ID: 923631510

View in Genome Browser
Species Human (GRCh38)
Location 1:235651663-235651685
Sequence TTTTAGAGATGCAGACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1363
Summary {0: 1, 1: 0, 2: 21, 3: 236, 4: 1105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923631505_923631510 13 Left 923631505 1:235651627-235651649 CCAAGACCAGTAGAATCAGCGTG 0: 1
1: 0
2: 1
3: 30
4: 260
Right 923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG 0: 1
1: 0
2: 21
3: 236
4: 1105
923631504_923631510 14 Left 923631504 1:235651626-235651648 CCCAAGACCAGTAGAATCAGCGT 0: 1
1: 0
2: 3
3: 40
4: 283
Right 923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG 0: 1
1: 0
2: 21
3: 236
4: 1105
923631506_923631510 7 Left 923631506 1:235651633-235651655 CCAGTAGAATCAGCGTGTCACCT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG 0: 1
1: 0
2: 21
3: 236
4: 1105
923631503_923631510 25 Left 923631503 1:235651615-235651637 CCAGAGTGGATCCCAAGACCAGT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG 0: 1
1: 0
2: 21
3: 236
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923631510 Original CRISPR TTTTAGAGATGCAGACTCCC AGG Intergenic
901500076 1:9646927-9646949 TTTTTGAGATGGAGTCTCCCAGG - Intergenic
901682017 1:10918626-10918648 TGTCAGAAATGCAGAATCCCAGG - Intergenic
902263604 1:15245847-15245869 TTTTAGAAATGCGGACTTCTGGG - Intergenic
902346873 1:15824697-15824719 TATTATAGCTGCAGCCTCCCAGG - Intergenic
902471864 1:16653480-16653502 TGTTAGAAATGCAGATTCTCAGG - Intergenic
902486940 1:16753964-16753986 TGTTAGAAATGCAGATTCTCAGG + Intronic
902508166 1:16951284-16951306 TATTAGACATGCAGATTCCCAGG + Intronic
902685987 1:18077995-18078017 TGTTAGAAATGCAGACTCACAGG + Intergenic
902780398 1:18701104-18701126 TTTTAGAAGTGCAGAATCTCAGG - Intronic
903666834 1:25013222-25013244 TTTTACAGATGAAGACGCCAAGG - Intergenic
903673490 1:25050374-25050396 TCTGACAGGTGCAGACTCCCAGG + Intergenic
903813510 1:26047525-26047547 TTTTATAAATACAGATTCCCAGG - Intergenic
903897184 1:26615094-26615116 TTTTAGAGAACCAGTTTCCCAGG + Intergenic
904054495 1:27661155-27661177 TTCTACAGAGGCAGACTCTCTGG + Intergenic
904109273 1:28112720-28112742 TGTTAGAAATACAGATTCCCGGG - Intergenic
904123096 1:28216046-28216068 TTTTAGAGATGGGGTCTCCCTGG + Intronic
904123255 1:28217318-28217340 TTTTAGAGATGGGGTCTCCCTGG + Intronic
904123414 1:28218603-28218625 TTTTAGAGATGGGGTCTCCCTGG + Intronic
904206111 1:28856328-28856350 TCTTAAAGATGAAGATTCCCAGG + Intronic
905007224 1:34719526-34719548 TGTTAGACATGAAGAATCCCAGG + Intronic
905247375 1:36624525-36624547 TTTCAGAAATGCAGATTCTCAGG + Intergenic
905248936 1:36635800-36635822 TTTCAGAGGTGCAGACTCCCAGG + Intergenic
905522578 1:38611886-38611908 TCTCAGTGCTGCAGACTCCCAGG + Intergenic
905773310 1:40652336-40652358 TCTTAGAAATGCAGAGTCTCAGG - Intronic
905943937 1:41885922-41885944 TTTTAAAGATGAAGACCCCAAGG + Intronic
906223943 1:44105771-44105793 TGTTAGAAATGCAGAATCCCTGG - Intergenic
906953952 1:50357317-50357339 TGATAGAGATACAGGCTCCCAGG - Intergenic
907306628 1:53516785-53516807 TTTTTGAGATGGAGTCGCCCAGG - Intronic
907374381 1:54023789-54023811 GGTTAGAGATGCAGATTCCCAGG + Intergenic
907800177 1:57757135-57757157 TTTTAGAAATGCAGAATCTCAGG - Intronic
907938589 1:59065360-59065382 TGTTAGAAATGCAGAATCTCAGG + Intergenic
908404039 1:63796374-63796396 TGTTAGAAATGCAGAGTCTCAGG + Intronic
908416813 1:63921315-63921337 TGTTAGAAATGCAAACTCGCAGG - Intronic
908670596 1:66543405-66543427 TTTTAGAGTTGCAGAAACCAAGG + Intronic
908799921 1:67869031-67869053 TGTTAGAAATGCAGAATCTCAGG - Intergenic
908839675 1:68266310-68266332 TTTTAGAAATACAGAATCTCAGG + Intergenic
908953793 1:69596067-69596089 TTCTGCAGATGCAGACTCACAGG - Intronic
909117989 1:71564110-71564132 TGTTAGAAATGCAGACTCTCAGG + Intronic
909480285 1:76122979-76123001 TATTAGAAATGCAGAATCTCAGG + Intronic
909576695 1:77184360-77184382 GTTTACAGATCCAGAATCCCTGG + Intronic
909730469 1:78882336-78882358 TTTTTGAGATGGAGTCTCCCAGG - Intergenic
909799182 1:79784132-79784154 TTTTAGAAATGCTGAATCTCTGG - Intergenic
909977775 1:82065406-82065428 TGTTAGAAATGCAGACTCTCAGG - Intergenic
910135117 1:83958872-83958894 TGTCAGAAATGCAGACTCTCAGG - Intronic
910235118 1:85027543-85027565 TGTTAGAGATGCACATTCTCAGG + Intronic
910238765 1:85063557-85063579 TTTTAAAAATGCGGAGTCCCAGG + Intronic
910241549 1:85092143-85092165 TGTTAGAAATGCAGAGTCGCAGG - Intronic
910433391 1:87180602-87180624 TGTTAGAAATGCAGAGTCTCAGG + Intergenic
910446237 1:87301445-87301467 TTTCAGAGATGCAGTTTCTCAGG + Intergenic
910839544 1:91548022-91548044 TTTAAGAAATGCAGAATCTCAGG + Intergenic
911203939 1:95074142-95074164 TATTAAAGGTGCAGACTCCCAGG + Intergenic
911231113 1:95362696-95362718 TCTTTAAAATGCAGACTCCCTGG + Intergenic
911263407 1:95714569-95714591 TGTTAGAAATGCAGAATCTCAGG - Intergenic
911345657 1:96693893-96693915 TTTTTGAGATGGAGTCACCCAGG + Intergenic
911599156 1:99829510-99829532 TGTTAGAAATGCAGAATCTCAGG - Intergenic
911659024 1:100478938-100478960 TGTTAGAAATGCACACTCTCAGG - Intronic
912201478 1:107462860-107462882 TTTTATAGATGCAGAAGCCAAGG + Intronic
912846964 1:113083233-113083255 TTTTTGATATGGAGTCTCCCAGG + Intronic
913212350 1:116592121-116592143 TGTTAGAAATGCAGACTCTCAGG + Intronic
913296901 1:117330683-117330705 TTTTTGAGTTGCAGAATCACAGG - Intergenic
913377670 1:118171976-118171998 ATTCAGAGATGGAGACTCCCAGG - Intronic
913562212 1:120032720-120032742 TGTTAGGAATGCAGATTCCCAGG - Intronic
913563740 1:120049352-120049374 TTTTAGAAATGCAATCTACCAGG + Intronic
913634384 1:120744211-120744233 TTTTAGAAATGCAATCTACCAGG - Intergenic
913635912 1:120760874-120760896 TGTTAGGAATGCAGATTCCCAGG + Intergenic
914282796 1:146192108-146192130 TGTTAGGAATGCAGATTCCCAGG - Intronic
914284333 1:146208726-146208748 TTTTAGAAATGCAATCTACCAGG + Intronic
914390419 1:147216763-147216785 TGTTAGAAATGCAGACTCTCAGG + Intronic
914543826 1:148642824-148642846 TGTTAGGAATGCAGATTCCCAGG - Intronic
914545365 1:148659467-148659489 TTTTAGAAATGCAATCTACCAGG + Intronic
914621203 1:149411207-149411229 TTTTAGAAATGCAATCTACCAGG - Intergenic
914622795 1:149428185-149428207 TGTTAGGAATGCAGATTCCCAGG + Intergenic
915126974 1:153672566-153672588 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
915263839 1:154700263-154700285 TGTTAGAAATGCAGAATCTCAGG - Exonic
915541772 1:156572025-156572047 TGTTTGAGATGCAGATTCCTGGG - Intronic
915797974 1:158757004-158757026 TTTTAGAAATGCAGATGGCCAGG - Intergenic
915985803 1:160462898-160462920 TTGTAGACATTCAGATTCCCTGG + Intergenic
916145672 1:161736876-161736898 TCTCAGAAATGCAGACTCTCAGG - Intergenic
916184266 1:162115587-162115609 TTTTAGAAATGCAGACTCTCAGG + Intronic
916213419 1:162376088-162376110 TGTTAGAAATGCAGAATCTCAGG - Intronic
916308039 1:163361692-163361714 TTTTAGAAATGCAGGATCGCAGG - Intergenic
916520985 1:165563337-165563359 TGTTAGAAATGCAGAATCTCAGG - Intronic
916617034 1:166452579-166452601 TTTTACAAATGCAGAAACCCAGG + Intergenic
916734483 1:167595500-167595522 TGTTAAAAATGCAGAGTCCCAGG - Intergenic
916899510 1:169205586-169205608 TTTTACAGATGAAGAATCTCAGG + Intronic
917137695 1:171803355-171803377 TTTTAAAAATGCAGATTCCTTGG - Intronic
917232017 1:172847497-172847519 CATTAGAGATGCAGATTCTCAGG - Intergenic
917265406 1:173215953-173215975 TGTTAGAAAAGCAGAATCCCAGG + Intergenic
917398184 1:174616842-174616864 TGTTAAAAATGCAGACTGCCTGG + Intronic
917510822 1:175667985-175668007 TGTTAGAAATGCAGAATCTCAGG + Intronic
917599988 1:176564177-176564199 TGTTAGAAATGCAGAATCTCAGG - Intronic
917602489 1:176590912-176590934 TTTTATAGATGCAGACACTGAGG - Intronic
917708769 1:177662224-177662246 TTTTAGAGATGAATTCTGCCAGG + Intergenic
917810525 1:178653773-178653795 TTTTCAAAATGCAGACTCCTGGG + Intergenic
917852727 1:179079212-179079234 TGTTAGAAATGCAGAATCTCAGG - Intergenic
918189095 1:182154920-182154942 TTTTTGAAATGCAGACACACAGG + Intergenic
918371807 1:183868482-183868504 TGTGAGAAATGCAGACTCTCAGG + Intronic
918653733 1:186998759-186998781 TTTTGGAGATGGAGTCACCCAGG + Intergenic
920479785 1:206310743-206310765 TCTTAGTGATGCTGACTGCCAGG - Intronic
920578130 1:207078334-207078356 CATTAGAAATGCAGAATCCCAGG + Intronic
920803226 1:209208447-209208469 TGTTAGAAATGCATACTCTCAGG + Intergenic
920842634 1:209567496-209567518 TTTAAGAGATGCAAACCCCCAGG - Intergenic
920960964 1:210663738-210663760 TGCTAGAGATGCAGATTCTCAGG + Intronic
921072811 1:211676052-211676074 AATTAGAAATACAGACTCCCGGG + Intergenic
921075520 1:211697515-211697537 TATTAGACATGCAGACTCTCAGG + Intergenic
921090588 1:211838401-211838423 TTTTAGAAATACAGAATCTCAGG + Intergenic
921135045 1:212252476-212252498 TATTAGAAATGCAGATTCTCAGG + Intergenic
921369934 1:214411583-214411605 TTTTACATATGCATATTCCCTGG - Intronic
922168201 1:223133447-223133469 CGTTAGAAATGCAGACTCTCAGG - Intronic
922351281 1:224736508-224736530 TTTTAAAAATGCAGATTCCTGGG + Intronic
922614616 1:226954460-226954482 TGTTAGAGATGCAGATTCCCGGG + Intronic
923458219 1:234184879-234184901 TATTAGAAATGCAGAATCTCAGG + Intronic
923586670 1:235279092-235279114 TGTTAGAAATGCAAATTCCCAGG + Intronic
923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG + Intergenic
923893597 1:238243016-238243038 TTGTAGAAATGCAGAATCTCAGG + Intergenic
923984215 1:239362351-239362373 TTTTAGAAATGCAGATTCCTGGG + Intergenic
924066971 1:240233868-240233890 TTTTAGTGATCCAGAAACCCTGG + Intronic
1063277770 10:4589861-4589883 TTTTAAAAATGCAGACTTCAGGG + Intergenic
1063290039 10:4735801-4735823 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
1064152658 10:12877697-12877719 TGTTAGAGATGCCGAGTACCTGG + Intergenic
1064602765 10:17010051-17010073 TGTTAGAAATGCAGATTCACGGG + Intronic
1064606388 10:17045373-17045395 TTTTTGAGATGGAGTCTCACTGG + Intronic
1066606388 10:37178438-37178460 TTTTAAAAATGCAGAATCCCAGG - Intronic
1067523057 10:47022447-47022469 TTTCAGAGCTGCTGTCTCCCAGG - Intergenic
1067773345 10:49143448-49143470 TGTTAGAGATGCAAATTCCCAGG + Intergenic
1069015693 10:63426643-63426665 TTTTTGAGACGGAGTCTCCCAGG - Intronic
1069271952 10:66539796-66539818 TGTTAGACATGCAGAATCTCAGG + Intronic
1069427348 10:68300510-68300532 TGTTAGAAATGCAGAGTCCGAGG + Intronic
1069554814 10:69390760-69390782 TGTTAGAGATGCAGGCTCTCAGG + Intronic
1069749070 10:70734255-70734277 TATTAAAAATGCAGACCCCCTGG + Intronic
1069850218 10:71399253-71399275 TGTTAGAAATGCAGACTCTTGGG + Intronic
1070074750 10:73123946-73123968 TTTTAGAGATGGGGTCTCACTGG + Intronic
1070103160 10:73407454-73407476 CTTTAGAAATGCAGAATCTCAGG - Intronic
1070485525 10:76927026-76927048 TTTTACAGATGAAGACACCAAGG - Intronic
1070534749 10:77367481-77367503 TATAAGAAATGCAGAGTCCCAGG + Intronic
1070873030 10:79774788-79774810 TGTGAGAAATGCAGAATCCCAGG + Intergenic
1070942414 10:80358723-80358745 TTGTTGAGATGCAGAATCTCAGG - Intronic
1071417421 10:85454230-85454252 TTTAAGAGATGCAGATTCTCAGG - Intergenic
1071516765 10:86302846-86302868 TGTTAGAAATGCAGAATCTCAGG + Intronic
1071639956 10:87296939-87296961 TGTGAGAAATGCAGAATCCCAGG + Intergenic
1071655278 10:87441010-87441032 TGTGAGAAATGCAGAATCCCAGG - Intergenic
1071855964 10:89624734-89624756 TGTTAAAAATACAGACTCCCAGG + Intronic
1071983922 10:91031871-91031893 TTTTAAAAATGCAGAATCTCAGG - Intergenic
1072019364 10:91383026-91383048 GTTTGGAGATGCAGCCTCACAGG + Intergenic
1072186359 10:93042960-93042982 TTTTTGAGATGGAGTCGCCCAGG + Intronic
1072225904 10:93368408-93368430 TGTTAAGCATGCAGACTCCCAGG - Intronic
1072447852 10:95515210-95515232 TGCTAAAGATGCAGATTCCCTGG - Intronic
1072570481 10:96653984-96654006 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1072910932 10:99499986-99500008 TTTTTGAGAAGCAGTCTCACTGG - Intergenic
1073552601 10:104417016-104417038 CTTTAGAAATGCAGGATCCCTGG + Intronic
1073584189 10:104692945-104692967 TGTTAAAAATGCAGATTCCCAGG - Intronic
1073620567 10:105043294-105043316 TGTTAGAAATGCAGAATCTCAGG + Intronic
1073704930 10:105972380-105972402 TCTCAAAAATGCAGACTCCCAGG - Intergenic
1074894278 10:117761397-117761419 TGTTAGAGATGTAGACTCTCAGG - Intergenic
1074921052 10:118012634-118012656 TTTTAGAGAGGAAAACTCTCAGG + Intronic
1075283245 10:121159610-121159632 TTTTATAGATGCAGACACCAAGG + Intergenic
1075418684 10:122285007-122285029 TATTTGAGATGCAAACCCCCCGG + Intronic
1075487873 10:122840769-122840791 TTTCACACATCCAGACTCCCAGG - Intronic
1075853816 10:125610444-125610466 TGTTAGAAATGCAGACTCTCAGG + Intronic
1075868026 10:125744363-125744385 TTTTAGAGATGAAGTCTTGCTGG + Intronic
1076386258 10:130058143-130058165 TATTCGAAATGCAGAATCCCAGG + Intergenic
1076388600 10:130077674-130077696 TTTTAGAGATGCAAGATCCCTGG - Intergenic
1078361044 11:10667837-10667859 TTTTAGCCATACAGATTCCCAGG - Intronic
1078608149 11:12795692-12795714 TTTTGGAAATGCAGAGTCTCAGG + Intronic
1078655671 11:13236520-13236542 TATTAGAAATGCAGAATCTCAGG - Intergenic
1078863730 11:15277363-15277385 TTTTACAGATGAAGAATCCAGGG + Intergenic
1079355443 11:19726742-19726764 TGTTAGAAATGCAGAATCCCAGG + Intronic
1079797776 11:24827737-24827759 TTTTATAAATGCAGAGCCCCAGG - Intronic
1079909075 11:26286633-26286655 TGTTAGAGATGCAGACACTCAGG - Intergenic
1080007784 11:27428161-27428183 TTTTTGAGATGCAGTCACCCAGG + Intronic
1080010674 11:27455862-27455884 TTTTAGAGATGGAGAAACCATGG - Intronic
1080160606 11:29170761-29170783 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1080249150 11:30213629-30213651 TGTTAGACATGCAGAATCCCGGG + Intergenic
1080447677 11:32352373-32352395 TTTTAGAAATGCAGACCTCAAGG - Intergenic
1080493148 11:32789468-32789490 TTTTAAAAATACAGACACCCAGG + Intronic
1080550253 11:33368356-33368378 TGTTAGAAATGCAGACTCTGGGG + Intergenic
1080556431 11:33421451-33421473 TGTTAGAAATGCAGAATCCTAGG + Intergenic
1080643896 11:34174452-34174474 GCTTAGAGCTGCAAACTCCCGGG + Intronic
1080919025 11:36690101-36690123 TGTTAGAGAAGCAGACTCTCAGG + Intergenic
1080967445 11:37229754-37229776 TGTTAGAAATGCAGACTCTCGGG - Intergenic
1081005210 11:37727784-37727806 TCTTAGAAATGCAGACTCTTGGG + Intergenic
1081268838 11:41059735-41059757 TGTTAGAAATGCAGAATCTCTGG + Intronic
1081289825 11:41310404-41310426 ATTTAGAGAATCAGACTGCCTGG + Intronic
1081361745 11:42188441-42188463 TTTTAGAGATGAAGACACTGAGG - Intergenic
1081855446 11:46300433-46300455 TGTTAGACATGCAGATTCTCGGG + Intronic
1082221494 11:49643689-49643711 TGTTAGAAATTCAAACTCCCTGG + Intergenic
1082931775 11:58615713-58615735 TATTAGAGATACAGAATCTCAGG + Intronic
1083155912 11:60822671-60822693 TGTTAGAAATGCAGAGTCTCAGG + Intergenic
1083230279 11:61313111-61313133 TGTTAGAAATGCAGATTCTCTGG - Intronic
1083354661 11:62057310-62057332 TTTTAGAGATGAAGAAACCAAGG + Intergenic
1083883738 11:65560667-65560689 TGTCTGAGCTGCAGACTCCCGGG - Intergenic
1084574871 11:69982622-69982644 TTTTACAGATGCACAAACCCGGG + Intergenic
1084605315 11:70168727-70168749 TTTTAAAAATGCAGCCTGCCAGG - Intronic
1084696999 11:70761702-70761724 TGTTAGGAATGCAGGCTCCCAGG - Intronic
1084855654 11:71984094-71984116 TTTTAGGGATGAAGACTTCAAGG - Intronic
1084974799 11:72790855-72790877 TTTCAGAAATGCAGGCACCCAGG + Intronic
1085104542 11:73830867-73830889 TTTTTGAGATGGAGTCTTCCTGG + Intronic
1085131088 11:74039475-74039497 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1085442602 11:76578073-76578095 GGTTAGAAATGCAGACTCTCAGG - Intergenic
1085907248 11:80778463-80778485 TGTTAGTGATGCAGAATCTCAGG - Intergenic
1086044334 11:82514965-82514987 TACTAGACATGCAGAATCCCAGG - Intergenic
1086252842 11:84837896-84837918 TGTAAGAAATGCAAACTCCCAGG + Intronic
1086477505 11:87193087-87193109 TTTTTGAGATGGAGTCACCCAGG - Intronic
1086543600 11:87942257-87942279 TTTTAGAAATGCAGAATTTCAGG - Intergenic
1086627550 11:88975463-88975485 TGTTAGAAATTCAAACTCCCTGG - Intronic
1086858123 11:91891437-91891459 TTTTACAGATGAAGACTTCGAGG + Intergenic
1086886994 11:92217588-92217610 TGTTAGAAATGCAAATTCCCAGG - Intergenic
1086974880 11:93120200-93120222 TGTTACAAATGCAGACTCTCAGG - Intergenic
1087152053 11:94868080-94868102 TCTTAGAAATACAGAATCCCAGG + Intronic
1087523909 11:99282840-99282862 TTCCACAGATGCTGACTCCCAGG - Intronic
1087644699 11:100794492-100794514 TGTTAGAAATGCAGACTCTCAGG - Intronic
1087767672 11:102174047-102174069 TGTTAGAAATGCAGAATCTCAGG - Intronic
1087817851 11:102678808-102678830 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1088398641 11:109398178-109398200 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1088439126 11:109848903-109848925 TGTTAGAAATGCAGATTTCCAGG - Intergenic
1088567665 11:111189900-111189922 TACTAGAAATGCAGACTCTCAGG - Intergenic
1088597976 11:111454047-111454069 TGTTAGAAATGCAGAATCTCAGG - Intronic
1088707855 11:112479969-112479991 TTCTAGAAATGCAGAAGCCCAGG - Intergenic
1088926124 11:114305076-114305098 TTTTAGAAATGCAGGCTGTCAGG + Intronic
1089568417 11:119385565-119385587 TGTTAGAAATGCAGATTCCTGGG - Intergenic
1089904975 11:122029346-122029368 TTTCATAGATGAAGAGTCCCAGG - Intergenic
1090167768 11:124569767-124569789 TTTTAGAGATGCAAATTCTCAGG - Intergenic
1090525452 11:127529569-127529591 TTTTTGAGATGGAGTCTCGCTGG - Intergenic
1090672172 11:128956107-128956129 TTTCAAAAATACAGACTCCCAGG - Intergenic
1090828440 11:130404301-130404323 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1090945158 11:131423075-131423097 TTTTAGAAAGGCAGACTCTCAGG + Intronic
1091026190 11:132143272-132143294 TGTCAGAAATGCAGCCTCCCAGG + Intronic
1091834277 12:3574415-3574437 TTTTTAAAATGCAGACTCCAGGG - Intronic
1091899461 12:4133356-4133378 TCTTAGAAATGCAGACTCTCAGG - Intergenic
1092813233 12:12290799-12290821 TGTTAGACATGCAGATTCCCAGG - Intergenic
1093057632 12:14570474-14570496 ATGTAAAAATGCAGACTCCCTGG + Intergenic
1093204726 12:16233771-16233793 TGTTAGACATGCAGAATCTCAGG + Intronic
1093381475 12:18499858-18499880 TGTTAGAAATGCAGAATCTCAGG + Intronic
1093564286 12:20583534-20583556 CTGTAGAGTTGCAGACTGCCTGG + Intronic
1093627699 12:21369715-21369737 TATTAGAAATGCAGAATCTCAGG - Intronic
1094166251 12:27446843-27446865 TGTTAGAAATGCAAATTCCCAGG - Intergenic
1094487640 12:30937731-30937753 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1095311791 12:40706905-40706927 TGTTAGAAATGCAGATTCCTGGG - Intronic
1095374134 12:41505876-41505898 TATTAGAAATACAGAATCCCTGG - Intronic
1095382470 12:41612204-41612226 TATTAGAGATGCAGAATCTCTGG + Intergenic
1095516534 12:43012406-43012428 TGTTGGAAATGCAGAATCCCAGG - Intergenic
1095626031 12:44316612-44316634 TTTTAAAGAGGTAGACACCCAGG - Intronic
1095727306 12:45468402-45468424 TGTGAGAAATGCAGACTCTCAGG + Intergenic
1095738510 12:45584085-45584107 TAGTAGAAATGCAGAATCCCAGG - Intergenic
1095997137 12:48097551-48097573 TGATAGAAATGCAGACTCTCAGG - Intronic
1096224234 12:49854741-49854763 TGTCAGAAATGCAGACTCTCAGG - Intergenic
1097387105 12:58963098-58963120 TTTTTGAGATGGAGTCACCCAGG + Intergenic
1097470192 12:59980943-59980965 TTTTAGAAATGCAGATCCACTGG + Intergenic
1097602287 12:61707843-61707865 TTTTAAAGATTAAGACTCACAGG - Intergenic
1097691432 12:62738210-62738232 TGTTAGAAATGCAGAATCTCAGG + Intronic
1098536639 12:71600686-71600708 TGTTAGAAATGCAGAGTCTCAGG - Intergenic
1098601147 12:72332824-72332846 TGTTAGAAATGCAGAATCTCTGG + Intronic
1098601529 12:72336971-72336993 TGTTAGAAATGCAGAATCTCAGG + Intronic
1098999532 12:77162173-77162195 CTTTGGAGCTGCAGTCTCCCAGG - Intergenic
1099012297 12:77305898-77305920 TATTAGAAATGCAGAATCTCAGG + Intergenic
1099119576 12:78671476-78671498 TGTTAGAAATGCAGACTTTCTGG - Intergenic
1099439131 12:82680636-82680658 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
1099893716 12:88619486-88619508 TTTTAGAAATGAAGACTTCCTGG - Intergenic
1100042403 12:90336313-90336335 TTTTATAAATGCAGTGTCCCAGG - Intergenic
1100197506 12:92263964-92263986 TTTTAAAAATGGAGACTCCTGGG - Intergenic
1100288548 12:93191160-93191182 TTTTAAAAATGCAGATTCCTAGG + Intergenic
1100365820 12:93919471-93919493 TTTTGGAGGTGCAGAAACCCTGG + Intergenic
1101203548 12:102462055-102462077 TTTTAGAAATGCAGAGTCAGGGG - Intronic
1101210111 12:102526850-102526872 TGTTAAACATGCAGACTCCTGGG - Intergenic
1101415599 12:104505464-104505486 TTTCAGAAATACAGACTCTCAGG - Intronic
1101709297 12:107249936-107249958 TTTTCAAAATGCAGATTCCCAGG + Intergenic
1101755421 12:107617479-107617501 TGTTAAAAATGCAGATTCCCAGG + Intronic
1102253208 12:111401467-111401489 TTTTACAGATGCAGACACTGAGG - Intergenic
1102367015 12:112346319-112346341 TGTTAAACATGCAGATTCCCAGG - Intronic
1102556295 12:113728929-113728951 TGTTAGGAATGCAGAGTCCCGGG - Intergenic
1102634719 12:114312811-114312833 GGTTAGAGATGCTGAATCCCAGG - Intergenic
1102727256 12:115076667-115076689 TGTTAGAAATGCAGATTCTCAGG - Intergenic
1102806073 12:115782161-115782183 TGTTAGAGATGCAGAACCTCAGG - Intergenic
1102818912 12:115891475-115891497 TGTTGGAAATGCAGAGTCCCAGG + Intergenic
1102945507 12:116984279-116984301 TATTAGAAATGCAGACTGTCAGG - Intronic
1102957993 12:117071909-117071931 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1103010542 12:117455255-117455277 GTTTGGAGATGGAGACTCCAGGG + Exonic
1103281900 12:119765217-119765239 TTGTAGAGATGGGGTCTCCCGGG - Intronic
1103922526 12:124406375-124406397 GGTTAGAAATGCAGAGTCCCAGG - Intronic
1104345535 12:127993409-127993431 TTTTTGAGATGGAGTCACCCAGG + Intergenic
1104400758 12:128474206-128474228 TCTTAAAAATGCAGATTCCCAGG - Intronic
1104420417 12:128630189-128630211 TGTTAGGGATGCAGATTCCTGGG - Intronic
1104623159 12:130333338-130333360 TGATAGAAATGCAGATTCCCAGG - Intergenic
1104704732 12:130934507-130934529 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
1104738479 12:131154656-131154678 TGTAAGAAATGCAGAATCCCAGG - Intergenic
1104794306 12:131506474-131506496 TGTCAGAAATGCAGAGTCCCAGG + Intergenic
1104896845 12:132168896-132168918 TCTTAGAAATGCAGAGTCCCGGG + Intergenic
1104951206 12:132441317-132441339 TGTTAAACATGCAGATTCCCTGG + Intergenic
1105215594 13:18282744-18282766 TGTTAGAAATGCAGACTCTCAGG + Intergenic
1105525962 13:21177958-21177980 TTTTTGAGATGCAGTCTCCCAGG - Exonic
1105594250 13:21821291-21821313 TCTTAGAAATGCAGAATCCCAGG + Intergenic
1106061037 13:26292325-26292347 TATTAGAAATGCAGAATCTCAGG + Intronic
1106633693 13:31504682-31504704 TGATAGAAATGCAGAATCCCGGG - Intergenic
1106852398 13:33808605-33808627 TTTTAGAGACACAGATTCCCAGG - Intergenic
1107419784 13:40235363-40235385 ATTTAGAAATGCAGAATCTCAGG - Intergenic
1107488816 13:40859870-40859892 TTTTAGAGAAGGAGTCTCACTGG - Intergenic
1107523118 13:41203052-41203074 TGTTAGAAATGCAGAATCACAGG + Intergenic
1107542799 13:41408765-41408787 TGTTAGAAATGCAGATTCCTGGG + Intergenic
1107705046 13:43094344-43094366 TGTTAGACATGCAGACTCTTAGG + Intronic
1108003322 13:45924236-45924258 TTTTAGAAATGCAAATTCCTGGG + Intergenic
1108112109 13:47085308-47085330 TCATAGAAATGCAGAATCCCAGG - Intergenic
1108467180 13:50727987-50728009 TGTTAGAAATGCAAACTCTCAGG - Intronic
1108510558 13:51151967-51151989 TGTTAGAAATGCAGAATCTCTGG + Intergenic
1108514802 13:51190983-51191005 AATTAGAAATGCAGACTCTCTGG + Intergenic
1108520037 13:51238296-51238318 TGTTAGAAATGCAGAATCCCAGG + Intronic
1108671137 13:52689941-52689963 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1109727026 13:66354985-66355007 TGTTAGAAATGCAGACTCTCAGG - Intronic
1110014143 13:70378985-70379007 TTTCAGAGATTTAGAATCCCAGG - Intergenic
1110340064 13:74379372-74379394 TTTTAGAGATGAAGAGAGCCAGG - Intergenic
1111403081 13:87766835-87766857 TTTTAGAAATGCAAATTCTCAGG + Intergenic
1111657707 13:91174272-91174294 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1111868269 13:93797204-93797226 TGTTAGAAATGCAGAATCTCAGG - Intronic
1111913233 13:94334850-94334872 TTTTATAGATGAAGACTCTGGGG - Intronic
1111986002 13:95067570-95067592 TGTTAGAAATGCAGACTGTCAGG - Intronic
1112017991 13:95347295-95347317 TATGAGAAATGCAGACTCTCAGG - Intergenic
1112212966 13:97399569-97399591 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1112258737 13:97858497-97858519 CTTTAGAGATGCAGAGCTCCAGG - Intergenic
1112290460 13:98141625-98141647 TGTTAGAAATGCAAACTCTCAGG + Intergenic
1112437001 13:99397719-99397741 GCTTAGACATGCAGACTCTCAGG + Intergenic
1112678549 13:101734109-101734131 TGTTAGAAATGCAGAATCCCAGG + Intronic
1113245329 13:108388580-108388602 TGTTAGACCTGCAGACTCTCAGG + Intergenic
1113840721 13:113359398-113359420 TTGTAGAGATGGAGTCTCCTGGG - Intronic
1114187895 14:20416995-20417017 TGTTAGAAATGCAGACTCTCAGG + Intergenic
1114854215 14:26418126-26418148 TCTTAGAAATGCAGAATCTCAGG + Intergenic
1115050749 14:29059773-29059795 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1115270871 14:31550808-31550830 GGTCAGAGTTGCAGACTCCCTGG + Intronic
1115440224 14:33425864-33425886 TGTTAGAAATGCAGATTCCTAGG + Intronic
1116041582 14:39692520-39692542 TGTTAGAAATGCAGACTCTCTGG - Intergenic
1116185018 14:41589019-41589041 TTTTAGAAGTGCAGATTCTCAGG - Intergenic
1116713154 14:48395463-48395485 TGTTAGAAATGCAGACTCTCAGG + Intergenic
1116811771 14:49546468-49546490 TTTTAAAGATCAAGACTTCCAGG - Intergenic
1116909685 14:50447007-50447029 CTTTAGAAATGCAGATTCCTAGG - Intronic
1117045774 14:51811668-51811690 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1117097326 14:52312257-52312279 TGTTTGAGATGCATATTCCCAGG + Intergenic
1117362620 14:54992180-54992202 TTTTTGAGACGGAGTCTCCCGGG - Intronic
1117408620 14:55429316-55429338 TGTTAGAAATGCAAAGTCCCAGG + Intronic
1117521298 14:56553837-56553859 TATTAGAAATGCAGACTCTCAGG + Intronic
1117838856 14:59836381-59836403 TTATAGAGATGAGGACTCTCAGG + Intronic
1117884502 14:60346260-60346282 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1118200983 14:63673012-63673034 TGTTAGGAATGCAGACTCCTGGG - Intergenic
1118463659 14:66011658-66011680 TGTTAGAAATGCAGAATCCCAGG + Intergenic
1118588096 14:67375778-67375800 TTTTAGAAATACAGACTCTCAGG + Intronic
1118945500 14:70382531-70382553 TGTTAGAAATGCAGAATCTCAGG - Intronic
1119186543 14:72646848-72646870 TTTTAAACATGCAGATTCTCAGG + Intronic
1119192968 14:72696808-72696830 TGTTAGAGATGCAAACTCTTGGG + Intronic
1119229858 14:72971240-72971262 TTTTAAAAATGCAGAAGCCCAGG + Intronic
1119408824 14:74415394-74415416 TGTTAGAAATGCAAATTCCCAGG - Intronic
1119510972 14:75210942-75210964 TTTTAGAAATGCAGACGCTCAGG - Intergenic
1119587333 14:75848751-75848773 TTATGGAGATAGAGACTCCCTGG - Intronic
1119678432 14:76573760-76573782 TGTTAGAAATGCAGAATCTCGGG - Intergenic
1119953736 14:78772697-78772719 TGCTAGAAATGCAGAATCCCAGG - Intronic
1119970533 14:78965265-78965287 TGTTAGAAATGCAGATTCTCAGG + Intronic
1120004481 14:79341447-79341469 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1120033547 14:79669757-79669779 TGTTAAAAATGCAGACTCTCAGG + Intronic
1120122052 14:80693019-80693041 TTTTAGAAATGTAGACTCTCAGG - Intronic
1120197835 14:81505603-81505625 TTATAGAGATGCTGACTCTAAGG - Intronic
1120205947 14:81587908-81587930 TTTGGGAAATGCAGTCTCCCTGG - Intergenic
1120222079 14:81745848-81745870 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1120566391 14:86063580-86063602 TCTTTGAGAAGCAGACTCCAAGG - Intergenic
1120713059 14:87813046-87813068 TTTTAGAAATGCGGAATCTCGGG - Intergenic
1120835535 14:89035546-89035568 TTTTACAGATGCAGACTTTGTGG + Intergenic
1120880107 14:89409021-89409043 TGTGAGAGGTGCAGGCTCCCAGG - Intronic
1121055256 14:90846613-90846635 TTTTAGAGAAGAAGAATCCAAGG + Intergenic
1121149522 14:91618895-91618917 TGTTAGAAATGCAGAATCTCAGG - Intronic
1121173929 14:91876373-91876395 TGTTAGAAATGCAGATTCCTGGG + Intronic
1121439036 14:93937216-93937238 CTGTTGAAATGCAGACTCCCCGG + Intronic
1121615019 14:95307932-95307954 CTTCACAGATGCAGACTCCGAGG - Intronic
1121907826 14:97763618-97763640 GTCTCTAGATGCAGACTCCCAGG - Intronic
1123457019 15:20435544-20435566 TGTTAGAAATGCAGACTCCCAGG - Intergenic
1123661043 15:22564815-22564837 TGTTAGAAATGCAGACTCCCAGG + Intergenic
1124001482 15:25764142-25764164 TTGAAGAAATGCAGAGTCCCAGG - Intronic
1124263173 15:28210697-28210719 TGTTAGAAATGCAGACTCCCAGG - Intronic
1124314843 15:28659049-28659071 TGTTAGAAATGCAGACTCCCAGG + Intergenic
1126182657 15:45801013-45801035 TGTCAGAAATGCAGAATCCCAGG - Intergenic
1126419233 15:48454184-48454206 TATTAGAAATTCAGACTCTCAGG - Intronic
1126562690 15:50060795-50060817 TGTTAGAAATGCAGACTCTCGGG - Intronic
1126641684 15:50833321-50833343 TTTTAGAGATGCATACTAAAGGG - Intergenic
1127283086 15:57508805-57508827 TGTTAGAAATGCAGAGTCCTGGG + Intronic
1127337296 15:58000785-58000807 ATGTAGAAATGCAGACTCTCTGG - Intronic
1127377590 15:58399082-58399104 TATTAGAAATGCAGACTCTCAGG + Intronic
1127393578 15:58526178-58526200 TGCTGGAGATGCAGACTCCTGGG - Intronic
1127675845 15:61238132-61238154 TAATAGAGATGCAGATTCTCAGG + Intergenic
1127800968 15:62477244-62477266 TGTTAGAAATGCAGACTCTCAGG - Intronic
1128541644 15:68538889-68538911 TCTTAGAAATGAAGATTCCCTGG - Intergenic
1128556369 15:68634637-68634659 TGTTAGGGATGCAGATTCTCGGG + Intronic
1128556431 15:68635029-68635051 TTGTGGAAATGCAGGCTCCCGGG - Intronic
1128880760 15:71240477-71240499 TGTTGGAAATGCAGACTCTCAGG + Intronic
1128906917 15:71475535-71475557 TGTTAAAAATGCAGACTCTCAGG - Intronic
1129032188 15:72627543-72627565 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1129217708 15:74109696-74109718 TGTTAGAAATGCAGATTCTCAGG - Intronic
1129406953 15:75326281-75326303 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1129470158 15:75749151-75749173 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1129610999 15:77056945-77056967 TGTTAGAAATGCAGACTCTCAGG - Intronic
1129695583 15:77739064-77739086 TGTGAGAGCCGCAGACTCCCTGG - Intronic
1129734870 15:77953991-77954013 TGTTAGAAATGCAGATTCTCAGG - Intergenic
1129782742 15:78284568-78284590 TGTTAGAAATGCAGAATCCCAGG + Intronic
1129798819 15:78398060-78398082 TGTTACAAATGCAGACTCTCAGG + Intergenic
1129817841 15:78571094-78571116 TGTTAGAAATGCAGAGTCTCAGG - Intronic
1129840721 15:78742000-78742022 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1129880286 15:79002088-79002110 TGTTAGAAATGCAGACTCTCAGG - Intronic
1129904690 15:79178181-79178203 TGTTAGAAATGCAGACTCTCGGG + Intergenic
1130737776 15:86568678-86568700 TGTTAGAAATGCAGACTCCCAGG + Intronic
1130918139 15:88322082-88322104 TCTTAGAAATGCACACTCTCAGG - Intergenic
1131287457 15:91073170-91073192 TTTAACAGATGCAGACTCAGAGG - Intergenic
1131306519 15:91248724-91248746 TGTTAGAGATGCAGAATCTCAGG + Intronic
1131319199 15:91369806-91369828 TTTAAGAGATGGAGTCACCCAGG - Intergenic
1131433682 15:92406304-92406326 TGTTAGAGATGCAAATTCTCAGG - Intronic
1131576110 15:93592927-93592949 TGTTAGAGATGCAAATTCTCTGG + Intergenic
1131601069 15:93849551-93849573 TTTTAAAAATGCAGCCTCTCAGG - Intergenic
1131788352 15:95937132-95937154 TTTTAGAGATTCAGACACAGGGG + Intergenic
1131927305 15:97399758-97399780 TTTAAGAAATGCAGAATCTCAGG + Intergenic
1132313159 15:100871681-100871703 TGATAGAAATGCAGACTCCCAGG - Intergenic
1133016657 16:2945615-2945637 TTTTTGAGATGTAGTCTTCCAGG - Intronic
1133406979 16:5532404-5532426 TCTTAGAGATGCAGAATCTCAGG + Intergenic
1133620052 16:7517926-7517948 TTTTACAGATGCAGAAACCGAGG - Intronic
1133664747 16:7955515-7955537 TTTTGGAGATGGAGTCGCCCAGG - Intergenic
1133835380 16:9362998-9363020 ATTTAGAGATGAAGTCACCCAGG + Intergenic
1133966001 16:10532139-10532161 CGTTAGAAATGCAGATTCCCTGG + Exonic
1134829416 16:17311245-17311267 GGTTAGAAATGCAGACTCCCAGG + Intronic
1134862376 16:17572105-17572127 TATGAGAAATGCAGACACCCAGG + Intergenic
1135044885 16:19147019-19147041 TGTTAGAAATGCAGAATCTCAGG - Intronic
1135046311 16:19158878-19158900 TGTCAGAAATGCAGAATCCCAGG - Intronic
1135055976 16:19232402-19232424 TGTTAGAAATGCAGAATTCCAGG - Intronic
1135068298 16:19330323-19330345 TCTTAGAAATGCAGGCTCTCAGG - Intergenic
1135072582 16:19364974-19364996 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1135101238 16:19607885-19607907 TTTTACAGATGCAGAGACCAAGG - Intronic
1135134682 16:19878892-19878914 CTTTAGAAATGCAGATTCTCAGG + Intronic
1135195928 16:20394637-20394659 TCATAGAAATGCAGACTCCCAGG - Intronic
1135392795 16:22107767-22107789 TGTTAGAAATGCAGAGTCTCAGG - Intronic
1135396076 16:22132619-22132641 TGCCAGAAATGCAGACTCCCAGG - Intronic
1135578256 16:23602841-23602863 TTTTTGAGATGGAGCCTCACTGG - Intergenic
1135644474 16:24149589-24149611 TTATTAAAATGCAGACTCCCAGG + Intronic
1135749406 16:25044887-25044909 TTTTTGAGATGGAGTCTCACTGG + Intergenic
1135982135 16:27156054-27156076 TGTCAGAAATGCAGACTCCCAGG - Intergenic
1136488156 16:30586270-30586292 TTATAGAGATGCAGAAGGCCAGG + Intergenic
1137238994 16:46638847-46638869 TGTTCGAAATGCAGATTCCCAGG + Intergenic
1137377235 16:47962594-47962616 TGTTAGAAATGCAGATTCTCAGG - Intergenic
1137405061 16:48182889-48182911 TTTTACAGATGAGGAATCCCAGG - Intronic
1137595459 16:49720613-49720635 TTTTAGGGAAGCAGAATCCTTGG - Intronic
1137604645 16:49779444-49779466 TGTTAGAAATGCAGAATCTCAGG + Intronic
1137684445 16:50376163-50376185 TGGTAGAGATGCAGAGTCTCAGG + Intergenic
1137891635 16:52169312-52169334 TATTAGAGATGCAGACTCTAGGG + Intergenic
1138401946 16:56753523-56753545 TTTTAGTAATGGAGACTCTCAGG + Intronic
1138420979 16:56898905-56898927 TGTTAGAAATGCAGAATCCCAGG + Intronic
1138449707 16:57086339-57086361 TCTTAGAAATGCAGAATCCCAGG - Intergenic
1138628687 16:58275264-58275286 CTTGGGAGCTGCAGACTCCCAGG - Intronic
1139587537 16:67913787-67913809 TATTAGAAATGCAGACCCTCAGG - Intronic
1139719184 16:68839122-68839144 TTTTAGAGATGAAGACACTGAGG - Intergenic
1140035085 16:71365630-71365652 TGTTAGGAATGCAGAATCCCAGG - Intronic
1140288289 16:73625736-73625758 TGTTAGACATGCAGATTCCTGGG - Intergenic
1140467742 16:75195968-75195990 TGTTAGCAATGCAGATTCCCAGG - Intergenic
1140609308 16:76579116-76579138 TGTTAGAAATGCAGACGCTCAGG - Intronic
1140951294 16:79820370-79820392 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1140966616 16:79972538-79972560 TGTTAGAAATGCAGATTCACAGG + Intergenic
1140972592 16:80027917-80027939 TGCTAGAAATGCAGACTCCCAGG - Intergenic
1141143637 16:81514078-81514100 TTTTAGGGATGAAGATTCACTGG - Intronic
1141207413 16:81943597-81943619 CATTAGAGATGCAGAATCTCAGG + Intronic
1141276481 16:82593069-82593091 TTTTGGAAATGCAGAATCCCAGG + Intergenic
1141459983 16:84172513-84172535 GGTTAGAAATGCAGACTCCCAGG + Intronic
1141501380 16:84446680-84446702 TATTAGAAATGCAGAATCTCAGG + Intronic
1141629195 16:85277511-85277533 TTTTAGAAATCCGGAATCCCAGG - Intergenic
1141688144 16:85581938-85581960 TTTGAAAAATGTAGACTCCCAGG - Intergenic
1141807923 16:86354247-86354269 TGATAGAAATGCAGAGTCCCAGG + Intergenic
1141888237 16:86908029-86908051 TGTTAGAGATGCAGGATCTCAGG - Intergenic
1142103835 16:88291514-88291536 TTTTACAGATGAAGACACCGGGG + Intergenic
1142396892 16:89837213-89837235 TGTTACAGATGCAGATTCTCAGG - Intronic
1142952850 17:3497819-3497841 TGTTAGACATGCAGAATCCCAGG + Intronic
1143332438 17:6147649-6147671 TTTTAGATACCCAGACTCCCAGG + Intergenic
1143396287 17:6600644-6600666 TGTTGGAAATGCAGACTCTCAGG - Intronic
1143407836 17:6689749-6689771 TTTTATACATGCAGACGCCCAGG + Intronic
1143417952 17:6763732-6763754 TGTTAGAAATGCAGAATCTCAGG + Intronic
1143673144 17:8410779-8410801 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1143761315 17:9106039-9106061 TATTAGTGATGCAAACTCCTGGG + Intronic
1143829148 17:9637175-9637197 TCTTAGAAATGCAGAATCTCAGG - Intronic
1144038821 17:11390480-11390502 AGTGAGAAATGCAGACTCCCAGG + Intronic
1144057722 17:11557489-11557511 TGTTAGAGATGCAAACTCTTGGG + Intronic
1144077741 17:11734171-11734193 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1144124752 17:12192683-12192705 TTTTAGAGATGCAGAATATTGGG + Intergenic
1144388461 17:14771541-14771563 TGTTAGAAATGCAGAATCCTTGG - Intergenic
1144458875 17:15441380-15441402 ACTTAGAGATGCAGATTCTCAGG - Intronic
1144479607 17:15618027-15618049 TGTTAGAAATACAGAATCCCTGG + Intronic
1144762514 17:17715372-17715394 TTTGAGAGATGCAGACACTGAGG - Intronic
1144918696 17:18745712-18745734 TGTTAGAAATACAGAATCCCTGG - Intronic
1145745029 17:27311655-27311677 TTTTTGAGATGTAGTCTCCCAGG + Intronic
1145842659 17:28009048-28009070 TTTTATAGTTGCATTCTCCCTGG + Intergenic
1146297366 17:31660337-31660359 TGTTAGAAATGCAGAGTCCCAGG + Intergenic
1146462478 17:33057149-33057171 TGTTAGAAATGCAGATTCCTGGG + Intronic
1146575255 17:33985414-33985436 TGTTAGAGATGCAGAATGTCAGG - Intronic
1146628759 17:34455063-34455085 TATTAGAAATGCAGAGTCTCAGG - Intergenic
1146639608 17:34530448-34530470 TATTAGAAATGCAGAGTCCCAGG - Intergenic
1146723297 17:35138346-35138368 TGTTAGAAATGCAGATTCCCAGG + Intronic
1147005090 17:37396449-37396471 TTTCAGAGATCCACAGTCCCAGG - Intronic
1147036835 17:37687903-37687925 TGTTAGAAATGCAGACTCTTAGG - Intronic
1147390991 17:40109065-40109087 TGTTAGAAATGCAAATTCCCAGG + Intergenic
1147547684 17:41415340-41415362 TGTTAGAAATGCAGACTCCCTGG - Intergenic
1147887263 17:43692490-43692512 TATTACAGATGCATATTCCCAGG + Intergenic
1147911249 17:43857574-43857596 TGTTAGAGATGCACTCTCCAGGG + Intronic
1148394981 17:47300593-47300615 TCTTAGAGTTGCACACACCCAGG + Intronic
1148433461 17:47662273-47662295 TTTTTGAGATGGAGTCTCCCAGG - Intronic
1148530562 17:48386523-48386545 TGTTAGCAATGCAGACTCTCAGG - Intronic
1148753354 17:49958946-49958968 TTTTACAGATGAAGACACCGAGG - Intergenic
1148976646 17:51535745-51535767 TGTTAGGAATGCAGACTCTCAGG + Intergenic
1149057862 17:52387284-52387306 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1149141943 17:53441753-53441775 TTTTTGAGATGGAGTCTCACAGG + Intergenic
1149455536 17:56785232-56785254 TGTTAGACATGCAAACTCTCAGG - Intergenic
1149985423 17:61343459-61343481 TTTTAAAGATACAGATGCCCAGG + Intronic
1150012841 17:61522551-61522573 TTTTTGAGATGGAGTCTCACTGG + Intergenic
1150122554 17:62616330-62616352 TTATAGAAATGCATACTCTCAGG + Intergenic
1150229356 17:63541687-63541709 TTTTAGAGATGAAGACTCTGGGG + Intronic
1150258137 17:63765911-63765933 TTTTGAAGATGCAGATACCCAGG - Exonic
1150605465 17:66686818-66686840 TATTAGAAATGCAGAAACCCAGG - Intronic
1150704768 17:67476916-67476938 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1151149245 17:72069464-72069486 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1151195739 17:72430177-72430199 TTTTAGAAAGGCAGAATCTCAGG - Intergenic
1151401032 17:73856346-73856368 TGTTAGAAATGCAGGCTCTCAGG - Intergenic
1151402748 17:73866545-73866567 TATTAGAAATGCAGATTCTCAGG + Intergenic
1151736357 17:75943199-75943221 TTTTTGAGATGGAGTCTCCCAGG - Exonic
1152030841 17:77842041-77842063 TCTTTGAGTTGCAAACTCCCAGG - Intergenic
1152422840 17:80203446-80203468 TGTTAGAAATGCAGAGTGCCAGG - Intronic
1152978356 18:246899-246921 TTTTTGAGACGGAGCCTCCCAGG - Intronic
1153323074 18:3792453-3792475 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1153555588 18:6310046-6310068 TGTTAGAAATGCAGATTCCTGGG - Intronic
1153971791 18:10233870-10233892 TTTCAAAGATGAAGACTCCAGGG + Intergenic
1154099282 18:11454886-11454908 TGTTAGAGTTTCAGAGTCCCAGG - Intergenic
1154477534 18:14777913-14777935 TTTTTGAGATGAAGTCTCACAGG - Intronic
1155208555 18:23581492-23581514 TTTTATAGATGCAGACATCAAGG - Intronic
1155707274 18:28831680-28831702 TGTTAGAAATGCAGACTCTTGGG + Intergenic
1155715232 18:28934037-28934059 TTTAAGAGTTGCAAACTCCTAGG + Intergenic
1155865940 18:30964837-30964859 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1155926025 18:31656004-31656026 TGTTAGAAATGCAGATTCTCAGG + Intronic
1155990136 18:32271572-32271594 TGTTAGAAATGCAGATTCCCAGG - Intronic
1156015225 18:32539613-32539635 TTTTTGAGATGTAGTCACCCAGG - Intergenic
1156047187 18:32889939-32889961 TATTAGAAATGCAGACACTCAGG - Intergenic
1156374404 18:36500632-36500654 TTTTACAGATGGAGAATCCAAGG + Intronic
1156408946 18:36809506-36809528 TTTAAGAGACTCAGACTCCTTGG + Intronic
1156466963 18:37353780-37353802 TTTTTGAGATGGAGTCACCCAGG + Intronic
1156695084 18:39755892-39755914 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1156822065 18:41384816-41384838 TGTTAGAAATGCAGACTCTCAGG + Intergenic
1156877960 18:42039155-42039177 TTTTCGAGATGAATAATCCCTGG + Intronic
1157201425 18:45663183-45663205 TGTTAGAAATGCAGAATCTCAGG - Intronic
1157347898 18:46856616-46856638 TGTTGGAAATGCAGACTCTCAGG + Intronic
1157371590 18:47117783-47117805 TTTTAGAGATGGAGTCTCTCTGG - Intronic
1157393648 18:47324201-47324223 TTTTAGAGACAGAGTCTCCCAGG - Intergenic
1157395980 18:47341517-47341539 TGTTAGAAATGCAAATTCCCAGG - Intergenic
1157618916 18:49004046-49004068 TGTTAGAAATGCAGTCTCTCAGG + Intergenic
1157681348 18:49609723-49609745 TGTTAGAAATGTAGAGTCCCAGG - Intergenic
1157807755 18:50670841-50670863 TATTAGAGATACAGATTCCCAGG + Intronic
1157921505 18:51717708-51717730 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1158036696 18:53040498-53040520 TTTTAAACATGCAGAATCCTTGG - Intronic
1158213007 18:55071010-55071032 TGTTAGAAATGCAGGCTCTCAGG + Intergenic
1158404831 18:57151766-57151788 TGTTAGAAATGCAGAGTCTCAGG - Intergenic
1158621162 18:59033668-59033690 TATTAGAAATGCAGATTCCCAGG - Intergenic
1158820833 18:61157262-61157284 TTTTACAGATGCAGAAACTCAGG - Intergenic
1158978557 18:62736233-62736255 TGTTAGAAATGCAGAATCTCAGG + Intronic
1159008587 18:63037175-63037197 CATTAGAAATGCAGATTCCCAGG - Intergenic
1159546906 18:69851213-69851235 TTTTTGAGATGCAGTCTCCCAGG + Intronic
1160362201 18:78293519-78293541 TGTCAGAAATGCAGACTCCCAGG + Intergenic
1160419750 18:78735762-78735784 GTTTTCAAATGCAGACTCCCGGG + Intergenic
1160841804 19:1149738-1149760 TGTGTGAGATGCAGACTCCCGGG - Intronic
1161128924 19:2576728-2576750 TTTTACAGATGGGGTCTCCCTGG + Intronic
1161492213 19:4568192-4568214 TGTCAGAAATGCAGAATCCCAGG + Intergenic
1161874274 19:6895557-6895579 TGTTAGAAATGCAAAATCCCCGG + Intronic
1162701184 19:12516145-12516167 TTTTTGAGATGGAGTCACCCAGG + Intronic
1163263410 19:16204633-16204655 CTTTGGAAATGCAGAATCCCAGG + Intronic
1163898986 19:20084077-20084099 TTTTTGAGACGGAGTCTCCCAGG + Intronic
1164464072 19:28472688-28472710 TGTTAGAAATGCAGAGTCCTAGG - Intergenic
1165279909 19:34786988-34787010 TTTTAAAAATGCATGCTCCCTGG + Intergenic
1165858982 19:38897102-38897124 TTTTACAGATGCAGAATCTGAGG - Intronic
1165864838 19:38930655-38930677 CGTTGGAGATGCAGCCTCCCCGG + Exonic
1165894449 19:39133176-39133198 TTTTACAGATGAGGACACCCGGG - Intronic
1166708143 19:44920102-44920124 TTTAAGAGATGGAGTCACCCAGG + Intergenic
1168038769 19:53741229-53741251 TTTTTGAGATGGAGTCGCCCAGG - Intergenic
1168047249 19:53802930-53802952 TTGTAGAGATGAAGTCTCACTGG + Intronic
1202704264 1_KI270713v1_random:10274-10296 TGTTAGAAATGCAGATTCTCAGG - Intergenic
926060877 2:9803981-9804003 TTTTTGAGATGGAGTCTTCCAGG + Intergenic
926172280 2:10559995-10560017 TTTTACAGATGTAGACACCAAGG + Intergenic
926432395 2:12801585-12801607 TGTTAGAAATGCAGACTCTCAGG - Intergenic
926503849 2:13686190-13686212 TTTTTGAGATGGAGTCACCCAGG - Intergenic
927318575 2:21716170-21716192 TTTTAGAGAAGAAAAATCCCTGG - Intergenic
927448328 2:23185300-23185322 TTTCAAATATGCAGATTCCCAGG + Intergenic
927702868 2:25278968-25278990 ATTTAGAAATGCAGAATTCCAGG - Intronic
927882870 2:26701040-26701062 TTTTGGAAATGCAGAATCTCAGG - Intronic
927983416 2:27390040-27390062 TTTTTGAGATGGAGTCTCCCAGG + Intronic
928016194 2:27660129-27660151 TTTTAGATATGCAGAATCTCAGG - Intronic
928121230 2:28584951-28584973 TTTTAGAGATGAGGAAACCCAGG - Intronic
928125960 2:28616425-28616447 TTTTAGAAATGCAGAGTCCTGGG + Intronic
928179494 2:29058013-29058035 ATTTAGGGATGCTGACTCCCAGG - Exonic
928497525 2:31849284-31849306 TTTTTGAGATGGAGTCACCCAGG - Intergenic
928732920 2:34253503-34253525 TGTTAAAAATGCAGAATCCCAGG + Intergenic
928824093 2:35398049-35398071 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
929287119 2:40147934-40147956 TTTTAGAGATGAAGAATCTGAGG + Intronic
929557300 2:42933693-42933715 TTTTACAGATGCAGAAACCACGG + Intergenic
929939537 2:46322533-46322555 TGTTAGAAATGCACACTCTCAGG - Intronic
930808720 2:55519142-55519164 CTTTTGAGACGCAGTCTCCCAGG + Intergenic
931009335 2:57890408-57890430 TGTTAGAAATGCACAATCCCAGG - Intergenic
931219296 2:60274738-60274760 TGATAGAAATGCAGAATCCCAGG + Intergenic
931629446 2:64285724-64285746 TGTTAGAAATGCTGACTCTCAGG - Intergenic
931700116 2:64902510-64902532 TGTTAGAAATGCAGATTCCCAGG - Intergenic
931731148 2:65154506-65154528 TATTAGAAATGCAGATTCTCAGG + Intergenic
931789039 2:65647027-65647049 TGTTAGATGTGCAGAATCCCAGG + Intergenic
931936747 2:67206679-67206701 TGTTAGAAATGCAGAATCTCAGG - Intergenic
931980676 2:67690801-67690823 TGTTAGAAATGCAGATTCTCAGG - Intergenic
931995308 2:67833983-67834005 TATTAGAAATGCAGATTCTCAGG + Intergenic
932015171 2:68018642-68018664 TGTTAGAAATGCACACTCTCAGG + Intergenic
932304577 2:70692860-70692882 TGTTAGAAATGCAGGCTCTCAGG - Intronic
932838426 2:75059290-75059312 TATTACAGATGCAGACTCTCAGG + Intronic
933093998 2:78155542-78155564 TGTTAGAAATGCAAATTCCCTGG - Intergenic
933279373 2:80315913-80315935 TGTTAGAAATGCAGAATCTCAGG + Intronic
933566963 2:83962083-83962105 GGTTAGAAATGCAGAATCCCAGG - Intergenic
933670217 2:85000149-85000171 TTTTTGAGATGGAGTCACCCAGG + Intronic
933694763 2:85209645-85209667 TTGTCGAAATGCAGACTCCTGGG + Intronic
933700014 2:85248358-85248380 TGTTAGAAATGCAGAGTTCCAGG - Intronic
933874319 2:86602923-86602945 TTTTTGAGATGGAGTCTCACTGG - Intronic
933881447 2:86673941-86673963 TTGTAGAAATGCAGAATCTCAGG - Intronic
934102121 2:88663262-88663284 TTTTAGAAATGCAGACACCCGGG - Intergenic
934298735 2:91763981-91764003 TGTTAGAAATGCAGACTCTCAGG - Intergenic
934717754 2:96553207-96553229 TGTTACCGATGCAGACACCCAGG - Intergenic
934747429 2:96768804-96768826 TGTCAGAAATGCAGACTCTCGGG - Intronic
935189016 2:100761004-100761026 TTTTAGAAATGCAAAGTCTCGGG - Intergenic
935333488 2:101994555-101994577 TATTAGAAATGCAGATTCTCAGG - Intronic
935538174 2:104318594-104318616 TGTTAGAAATGCAGAATCTCAGG + Intergenic
935562806 2:104576165-104576187 TTGTAGAAATGCAGACCCCCAGG + Intergenic
935583361 2:104779070-104779092 TGTTAGAGATGCACCCTCTCGGG - Intergenic
935679245 2:105621743-105621765 TTGTGGAAATGCAGACTCTCAGG + Intergenic
935746136 2:106191987-106192009 TATTAGTGATGCAGATTCTCAGG + Intronic
935782709 2:106521925-106521947 TGTTAGAAGTGCAGACCCCCAGG - Intergenic
935879060 2:107542907-107542929 TTTTAGTGATTCAGACACCTGGG + Intergenic
936394077 2:112106330-112106352 TGTTAGAGATGCAGAGTCTCAGG + Intronic
936407322 2:112217345-112217367 TTTTTGAGATGGAGTCACCCAGG - Intronic
936547869 2:113408007-113408029 TTCTAGACATGCAGACTCCTGGG - Intergenic
936664889 2:114582998-114583020 TGTTAGAAATGCAGATTCCCAGG - Intronic
937032957 2:118756084-118756106 TCCTAGAGATGCTGAATCCCAGG + Intergenic
937122284 2:119449107-119449129 TGTTAGAAATGCAGAATCTCAGG - Intronic
937476771 2:122222116-122222138 TTTTACAGATGTAGAATCCAAGG - Intergenic
937692300 2:124770262-124770284 TTCTAGAGTTGCAGACTCGGGGG + Intronic
938569079 2:132545790-132545812 TGTTAGAAATGCAGAATCCCAGG - Intronic
938641755 2:133288453-133288475 CTCTAGAAATTCAGACTCCCTGG - Intronic
938665272 2:133528498-133528520 TGTTAGAAATGCAGACTCTCAGG - Intronic
938698329 2:133854521-133854543 TGTTAGAAATGCAGATTCTCAGG + Intergenic
938966733 2:136395268-136395290 TGTTAGAAATGCAGAATCTCAGG + Intergenic
938985953 2:136576410-136576432 TCTTAGAAATCCAGACTCTCAGG + Intergenic
939906675 2:147924813-147924835 TTTAAGAAATGTAGACTCTCAGG - Intronic
940191548 2:151045975-151045997 TTTGAAAAATGTAGACTCCCAGG - Intronic
940365722 2:152846565-152846587 TGTTAGAAATGCAGATTCTCAGG - Intergenic
940502360 2:154508934-154508956 TGTTAGAAATACAGACTCTCAGG - Intergenic
940533948 2:154914507-154914529 TTTTAGAAATGCAGAATATCAGG + Intergenic
940781056 2:157934022-157934044 TGTTAAAAATGCAGAATCCCAGG - Intronic
940854735 2:158721131-158721153 TTTTAAAAATGCAGATTCCTAGG - Intergenic
941037460 2:160584051-160584073 TTGTAGAGATGCAGATTCCTAGG + Intergenic
941086295 2:161121960-161121982 TGTTAGAAATGCAGACTCTCAGG - Intergenic
941327660 2:164136932-164136954 TGTTAGAAATGCAGAATCTCAGG + Intergenic
941460150 2:165761098-165761120 TTTTAAATTTGCAGACTCCTTGG - Intronic
941693402 2:168525470-168525492 TATTAAAAATGCAGACTCTCAGG - Intronic
942037225 2:172022106-172022128 ATTTAGACATGCAGACTACCTGG + Intronic
942092880 2:172511163-172511185 TGTTAGAAATGTAGACTCTCAGG - Intergenic
942102843 2:172603084-172603106 TGTTAGAAATGCAGAATCTCAGG - Intronic
942195073 2:173509026-173509048 TTTTAGAAATGCAGGCTCTCAGG + Intergenic
942631563 2:177955579-177955601 TGTTAGAAATGCAGAATCTCAGG - Intronic
942926390 2:181438307-181438329 TGTTAGAAATGCAGAATCTCAGG + Intergenic
943199703 2:184804471-184804493 TTTTAGAAATGCAGAATCTCAGG + Intronic
943332376 2:186574863-186574885 TTTTACAGATGCAGAATGTCAGG + Intergenic
944142179 2:196468559-196468581 TGTTAGAAATGCAGATTCTCAGG - Intronic
944289011 2:197983412-197983434 TTGTAGAGACGGAGTCTCCCTGG + Intronic
944383043 2:199133846-199133868 TGTTAGAAATGTAAACTCCCAGG + Intergenic
945231846 2:207598820-207598842 TTTTTGAGATGGAGTCGCCCAGG - Exonic
945234362 2:207620987-207621009 TGTTAGAAATGCAGGTTCCCAGG + Intronic
945488225 2:210423810-210423832 TGTTAGAAATGCAGAATCTCAGG + Intergenic
945613174 2:212031480-212031502 TTTTAAAAATGCAGACCCCCAGG + Intronic
945904019 2:215570526-215570548 TTTTGGAGATGGAGTCTCGCTGG + Intergenic
946178595 2:217936896-217936918 TTTTACAGATGCAGACACTAAGG + Intronic
946255583 2:218439359-218439381 TTTAAAAGATGCAGATTCCTAGG - Intronic
946387262 2:219391747-219391769 TTTTAGAAATGCAGAACCTCAGG + Intronic
946445279 2:219734112-219734134 TGCTAGAGATGCAGAATCCCAGG + Intergenic
946472087 2:219970463-219970485 TTTTACAGATGGATATTCCCAGG - Intergenic
947910163 2:233795514-233795536 GATTAGAAATGCAGACTCTCAGG - Intronic
948174080 2:235929296-235929318 TTCGAGAAATGCAGAATCCCAGG - Intronic
948753003 2:240143325-240143347 GGTTAGGGATGCAGAATCCCAGG - Intronic
948753050 2:240143538-240143560 TGTTGGAAATGCAGATTCCCAGG - Intronic
1169122877 20:3107810-3107832 TGTTAGAAATGCAGATCCCCAGG + Exonic
1169270941 20:4199011-4199033 TTTTAGAGCATCAGAATCCCAGG + Intergenic
1169503951 20:6188376-6188398 TATTAGAAATGCAGAATCTCTGG + Intergenic
1169545593 20:6647542-6647564 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
1169547065 20:6661114-6661136 TGTTAGAAATGCAGATTCTCAGG - Intergenic
1169561536 20:6805885-6805907 TTTTTGAGATGGAGTCTCACTGG - Intergenic
1169694045 20:8367355-8367377 TATTTGAGATGCAGATTCTCAGG + Intronic
1169703514 20:8475991-8476013 TGTTAGAAATGCAGAATCTCAGG - Intronic
1169714827 20:8603603-8603625 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1169727073 20:8746919-8746941 TATTAGAGATGCTGAGTCCCAGG - Intronic
1169730392 20:8779626-8779648 TGTTAGACATGCAGAGTCTCAGG + Intronic
1169763792 20:9127243-9127265 TGTTAGAAATGCAGAGTCTCAGG - Intronic
1169775029 20:9242776-9242798 TGTTAGAAATGCAGATTCTCAGG + Intronic
1169776751 20:9263468-9263490 TGTTAGAAATGCAGACTCTCAGG + Intronic
1169776996 20:9265853-9265875 TGTTAGAAATGCAGATTCTCAGG + Intronic
1169784615 20:9346193-9346215 TATTAGAGATGCAGATTCCCAGG + Intronic
1169785791 20:9358012-9358034 TGTTAGGAATGCAGAGTCCCAGG - Intronic
1169806126 20:9560940-9560962 TGTTAGAAATGCAGAATCTCAGG - Intronic
1170182132 20:13543583-13543605 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1170344456 20:15368199-15368221 TCTTAGGAATGCAGACTCTCAGG + Intronic
1170409062 20:16068743-16068765 TTTTAGAAAAGCAAACTCCCAGG + Intergenic
1170429712 20:16264905-16264927 TCTGAGAAGTGCAGACTCCCGGG + Intergenic
1170445188 20:16419080-16419102 TGTTAGATATGCAAATTCCCAGG - Intronic
1170640803 20:18151048-18151070 TTTTTGAGATAGAGTCTCCCAGG + Intronic
1170681355 20:18528545-18528567 TGTTAGAAATGCAGACTCTCAGG - Intronic
1170740728 20:19053827-19053849 TGTTAGACATGCAAACTCTCAGG + Intergenic
1170818407 20:19734832-19734854 TGTTAGAAATGCAGACTCTCAGG + Intergenic
1170918555 20:20653261-20653283 TGTTAGAGATGCAGAATCTCAGG - Intronic
1171428112 20:25061139-25061161 TTGTAGAAATGCAGAATGCCAGG + Intergenic
1172052156 20:32126259-32126281 TGTTAGAAATGCAGAGTCTCAGG + Intronic
1172068541 20:32239151-32239173 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1172559872 20:35877262-35877284 TTTTTGAGATGGAGTCTCTCAGG - Intronic
1173170713 20:40721328-40721350 TTTTAGAAATGCAAATTCTCAGG - Intergenic
1173217248 20:41096569-41096591 GTTTAGAAATGCAGAATCCCAGG - Intronic
1173359641 20:42330875-42330897 TGTTGGAAATGCAGAGTCCCAGG + Intronic
1173371821 20:42443345-42443367 TGTTAGAGATGCAGAATCGCAGG - Intronic
1173446319 20:43122129-43122151 TGTTAGAAATGCAAATTCCCAGG - Intronic
1173476244 20:43361819-43361841 TGTTAGAAATGCAGATTCTCAGG - Intergenic
1173563147 20:44020649-44020671 TGTTAGAGATGCAGATTCTCAGG + Intronic
1173618755 20:44420304-44420326 TTTTTGAGATGGAGTCACCCAGG - Intronic
1174350765 20:49966025-49966047 TTTTAAAGATACAGATTCCCAGG - Intergenic
1174621804 20:51880819-51880841 TTTTAGAGATGCAGAAACTAAGG - Intergenic
1174648567 20:52105475-52105497 CGTTAGAAATGCAGACTCTCGGG + Intronic
1175043087 20:56074605-56074627 TTTTAGAGATGAAGTCACCCAGG - Intergenic
1175076640 20:56380466-56380488 ATTTAAAGATGTAGACTCCTGGG - Intronic
1175308164 20:57992238-57992260 TTTTAGAAATGCAGACTCTCAGG + Intergenic
1175482447 20:59321087-59321109 TGTGAGAGCTGCAGATTCCCTGG - Exonic
1175724095 20:61305421-61305443 TGTTGGAAATGCAGACTCTCAGG - Intronic
1176520965 21:7823961-7823983 TGTTAGGAATGCAGATTCCCAGG - Intronic
1177057835 21:16331006-16331028 TGCTAGAAATGCAGACCCCCGGG - Intergenic
1177143726 21:17384828-17384850 TGTTAAAAATGCAGACTCTCAGG - Intergenic
1177460324 21:21400609-21400631 TTTTTGAGATGGAGTCGCCCAGG + Intronic
1177926316 21:27220187-27220209 TATTAGAAATGCAGAATCTCAGG + Intergenic
1178400281 21:32279410-32279432 TGTTAGAAATGCAGATTCTCGGG - Intergenic
1178654986 21:34453973-34453995 TGTTAGGAATGCAGATTCCCAGG - Intergenic
1179013525 21:37574883-37574905 TGTTAGAAATGCAAATTCCCAGG - Intergenic
1179165683 21:38933547-38933569 TGTTAGCAATGCAGAATCCCAGG - Intergenic
1179175865 21:39007626-39007648 TGTTAGAAATGCAAACTCCTGGG + Intergenic
1179526095 21:41976810-41976832 TGTTAGAAATGCAGACTCCTGGG + Intergenic
1180630869 22:17229070-17229092 TTTTACAGATGCAGAAGTCCAGG + Intergenic
1180653503 22:17398997-17399019 TGTTAGAAATGCAGAATCTCAGG + Intronic
1181331654 22:22097631-22097653 TTTTAGAAACGCAGAATCTCAGG - Intergenic
1181983149 22:26780647-26780669 TATTAGAAATGCAGAATCTCAGG + Intergenic
1182165918 22:28172723-28172745 TTCTAGAGATACGGACTTCCAGG - Intronic
1182243692 22:28937624-28937646 TGTTAGAAATGCAGATTCTCAGG - Intronic
1182333734 22:29569384-29569406 TTTTAGAGATGGAGAGTCTGAGG - Intronic
1182747828 22:32619107-32619129 TGTTAGAAATGCAGACTCTCAGG + Intronic
1182885320 22:33768841-33768863 TTTCAGATATGCAGAATCTCAGG + Intronic
1183067790 22:35375482-35375504 TTTGAAGGATGCAGACTACCAGG - Intergenic
1183480007 22:38058454-38058476 TTTAATAGAGGAAGACTCCCTGG + Intronic
1183652940 22:39169437-39169459 TGTCAGAAATGCAGATTCCCAGG + Intergenic
1183977488 22:41521285-41521307 CTTTACACATGCAGACGCCCTGG + Intronic
1184758526 22:46531693-46531715 TTTTACAGATGCAGACACTGAGG - Intronic
949330610 3:2917492-2917514 TGTTAGAAATGCAGAATTCCAGG - Intronic
949564840 3:5235091-5235113 CATTAGAAATGAAGACTCCCAGG - Intergenic
949635710 3:5979452-5979474 TGTTAGAGATGCAAATTCTCAGG - Intergenic
949767090 3:7538496-7538518 TTTTGCTGATGCAGATTCCCTGG - Intronic
949774074 3:7611704-7611726 TTGTAGAAATGCAGACTTTCAGG + Intronic
949789801 3:7780806-7780828 TTCTAGAAATGCAGAATCTCAGG + Intergenic
949841191 3:8321854-8321876 TGTTAGAAATACAGATTCCCAGG + Intergenic
950217761 3:11171508-11171530 TTTAAGAAATGCAGAGTCCCAGG + Intronic
950225542 3:11230587-11230609 TGTTAGAGATGCAGAATCTCTGG + Intronic
950236688 3:11327876-11327898 CTTCAGAAATGCAGAATCCCCGG - Intronic
950621274 3:14207476-14207498 TGTTAGAAATGCAGATTCTCAGG + Intergenic
950686946 3:14625551-14625573 TATCAGAAATGCAGAATCCCCGG - Intergenic
950842550 3:15981319-15981341 TGTTAGAAATGTAGACTCTCAGG + Intergenic
950892924 3:16420892-16420914 TCTTAGAGACACAGACTCTCAGG - Intronic
951024383 3:17814345-17814367 TTTTTGAGATGGAGTCACCCAGG - Intronic
951040904 3:17988013-17988035 TGATAGAAATGCAGACTCTCAGG - Intronic
951044523 3:18023170-18023192 TGTTAGAGATGCAAATTCTCAGG + Intronic
951063710 3:18239656-18239678 TTTTAGAGATGCAGAAACTAAGG + Intronic
951106168 3:18745810-18745832 TATTAGAAATGCAGACTGTCGGG - Intergenic
951119471 3:18908236-18908258 TGTTAGAAATGCAGATTCTCAGG + Intergenic
951169610 3:19525305-19525327 TATTAGAAATGCAGAATCTCAGG + Intronic
951190419 3:19762684-19762706 TGTTGGAGATGCAGAATCTCAGG + Intergenic
951220015 3:20058904-20058926 TTTTAGAAATGTAGAATCTCAGG + Intronic
951222847 3:20086805-20086827 TTTTTGAGATGGAGTCTCGCAGG + Intronic
951230445 3:20172556-20172578 TTTAAGAAATGCAGAATCTCAGG - Intronic
951273484 3:20656335-20656357 TGTTTAAGATGCAAACTCCCTGG - Intergenic
951297579 3:20957812-20957834 TGTTAAAGATGCAAATTCCCAGG - Intergenic
951483868 3:23190749-23190771 TGTTAGAAATGCAGACTCTCAGG - Intergenic
951539381 3:23767664-23767686 TGTGAGAAATGCAGACTCTCAGG - Intergenic
951588683 3:24240768-24240790 TGTTAGAAATGCAGACTCTCAGG - Intronic
951892425 3:27579714-27579736 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
952098914 3:29988624-29988646 TGTTAGAAATGCAGACTTGCTGG + Intronic
952227708 3:31395993-31396015 TGTTAGAAATGCAGAATCTCAGG - Intergenic
952315079 3:32225465-32225487 TATTAGAAATGCAGAATCTCAGG - Intergenic
952369522 3:32707775-32707797 TTTTTGAGATGGAGTCACCCAGG - Intronic
952370256 3:32715799-32715821 TTTAAAAAATGCAGAATCCCAGG - Intronic
952524309 3:34194045-34194067 TTTCAGAGATGTAGAAACCCAGG + Intergenic
952847074 3:37696888-37696910 TGTTAGAAATGCAGAATCTCAGG + Intronic
952850016 3:37720097-37720119 TGTTAGAAATGCAGATTCTCAGG - Intronic
952853301 3:37746968-37746990 CTTCAGAGTTGCAGATTCCCTGG + Intronic
952857069 3:37781010-37781032 TCTTAGAAATGCAGAATCCTGGG + Intronic
953111728 3:39947604-39947626 TGTTAGAAATACAGACTCACTGG + Intronic
953190132 3:40678091-40678113 TGTTAGAAACGCAGACTCTCAGG + Intergenic
953417533 3:42731515-42731537 TGTTAGAAATGCAGAATCCCAGG + Intronic
953780813 3:45868926-45868948 TGTTAGAAATGCAGACTCTCAGG + Intronic
954040328 3:47881785-47881807 TTGTAGAGATGGGGTCTCCCTGG + Intronic
954303208 3:49712198-49712220 TTTTTGAGATGGAGTCACCCAGG - Intronic
954346695 3:50006074-50006096 TTTTTGAGATGGAGTCTCACTGG + Intronic
954667421 3:52264145-52264167 TTTTTGAGATGGAGGCTCACCGG - Intronic
954738493 3:52727499-52727521 TTTTTGAGATGGAGTCACCCAGG + Intronic
954761145 3:52875328-52875350 TCTGAGAAATGCAGACTCCACGG - Intronic
955196178 3:56806692-56806714 TTTTAGACTTGCAGACAACCAGG + Intronic
955488550 3:59459628-59459650 TGTTAGAAATGCAGAATCTCAGG + Intergenic
955578699 3:60395345-60395367 TTTTATAGATGCAGACACTGAGG + Intronic
955618961 3:60840572-60840594 TTTCAGACAAGCAGATTCCCAGG - Intronic
956135090 3:66090439-66090461 TGCTAGAAATGCAGACTCCCAGG + Intergenic
956200774 3:66703202-66703224 TGTTAGAGATGCAGAATCTCAGG - Intergenic
956201002 3:66705889-66705911 TATTAGAAATGTAGACTCCGAGG - Intergenic
956595218 3:70959832-70959854 TGTTAGAGATGCAGAGTCTCAGG - Intronic
956649875 3:71494740-71494762 TTCTAGAAATGCAGAATCTCAGG - Intronic
956813899 3:72890287-72890309 TGTTAGAAATGCAGATTCCTGGG + Intronic
956855807 3:73273855-73273877 GTTTAGAAATGCAGAGTCTCAGG + Intergenic
956861101 3:73324467-73324489 GGTTAGAAATGCAGAATCCCAGG - Intergenic
956903096 3:73737064-73737086 GGTTAGAAATGCAGACTCTCAGG + Intergenic
957596596 3:82274101-82274123 TTTTAGAGATGCCTCCTCTCTGG - Intergenic
957996373 3:87695263-87695285 TTTTAGAAATGCAGAAACTCAGG + Intergenic
958264362 3:91420577-91420599 TTTTAGAAATGCAGATTCTCAGG - Intergenic
958788424 3:98623972-98623994 TGTTAGAAATGCAGAATCTCAGG + Intergenic
958994856 3:100892664-100892686 TTTTAAAAATGCAGATTCTCAGG + Intronic
959094202 3:101935337-101935359 TTTTAAAAATTCAGACTCACTGG + Intergenic
959677446 3:109052426-109052448 TGTTAGAAATGCAGAATCCCAGG - Intronic
959895744 3:111604019-111604041 TTTTACAAATGCAGAATCTCAGG - Intronic
960245006 3:115390609-115390631 TTTTAGAAATGCAAATTCCCAGG + Intergenic
960611048 3:119555038-119555060 TCTTAGAAATGCAGAATCTCAGG + Intronic
960741201 3:120835678-120835700 TTTTAGAAGTTCAGAATCCCAGG - Intergenic
960906474 3:122606661-122606683 TTTTAAAAATACGGACTCCCAGG + Intronic
961074560 3:123969774-123969796 TGTTAGAAATGCAGAATCTCAGG - Intronic
961145930 3:124593353-124593375 TGTTACAAATGCAGATTCCCAGG + Intronic
961177404 3:124847039-124847061 TTTTAGAGATGCAGAAACTGAGG - Intronic
961189171 3:124943068-124943090 TTTTAGAAATGCATATTCTCAGG + Intronic
961309122 3:125982684-125982706 TGTTAGAAATGCAGAATCTCAGG + Intronic
961624822 3:128254646-128254668 TTTTAAAAATGCAGATACCCAGG + Intronic
961771249 3:129251699-129251721 TTTTTGAGATGGAGACTTGCTGG + Intronic
961962973 3:130871459-130871481 TTTTAGAAATGCAGACTCTTGGG - Intronic
962087462 3:132207103-132207125 TATTAGAAATGCAGAATCTCAGG - Intronic
962099790 3:132329801-132329823 TGTTAGACATGCAGAATCGCAGG - Intronic
962186751 3:133268371-133268393 TTGTAGAAATGCAGACTCCCAGG + Intronic
962433743 3:135345928-135345950 TGTTAGAGATGCAAATTCTCAGG + Intergenic
962547332 3:136450273-136450295 TGTTAGAAATGCAGAATCTCAGG + Intronic
962631839 3:137284427-137284449 TTTTAGAGGTGCAGGCCACCAGG - Intergenic
962634174 3:137313204-137313226 TGTTAGAAATGTAGACTCTCAGG + Intergenic
962722425 3:138187924-138187946 TTTTAGCGATGCCGCTTCCCGGG + Intronic
963001459 3:140685478-140685500 TGTTAGAAATGCAGAATCTCAGG + Intronic
963310961 3:143709421-143709443 TATTAGAAATGGAGAATCCCAGG - Intronic
963880126 3:150519793-150519815 TGTTAGAGATGCACATTCTCGGG + Intergenic
964353134 3:155822893-155822915 AAATAGAGATGCAGTCTCCCTGG + Exonic
964730565 3:159860376-159860398 TATTAGAAATGCAGAGTCTCCGG + Intronic
964827449 3:160844408-160844430 TTTTAGAGATGAAGAAGCCGAGG - Intronic
965142647 3:164859749-164859771 TTTTAGAGATGCAGAAACTGAGG + Intergenic
965334541 3:167420113-167420135 TTTTAGAAATGCAGATTCTTAGG + Intergenic
965439422 3:168694703-168694725 TGTTAGAAATGCAGACTCTTAGG + Intergenic
965515513 3:169617424-169617446 TGTTAAAAATGCAGACTCTCAGG - Intronic
965738521 3:171848244-171848266 CATTAGACATGCAGACTCTCAGG - Intronic
966018711 3:175178700-175178722 TTATAGAAATGCAGATTCTCGGG - Intronic
966181765 3:177195466-177195488 TTTTAGTAATGCCGACTTCCTGG - Intronic
966252369 3:177880648-177880670 TGTTAGACATGCAGAATTCCAGG - Intergenic
966385488 3:179393329-179393351 TGTTAGAAATGCACAATCCCGGG + Exonic
966557061 3:181274466-181274488 TGTTAGAAATGCAGAATCTCAGG + Intergenic
966769375 3:183490777-183490799 TTTTTGAGATGAAGTCGCCCAGG - Exonic
966994433 3:185266076-185266098 TTTTTGAGACGGAGTCTCCCTGG + Intronic
967082311 3:186061488-186061510 TTTTAGAAATGCACATTCTCAGG - Intronic
967150401 3:186643485-186643507 TATTAGAGATGCAGGATCTCAGG - Intronic
967671001 3:192235322-192235344 TTTTTGAGACGGAGTCTCCCTGG + Intronic
967844694 3:194034409-194034431 TGTTAGAAATGCAAATTCCCAGG - Intergenic
967977807 3:195045140-195045162 TGTTACAGATGCAGATTCCCAGG + Intergenic
968120894 3:196125179-196125201 TGCTAGAAATGCAGACTCTCAGG + Intergenic
968298670 3:197596710-197596732 TTTTAGATATGCAAATTCTCAGG - Intergenic
968682397 4:1930014-1930036 TGCTAGAAATGCAGACTCCCGGG - Intronic
969051431 4:4376040-4376062 TGTTAGAGATGCAGATGCTCAGG - Intronic
969272970 4:6115382-6115404 ATTTTGAGATGGAGTCTCCCAGG - Intronic
969289611 4:6230313-6230335 TGTCAGAAATGCAGACTCCCAGG - Intergenic
970321329 4:14878456-14878478 TGTTAGAAATGCAGACTCTCAGG - Intergenic
970829653 4:20321927-20321949 TGTTAGAAATGCAGACTCTCTGG + Intronic
970870739 4:20814147-20814169 TGTTAAAAATGCAGACTCCCAGG + Intronic
971290386 4:25332280-25332302 TTTTTGAGATGGAGTCACCCAGG - Intronic
971370269 4:26013491-26013513 TTTTAGAAATACAGATTCCCTGG + Intergenic
972344343 4:38180272-38180294 ATTTAAAGATGCAGAATCTCAGG - Intergenic
972356097 4:38280627-38280649 TGCTAGAAATGCAGGCTCCCAGG + Intergenic
972574347 4:40338339-40338361 TTGTAGAAATGCAGAATCACAGG - Intronic
972717651 4:41663834-41663856 TTTTAGAGATGAAGACTTTCTGG - Intronic
972772056 4:42206595-42206617 TCTTAGAAATGCAGAGTCTCAGG + Intergenic
973210085 4:47605753-47605775 TCTTAAAAATACAGACTCCCAGG - Intronic
973697499 4:53505274-53505296 TTTTTGAGATGGAGTCACCCAGG + Intronic
973885998 4:55322339-55322361 TGTTAGAAATGCAGAATCCCTGG + Intergenic
973908481 4:55554151-55554173 TGTTAGAAATGCAGAATCTCTGG - Intergenic
974078761 4:57191945-57191967 TATTAGAAATGCAGAATCTCAGG + Intergenic
974511754 4:62852585-62852607 TTCTAATGATGCAGACTACCGGG - Intergenic
974823210 4:67094651-67094673 TGTTAGAAATGCAGAATCTCAGG - Intergenic
975421734 4:74172630-74172652 TATTAGACATGCAGATTTCCAGG + Intronic
975500653 4:75080794-75080816 TGTTAGACATACAGACTCTCAGG + Intergenic
975527691 4:75368916-75368938 TTATAAAGATGCAGAATGCCAGG + Intergenic
976160848 4:82197202-82197224 TGTTAGAAATGCAAACTCTCAGG - Intergenic
976672097 4:87665370-87665392 TTTTAGAGATGCAGAACTCTGGG - Intergenic
977049108 4:92104298-92104320 TGGTAGAGATGGAGTCTCCCTGG + Intergenic
978194149 4:105951003-105951025 TGTTAGAAATGCAGAGTCTCTGG - Intronic
978196302 4:105976234-105976256 TGTTAGAAATGCAGATTCTCAGG + Intronic
978419050 4:108510787-108510809 CTTTAAAGATACAGATTCCCAGG + Intergenic
978698303 4:111610510-111610532 TGTTAGATATACAGACTCTCAGG - Intergenic
979001373 4:115225041-115225063 TTTTATAGATTCAGATTCTCTGG - Intergenic
979552520 4:122007170-122007192 TGTTAGAGATGCAAATTCTCTGG + Intergenic
979784791 4:124702523-124702545 TGTTAGAAATGCAGACTCTCAGG - Intronic
980838161 4:138223443-138223465 TTTTAGAAATGCAGAATCTCAGG + Intronic
980892166 4:138827552-138827574 CATTAGCAATGCAGACTCCCAGG + Intergenic
980990798 4:139736709-139736731 TGTTAGAAATGCAAATTCCCAGG + Intronic
981143570 4:141299760-141299782 TGTTAGAAATGCAGAATCTCAGG - Intergenic
981438513 4:144755221-144755243 TATGAGAAATGCAGACTACCGGG - Intergenic
981926511 4:150146284-150146306 TTTTAGAAATGCAAAATCTCAGG + Intronic
982082968 4:151808048-151808070 TGTTAGAAATGCAGAATCCCAGG + Intergenic
982148420 4:152425011-152425033 TGTTAGAAATGCAGAATCTCGGG - Intronic
982368263 4:154604462-154604484 TTTTAGAGTTTCAAATTCCCAGG - Intronic
982562195 4:156943414-156943436 TATTAGAAATGCAGAATCTCAGG + Intronic
983320125 4:166186320-166186342 TATTAGAAATGCAGAATCTCAGG + Intergenic
983822459 4:172212523-172212545 TTTGAGAAATGCAGACTGCCAGG + Intronic
983844186 4:172495752-172495774 TATTAGAAATGCAGACTCACAGG - Intronic
984109024 4:175586078-175586100 TTTTAGAGATACTGACATCCTGG - Intergenic
984252188 4:177348214-177348236 TGTTAGACATGCAGATTCTCAGG - Intronic
985102950 4:186476090-186476112 TTTTTGAGATGGAGTCTCGCTGG + Intronic
985143486 4:186867262-186867284 TTTGAGAGATGGAGAGACCCAGG + Intergenic
985973973 5:3400654-3400676 TTGTAAAAATGCAGAATCCCGGG - Intergenic
986243137 5:5979522-5979544 TGTTAGAGATGCAGGCTCTCAGG + Intergenic
986360573 5:6974477-6974499 TATTAGGGATGAAGACTCGCAGG + Intergenic
986471744 5:8082920-8082942 TTTTAGAGTTGCAGCCTGCAAGG + Intergenic
986813951 5:11387427-11387449 TGTTAGAAATGCAGACTCTGGGG - Intronic
987002969 5:13679696-13679718 TGCTAGAGATGCAGAGTCTCAGG + Intergenic
987162776 5:15161653-15161675 TGTTAGAGATGCAGACTTTCTGG + Intergenic
987287974 5:16478352-16478374 TTTTAGAAATGCAGATTCTCAGG + Intronic
987740492 5:21902432-21902454 TTTGAGAAATGCAGAATCTCAGG + Intronic
987938704 5:24503863-24503885 TTTTACAGATGAGGAATCCCAGG - Intronic
988810282 5:34778299-34778321 TGTTAGAAATGCAGACTCTCAGG - Intronic
988825801 5:34933299-34933321 TTTTAGAGATGGAGTCTTGCTGG + Intronic
988908188 5:35811564-35811586 TTTTACAGATGCAGACACCAAGG - Intronic
989100270 5:37816606-37816628 TGTTAGAAATGCAGATTCCTTGG - Intronic
989155243 5:38338674-38338696 TTGAAAAGATGCAGACACCCTGG - Intronic
989485856 5:41991182-41991204 TTTTAGTGATGCTAAGTCCCAGG - Intergenic
990515592 5:56528308-56528330 TATTAGAAATGCAGAGTCGCAGG - Intronic
990523232 5:56600133-56600155 TGTTAGAAATGCAGAGTCCTAGG + Intronic
990674403 5:58167496-58167518 TTTAAAAGATGCAGATTCCTGGG - Intergenic
990990719 5:61681146-61681168 GTTTAAAGTTGCAGAATCCCAGG + Intronic
991200399 5:63985321-63985343 TGGTAAAAATGCAGACTCCCAGG + Intergenic
991587128 5:68212984-68213006 TGTTAGAAAGGCAGAATCCCAGG - Intergenic
991678281 5:69111007-69111029 TTTTTGAGATGGAGTCTCACTGG + Intronic
991721219 5:69495384-69495406 TGTTAGAAAGGCAGAATCCCAGG - Intronic
992028339 5:72693688-72693710 TGTTAGAGCTGGAGACTCTCAGG - Intergenic
992197858 5:74357454-74357476 TTTTAGAGATGATGTCACCCAGG - Intergenic
992310447 5:75492968-75492990 TGTTAGAAATGCAGATTCTCAGG - Intronic
992382470 5:76251637-76251659 TGTTAGAGATGCAAATTCCCTGG - Intronic
992400765 5:76409087-76409109 TTTTAGAGATGGGGTCTCACTGG - Intronic
992626185 5:78637757-78637779 TGTTAGAGATACAGAATCCTAGG + Intronic
992692033 5:79249939-79249961 TTTTAGAGATGAAGAACCACGGG - Intronic
992824575 5:80536184-80536206 TTTTTGAGATGGAGTCTCACTGG + Intronic
992869434 5:80991460-80991482 TGTTAGCAATGCAGACTCTCAGG - Intronic
992911081 5:81396757-81396779 TCTTAGAAATGCAGAATCTCAGG + Intergenic
993347590 5:86804246-86804268 TGTTAGAAATGCAGAATCTCAGG - Intergenic
993409986 5:87561798-87561820 TGTTAGAAATGCAGACTCTCAGG + Intergenic
993593562 5:89825683-89825705 TTTTTGAGATGGAGTCGCCCAGG + Intergenic
993660799 5:90631725-90631747 CTTCACAGATCCAGACTCCCTGG - Intronic
994292258 5:98041875-98041897 TATTAGAGAAGCAGAATCCAGGG - Intergenic
994314920 5:98321860-98321882 TTTAGGAGTTTCAGACTCCCTGG - Intergenic
995046763 5:107658743-107658765 TGTTAGAAATGCAGACTGTCAGG + Intronic
995429501 5:112058489-112058511 TTGTAGAAATGCAGATTCTCAGG + Intergenic
995677948 5:114684552-114684574 TGTTAGAAATGCAGAATCTCGGG - Intergenic
996294249 5:121893043-121893065 TTCTAGAAATGCAATCTCCCAGG + Intergenic
996471403 5:123865184-123865206 TGTTAGAAATGCAGACTCCTAGG + Intergenic
996794887 5:127334345-127334367 TGTTAGAAATACAGACTCTCAGG + Intronic
996858747 5:128040912-128040934 TTTTTGAGATGGAGTCACCCAGG - Intergenic
997033115 5:130154959-130154981 TGTTAGAAATGAAGACTCTCAGG - Intronic
997219422 5:132148053-132148075 TGTTAGAAATACAGACTCTCAGG + Intergenic
997650241 5:135511887-135511909 TTTTAGAGATGAGGAATCCAAGG - Intergenic
997801154 5:136863975-136863997 TTTTAGAAATGCATATTCTCAGG + Intergenic
998240507 5:140439049-140439071 TGTGAGAAATGCAGAATCCCGGG + Intronic
998411266 5:141913376-141913398 TTTTACAGATGACGAATCCCAGG + Intergenic
998453098 5:142249834-142249856 TGTTAGAAATGCAGATTCTCAGG + Intergenic
998460707 5:142308015-142308037 TCTTAGAGATGCAGACACTGAGG - Intergenic
998739070 5:145177957-145177979 TGTTAGCAATGCAGACTCTCAGG - Intergenic
998868409 5:146529047-146529069 TGTTAGAAATGCAGAATCCCAGG + Intergenic
999225963 5:150024794-150024816 TTTTAGAGATACAGAAACCAAGG + Intronic
999324077 5:150632234-150632256 TGTTAGAAATGCAGAATCCCAGG + Intronic
999444585 5:151629068-151629090 TGTTAGAAATGCAAATTCCCAGG + Intergenic
999518909 5:152330292-152330314 TTTTTAAAATGCAGACTCCTGGG + Intergenic
999564053 5:152838011-152838033 TATTTGTGATGCAGACGCCCTGG - Intergenic
999589669 5:153131189-153131211 GTTTAGAAGTGCAGATTCCCTGG + Intergenic
999630716 5:153568342-153568364 TGTTAGAAATGCAGAATCTCAGG + Intronic
999667198 5:153925235-153925257 TTTTTTAGATGAAGTCTCCCAGG - Intergenic
999700069 5:154219656-154219678 TGTTAAACATGCAGATTCCCCGG - Intronic
999707973 5:154291387-154291409 TGTTAGAAATGCAGAATCTCAGG + Intronic
999975985 5:156912586-156912608 TATTAGAAATGCAGAATCCCAGG - Intergenic
1000210551 5:159103502-159103524 TGTTAGAAATGCAGATTTCCAGG + Intergenic
1000748177 5:165061742-165061764 TTTTTGAGATGGAGTCGCCCAGG + Intergenic
1000767302 5:165308114-165308136 TGTTAGAAATGAAGACTTCCAGG - Intergenic
1001053813 5:168433282-168433304 TATTAGAAATGCAGAATCTCAGG - Intronic
1001553659 5:172621937-172621959 TATTTGAAATGCAGACTCCCTGG - Intergenic
1001736590 5:174008805-174008827 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1002076342 5:176710707-176710729 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1002155493 5:177275457-177275479 TTTTTGAGATGGAGTCGCCCAGG + Intronic
1002339919 5:178509139-178509161 TGTCAGAAATGCAGACTCTCAGG + Intronic
1002368084 5:178729119-178729141 TTTTAGAGCTGCGGATTCCAGGG - Intronic
1002385242 5:178860929-178860951 TTTTAGAGCTGCGGATTCCAGGG + Intronic
1003259471 6:4503994-4504016 TTTCAGAAATGCAGAATCTCAGG + Intergenic
1003269281 6:4593114-4593136 TGTGAGAAATGCAGACTCCCAGG + Intergenic
1003373701 6:5553791-5553813 TGTTAGAAATGCAGAATCCCAGG - Intronic
1003638348 6:7855308-7855330 TGTTAGAAATGCAGATTCTCAGG + Intronic
1003641993 6:7883594-7883616 CATTGGAAATGCAGACTCCCAGG - Intronic
1003742232 6:8953896-8953918 TTTTAATTATGGAGACTCCCAGG - Intergenic
1003780366 6:9417615-9417637 TGTTAGAGATGCAGAGTATCAGG + Intergenic
1004084141 6:12427904-12427926 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1004109316 6:12699776-12699798 TGTTAGACATGCAGAATCCCAGG - Intergenic
1004170424 6:13291622-13291644 TATTAGAAATGCAGACTCCCAGG - Intronic
1004219730 6:13735862-13735884 TTTTAGAGATGTGGATTCTCTGG + Intergenic
1004375143 6:15084452-15084474 TTTTTGAGATGGAGTCTCGCTGG - Intergenic
1004408639 6:15359726-15359748 TATTTGAGATGGAGTCTCCCAGG + Intronic
1004450953 6:15745878-15745900 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1004915606 6:20329126-20329148 TGTTAGAAATGCAGACTCTCAGG - Intergenic
1004925704 6:20413244-20413266 TGTTACAGATTCAGATTCCCAGG + Intronic
1005025689 6:21460895-21460917 TTTTTGAGATAGAGTCTCCCAGG - Intergenic
1005086710 6:22014770-22014792 TTTTTGAGACGAAGTCTCCCAGG + Intergenic
1005232774 6:23723401-23723423 TGTCAGAAATGCAGAATCCCAGG - Intergenic
1005354480 6:24969301-24969323 ACTTAGAAATGCAGACTCTCAGG + Intronic
1005683944 6:28233756-28233778 TTTTACAGATGAGGACTCCAAGG + Intergenic
1005712374 6:28514634-28514656 TTTTAGAAATGCAAATTCCTGGG + Intronic
1006133113 6:31880442-31880464 TTTTAGAAATGCAGAATCCTGGG + Intronic
1006408847 6:33860365-33860387 TTTTAGCTTTCCAGACTCCCAGG - Intergenic
1006461185 6:34159504-34159526 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1006511140 6:34521828-34521850 TTTTACAGATGCGGACGCCGAGG + Intronic
1006608090 6:35273703-35273725 TTTGTGAGATGGAGTCTCCCGGG - Intronic
1006791655 6:36705093-36705115 TTTTTGAGATGGAGTCACCCAGG - Intronic
1006844383 6:37052188-37052210 CTTTAGAAATGCAGAGTCACAGG - Intergenic
1007392735 6:41559824-41559846 TCTTAGAAATACAGATTCCCAGG + Intronic
1007451426 6:41942398-41942420 GGTTAGAAATGCAGACTCTCAGG + Intronic
1007716771 6:43860847-43860869 TTTTAGAGATGAAGACACTAAGG + Intergenic
1007949848 6:45861492-45861514 TTTTACAGCTGCAGAAACCCAGG + Intergenic
1008148923 6:47926500-47926522 TGTTAGAAATGCAGACTCTCAGG + Intronic
1008364290 6:50658222-50658244 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1008486451 6:52041358-52041380 TGTTAGAGATGCAGAGTCTCAGG - Intronic
1008857208 6:56103867-56103889 TATTAGAAATGCAGATTCCAGGG - Intronic
1008928395 6:56911318-56911340 TGTTAGAAAAGCAGACTCTCAGG - Intronic
1008991081 6:57602407-57602429 TTTTAGGAATGCAGATTCTCAGG + Intronic
1009023827 6:57973910-57973932 TGTTAGAAATGCAAATTCCCTGG - Intergenic
1009199406 6:60725459-60725481 TGTTAGAAATGCAAATTCCCTGG - Intergenic
1009265411 6:61548443-61548465 TGGTAGAAATGCAGACTCTCAGG - Intergenic
1009402061 6:63268664-63268686 TTTTAGAAATGCAAACTGACAGG - Intergenic
1010258518 6:73788873-73788895 TGTTAGAAAAGCAGATTCCCAGG - Intronic
1010694993 6:78961502-78961524 TGTTAGAAATGCAGAATCTCAGG + Intronic
1011030419 6:82916983-82917005 TTTTAGAGAGGGAGAATACCTGG + Intronic
1011352604 6:86439008-86439030 TGTTAGAAATGCAGACTTTCAGG + Intergenic
1011407086 6:87027153-87027175 TTTTAGAAATGCACTCTCTCAGG - Intergenic
1011670385 6:89677809-89677831 TGTTAGAAATGCAGACTCTCAGG + Intronic
1011938423 6:92812096-92812118 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1011966679 6:93167013-93167035 TGTTAGAAATGCAGAATCCCAGG + Intergenic
1012389179 6:98717544-98717566 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1012451191 6:99353740-99353762 TGTTAGAAATGCAGACTCTCAGG - Intergenic
1012835464 6:104259521-104259543 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1012921658 6:105226364-105226386 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1012949827 6:105505965-105505987 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1012979981 6:105819085-105819107 TGTTAGAAATGCAGAGTCTCAGG + Intergenic
1013024321 6:106254845-106254867 TGTGAGTGATGCAGACTCCCTGG - Intronic
1013430066 6:110047737-110047759 TTTTTAAGATGCAGATTTCCAGG + Intergenic
1013518871 6:110914592-110914614 TTTTAGAGATGGGGTCTCACAGG + Intergenic
1013591362 6:111621844-111621866 TCTTAGCAATGCAGACTCCCAGG - Intergenic
1013636551 6:112034355-112034377 TATTAGAAATGCAGATTCCAAGG + Intergenic
1013652601 6:112211136-112211158 TGTTAGAAATGCAGACCCTCAGG - Intronic
1013655501 6:112242573-112242595 TGTTAGAGATGCAGAACCTCAGG - Intronic
1014284510 6:119481535-119481557 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1014946355 6:127503275-127503297 TTTTAGAGATGAAGACTCTAAGG - Intronic
1015274278 6:131368071-131368093 TTTTTAAGATGCAGATTTCCAGG - Intergenic
1015864773 6:137717004-137717026 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1016350594 6:143163065-143163087 TTTTAAATATGCAGGATCCCAGG - Intronic
1016868078 6:148789304-148789326 TGTTAGAAATGCAGAATCTCAGG + Intronic
1016873258 6:148839552-148839574 TCTTAGAAAGGCAGACTCTCGGG - Intronic
1017110564 6:150928565-150928587 TTTTTGAGATGAAGTCACCCAGG + Intronic
1017516720 6:155162722-155162744 TTTTAAAAATGCAGATGCCCAGG - Intronic
1017561606 6:155634157-155634179 TGTTAGAAATGCAGAATCCAGGG - Intergenic
1017758711 6:157551542-157551564 TATTAGAAATGCAGACTCTTGGG + Intronic
1017818336 6:158030988-158031010 TATTAGAAATGCAGAATCCTGGG - Intronic
1017838526 6:158202375-158202397 TTCTAGAAATGCAGAATCTCAGG - Intergenic
1018444084 6:163839406-163839428 TGTTAGACATGCAGACCCTCAGG - Intergenic
1018914331 6:168123628-168123650 GCTTAGAAATGCAGACTCTCAGG + Intergenic
1018973093 6:168542469-168542491 TTTTAGATATGCAGCCTGCAGGG + Intronic
1019258123 7:64527-64549 TCTGACACATGCAGACTCCCAGG + Intergenic
1019791891 7:3019595-3019617 TGTTGGAAATGCAGACTCTCAGG - Intronic
1020221320 7:6240275-6240297 TTTTTGAGATGGAGTCTCCCAGG - Intronic
1020667163 7:11060574-11060596 TATTAGAAATGCAGAATCTCAGG - Intronic
1020762142 7:12281883-12281905 TGTTAGAAATGCAGAATTCCAGG - Intergenic
1020791192 7:12630277-12630299 TCTTAGATATGTAGACTCTCAGG + Intronic
1020912838 7:14154994-14155016 TGTTAGAAATGCAGACTCCCCGG + Intronic
1021063823 7:16147280-16147302 TTTCAAAGATGCAAAATCCCTGG + Intronic
1021603692 7:22389895-22389917 GGTTAGAGATGCAGAATCCCAGG - Intergenic
1021682778 7:23151535-23151557 TGTTAGAAATGCTGAATCCCAGG - Intronic
1021874423 7:25035234-25035256 TTTTTGAGATGGAGTCTCACTGG - Intergenic
1021874754 7:25037842-25037864 TTTCTGAGATGCAGCCTCCCCGG - Intergenic
1022265160 7:28746448-28746470 CTTTAGGAATGCAGAATCCCTGG + Intronic
1022377285 7:29826330-29826352 TGTTAGAAATGCAGAATCCCAGG + Intronic
1022535937 7:31098491-31098513 TCTTAGAAATGCAGAATCCCAGG - Intronic
1022620294 7:31976951-31976973 TTTTAGAAATGCAGACTTTCAGG + Intronic
1022639051 7:32164134-32164156 TGTTAGAAATGCAGATTCACAGG + Intronic
1022645007 7:32221530-32221552 TGTTCGAAATGCAGACTCTCAGG - Intronic
1022834495 7:34100980-34101002 TGTTAGAAATGCAGACTCCCAGG + Intronic
1022998571 7:35784282-35784304 TTTTTTAAATGCAGATTCCCAGG + Intergenic
1023092962 7:36633399-36633421 TTTCAGAGATGCAGAGTCTTGGG + Intronic
1023145311 7:37145153-37145175 TATTAGAGATGCAGATTCTTTGG - Intronic
1023648937 7:42348415-42348437 TTTTAGAAATGCAGAGTCTCAGG + Intergenic
1023754836 7:43406891-43406913 TTTTTGAGATGGAGTCACCCAGG - Intronic
1023774196 7:43588321-43588343 TTTTACAGATGAGGAATCCCAGG + Intronic
1024376429 7:48643868-48643890 TGTTAGACATGCAGAATCACAGG + Intronic
1024548196 7:50539598-50539620 TTGGAGAAATGCAGATTCCCAGG + Intronic
1024569151 7:50709808-50709830 TGGTAGAAATGCAGGCTCCCAGG + Intronic
1024575565 7:50761104-50761126 TTTTACAGATGCAGAAACCAAGG + Intronic
1024678664 7:51661108-51661130 TGTTAGAGGCGCAGACTCTCAGG - Intergenic
1024816380 7:53276268-53276290 TTTTGGAGATGGAGTCTCCCAGG + Intergenic
1024834833 7:53504573-53504595 TTTTAGAGATGAAGAAGCTCAGG - Intergenic
1025250799 7:57350177-57350199 TTTTATAGATGCGGACACCGAGG + Intergenic
1026230652 7:68480606-68480628 ATCTGGAAATGCAGACTCCCAGG + Intergenic
1026965075 7:74434318-74434340 TTGTAGAGATGGAGAGTCACTGG - Intergenic
1027251110 7:76399353-76399375 TGTTAGCGATGCAGATTCTCAGG + Intronic
1027400949 7:77806147-77806169 TTTTTGAGATGGAGTCACCCAGG - Intronic
1027409025 7:77893379-77893401 TGTTAGAAATGCAAACTCTCAGG - Intronic
1027464118 7:78493503-78493525 TTTTATAGATGGAGAAACCCAGG + Intronic
1027571471 7:79873307-79873329 TGTTAGAAATGCAGGCTCGCAGG - Intergenic
1028412135 7:90541304-90541326 TGTTAGAAATGCAGCCTCTCAGG + Intronic
1028512581 7:91641517-91641539 TATTAGAAATGCAGATTCCTGGG - Intergenic
1028673238 7:93428821-93428843 TTTAAGAGATGCTGAATCCGTGG - Intronic
1028910614 7:96203342-96203364 ATTTAGAAATGCAGAGTCCCAGG - Intronic
1028936321 7:96468347-96468369 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1029269751 7:99370048-99370070 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1029299495 7:99568274-99568296 TTTTTGAAATGGAGTCTCCCAGG + Intronic
1029350389 7:100009300-100009322 TTGTAGATATGGAGTCTCCCTGG - Intergenic
1029498968 7:100915790-100915812 TTATAGAGATGGAGTCTCACCGG - Intergenic
1030017364 7:105237527-105237549 TTTTAGAGATGAAAACTATCTGG - Intronic
1030059612 7:105612422-105612444 TGTTAGAAATGCAGACTCCCAGG + Intronic
1030559430 7:111066002-111066024 TTTTTGAGATGAAGTCTCCCAGG + Intronic
1030741614 7:113116411-113116433 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1031009948 7:116515467-116515489 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1031042110 7:116849510-116849532 TTTTTGAGATGGAGTCTCCCAGG - Intronic
1031137042 7:117895987-117896009 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1031402172 7:121338428-121338450 TGTGAGATATGCAGACTCTCAGG - Intronic
1031889865 7:127281586-127281608 TTTTAGGGATTCACGCTCCCTGG + Intergenic
1031909378 7:127498868-127498890 CTTTAGAGATCCAGAATCCTTGG + Intergenic
1031988013 7:128176099-128176121 TATTAGAAATGCAGAATCTCAGG + Intergenic
1031993254 7:128211390-128211412 TTTTACAAATGCAGAAACCCAGG - Intergenic
1032021383 7:128408830-128408852 TTCTAGAGAGGCAGCCTGCCAGG + Intronic
1032343629 7:131099287-131099309 TTTTAGAAATGGAGTCTCGCTGG - Intergenic
1032385602 7:131521140-131521162 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1032598090 7:133262654-133262676 TGTTAGAAATGCAGAATCTCAGG + Intronic
1032821574 7:135528893-135528915 TGTTAGACATGCAGAATCTCAGG + Intergenic
1033620783 7:143060529-143060551 TATTGGAGATGCAGAATCTCAGG - Intergenic
1034093738 7:148387576-148387598 TTTTAGAAATGCAGAATCTCAGG + Intronic
1034289322 7:149916114-149916136 TTTTAGAGATGAAGAAACCAAGG - Intergenic
1034296548 7:149977907-149977929 TTTTAGAGAAGCAGAATCAGAGG + Intergenic
1034388592 7:150763662-150763684 TTTTTGAGATGGAGTCTCACAGG + Intergenic
1034493681 7:151407914-151407936 TTTCAGAAATGCAGATCCCCAGG - Intronic
1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG + Exonic
1034661747 7:152776712-152776734 TTTTAGAGATGAAGAAACCAAGG + Intronic
1034765029 7:153712126-153712148 TTTTAGAGCTGCAGAGCTCCAGG - Intergenic
1034784938 7:153917084-153917106 TGTTAGAAATGCAGAATCCCAGG - Intronic
1034809483 7:154118918-154118940 TTTTAGAGAAGCAGAATCAGAGG - Intronic
1034869310 7:154669591-154669613 TTTTACATATTCAGACACCCTGG - Intronic
1034872916 7:154699668-154699690 CGTTAGAAATGCAGACTCTCAGG - Intronic
1035009336 7:155699289-155699311 TGTTAGAAATGCAGAACCCCAGG + Intronic
1036094091 8:5704019-5704041 TTTCAGAGATGCAGACTCTGAGG + Intergenic
1036446983 8:8830010-8830032 TATTAGGAATGCAGAATCCCAGG - Intronic
1037057576 8:14461459-14461481 TTTTAGAAATGCAGAATCTCAGG + Intronic
1037399460 8:18479342-18479364 TTGTGGAGATGAAGTCTCCCAGG + Intergenic
1037437895 8:18883064-18883086 TGTTAGAAATTCAGACTCTCAGG + Intronic
1037443381 8:18940327-18940349 TTTTAGGAATGCGGAGTCCCAGG - Intronic
1037444979 8:18956354-18956376 TGTTAGAAATGCAGACTGTCAGG - Intronic
1037495410 8:19435662-19435684 TTTTAAAAATGCAGACTCCTGGG - Intronic
1038532132 8:28326919-28326941 TGTTAGAAATGCAGACTCTTGGG - Intronic
1038749357 8:30281627-30281649 GATTAGAAATGCTGACTCCCAGG - Intergenic
1038930435 8:32188080-32188102 TTTTTGAGATGAAGTCTCACTGG + Intronic
1039225802 8:35387058-35387080 TGTTAGAAATGCAGATTCTCAGG + Intronic
1039958145 8:42222883-42222905 TGTGAGAAATGCAGACTCCCGGG + Intergenic
1039973885 8:42343499-42343521 TTTTTGAGATGGAGTCACCCAGG - Intronic
1040098897 8:43479313-43479335 TTTTAGAAATGCAGAATCTCAGG + Intergenic
1040370329 8:46764554-46764576 TGTTAGAAATGCAGACTCTCAGG - Intergenic
1041015341 8:53587608-53587630 TGTTAAATATGCAGAATCCCAGG + Intergenic
1041221370 8:55654932-55654954 TGTTAGAAATGCAGATTCCTTGG + Intergenic
1041531058 8:58867671-58867693 TGTTAGAAATGCAGAGTCTCAGG - Intronic
1041763233 8:61389515-61389537 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1042346048 8:67729131-67729153 CATTAGAAATGCAGAGTCCCAGG + Intronic
1042477930 8:69270261-69270283 TGTTAGAAATGCAGAATCCTGGG - Intergenic
1042585192 8:70329430-70329452 TTGTAGAGATGGAGTCTCCCAGG + Intronic
1043823565 8:84898178-84898200 TGTTAGAAATGCAGATTCTCAGG + Intronic
1043843048 8:85131784-85131806 TTTTACTGATGCTGACTTCCAGG + Exonic
1044274213 8:90281372-90281394 TCTTAGAAATGCAAATTCCCAGG - Intergenic
1044863421 8:96545757-96545779 TGTTAGAAATGCCGACGCCCAGG - Intronic
1044919896 8:97157912-97157934 TTTTAGAGTTGAAGATTCCTGGG + Intergenic
1044934451 8:97279250-97279272 TGTTAAAGATGCAGAATCTCAGG + Intergenic
1044993955 8:97821308-97821330 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1045010685 8:97956201-97956223 TTTTTGAGATGGAGTTTCCCAGG + Intronic
1045110942 8:98939402-98939424 TGTTAGAAATGCAAACTCTCTGG - Intronic
1045281917 8:100756859-100756881 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1045445457 8:102258061-102258083 TTTTAGACAGGCAGAATCTCTGG - Intronic
1045604811 8:103760544-103760566 TTTTAGAGACACAGACACCATGG + Intronic
1045777888 8:105827327-105827349 TTTTAGAAATGCATATTCCCAGG + Intergenic
1046576853 8:116040265-116040287 CTTTAAAGATGCAGATTCCCAGG - Intergenic
1046830119 8:118736051-118736073 TTTTAGTCATCCAGGCTCCCAGG - Intergenic
1046899248 8:119506122-119506144 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1047142636 8:122158419-122158441 TTTTTGAGATGGAGTCTCGCTGG - Intergenic
1047368624 8:124236311-124236333 TTTTAAATATTCAGTCTCCCTGG + Intergenic
1047380267 8:124355505-124355527 TGTTAGAAATGCAGAATCTCAGG + Intronic
1047516267 8:125557114-125557136 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1047883964 8:129227660-129227682 TGTTAGAAATGCCGAGTCCCAGG + Intergenic
1048152282 8:131904953-131904975 TATTAGACATGCAGACTCCGGGG - Intronic
1048376929 8:133831105-133831127 CTTTATAAATGCAGACTCCTGGG - Intergenic
1048410205 8:134164474-134164496 TTTTAGAAATGCAGACCCTCAGG + Intergenic
1048815433 8:138329382-138329404 TTTTTGATATGAAAACTCCCAGG + Intronic
1049090940 8:140512841-140512863 TTTTTGAGATGGAGTTTCCCAGG + Intronic
1049308844 8:141922717-141922739 TGTTAGAAATGCAGACTCCCAGG - Intergenic
1049309134 8:141924147-141924169 TGTTAGAAATGAAGACTCCCAGG + Intergenic
1049923776 9:389632-389654 TGTTAGAAATGCAAATTCCCAGG + Intronic
1050224342 9:3434079-3434101 TGTTAGAAATGCAGAATCTCAGG - Intronic
1050467664 9:5947279-5947301 TGTTAGAAATGCAGAATCCAAGG - Intronic
1050838415 9:10113790-10113812 TGTTAGAAATGCAGAATCACAGG - Intronic
1051672629 9:19527254-19527276 TTTTGGAGTTGCAGAGTCCTGGG + Intronic
1051728314 9:20111606-20111628 TGTTAGAAATGTAGACTCCTGGG + Intergenic
1051963523 9:22798007-22798029 TGTTAGAAATGCAGACTATCAGG - Intergenic
1052017514 9:23486385-23486407 TATTAGAAATGCAAACTCTCAGG - Intergenic
1052197565 9:25736143-25736165 TTATATAGATGAAGTCTCCCAGG - Intergenic
1052351151 9:27459409-27459431 TGTTAGAAATGTAGACTCTCAGG + Intronic
1052379000 9:27749882-27749904 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1052556911 9:30030513-30030535 TGTTAGAGATGAAGAATCACAGG - Intergenic
1052699762 9:31923254-31923276 TCTTAAAAATGCAGAATCCCAGG + Intergenic
1052829628 9:33204257-33204279 TTTTAGAAATGCAGAATCTCAGG + Intergenic
1053223723 9:36333334-36333356 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
1054787470 9:69222726-69222748 CCTTAGAAATGCAGACTCTCAGG + Intronic
1054978981 9:71181960-71181982 TTGTAAACATGCAGATTCCCAGG - Intronic
1055019697 9:71656543-71656565 TGTTAGAAATGCAGATTCTCAGG + Intergenic
1055583406 9:77731727-77731749 TGTTAGAAATGCAGACCCTCGGG - Intronic
1055641410 9:78321339-78321361 GTTTATAGCTGGAGACTCCCAGG + Intronic
1055704754 9:78985558-78985580 TGTTAGACATGCAGAATCTCAGG - Intergenic
1055952465 9:81743254-81743276 TTTTTGAGACGGAGTCTCCCTGG + Intergenic
1056036181 9:82608505-82608527 TGTTGGAGATGCAGAATTCCAGG - Intergenic
1056067084 9:82947654-82947676 TGTTAGAAATTCAGAATCCCAGG - Intergenic
1056702395 9:88921712-88921734 TTTTAGATATGCAGAATCTTAGG - Intergenic
1056713208 9:89008455-89008477 TTTTTGAAATGCAAATTCCCGGG + Intergenic
1056835181 9:89949175-89949197 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1056901890 9:90607602-90607624 TGATAGAAATGCAGACTCCCGGG + Intergenic
1056980537 9:91306587-91306609 TTTTATAAATGTAGACTCCCAGG + Intronic
1056989353 9:91395803-91395825 TTCTAGAAATGCAGACTAGCAGG - Intergenic
1057200588 9:93137710-93137732 TGATAGAAATGCAGACTCCTGGG - Intergenic
1057363917 9:94400699-94400721 TTTCAGAGGTGGAGAATCCCAGG - Intronic
1057390431 9:94638281-94638303 TCTTAGAAATGCAGAATCTCAGG + Intronic
1057584432 9:96316595-96316617 TCTTAGAAATGCAGACTGTCAGG - Intergenic
1057599199 9:96442509-96442531 TTTTAGAAATGCAGAATTTCAGG - Intergenic
1057659419 9:96987367-96987389 TTTCAGAGGTGGAGAATCCCAGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057794976 9:98149303-98149325 TGTTGGAGATGCAGATTCCCTGG + Intronic
1057836771 9:98451650-98451672 TGTTAGAGATGCACATTCCCAGG - Intronic
1057891762 9:98874989-98875011 TGTTAGAAATGCAGACTCTCAGG + Intergenic
1057898236 9:98926747-98926769 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
1057944095 9:99309587-99309609 TGTTTGAAATGCAGAATCCCAGG - Intergenic
1058083832 9:100727541-100727563 TGTTAAAGATGCAGATTCCCAGG - Intergenic
1058114514 9:101069774-101069796 TGTCAGAAATGCAGACTGCCAGG + Intronic
1058138092 9:101329483-101329505 TTTTATAGATGCTGACACACAGG - Intergenic
1058642792 9:107103446-107103468 TGTTAAAGATGCAGAGTCCTGGG + Intergenic
1058934146 9:109752393-109752415 CCTTAGAAATGCAGACTCTCAGG - Intronic
1059044643 9:110853193-110853215 TGTAAGAAATGCAGACTCTCAGG - Intergenic
1059066428 9:111090433-111090455 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1059175477 9:112166441-112166463 GTTTAGAAATGCAGATTCTCAGG - Intronic
1059379474 9:113912049-113912071 TATTAGAAATGAAGACTCTCAGG - Intronic
1059461248 9:114431811-114431833 TCTTATAGATGCAGAATCCAAGG + Intronic
1059543199 9:115151153-115151175 TGTTAGAAATGCAGATTCTCAGG + Intronic
1059630196 9:116113484-116113506 TTTTACAGATGCAGGCTTCAAGG + Intergenic
1059716439 9:116917566-116917588 TGTTAGAAATGCAGAATCCCAGG + Intronic
1059857798 9:118419854-118419876 TTTGAAAGCTGCAGATTCCCAGG - Intergenic
1060061524 9:120464582-120464604 TGTTAGAAATACAGACTCTCTGG + Intronic
1060632020 9:125167724-125167746 TTTTAGAGATGGGGAGTCTCAGG + Intronic
1060883038 9:127131955-127131977 TGTTAGAAATGCAAATTCCCGGG - Intronic
1061347319 9:130037027-130037049 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1061850674 9:133413112-133413134 TTTTTGAGATGGAGTCTCACTGG + Intronic
1062726861 9:138079124-138079146 TGTTAGACATACAGATTCCCAGG + Intronic
1185709641 X:2293204-2293226 TTTTAGCGATGGAGACCCACTGG - Intronic
1185876916 X:3709348-3709370 TTTTTGAAATACAGACTCACAGG - Intronic
1185894985 X:3850059-3850081 TTTTTGAGATGAAGTTTCCCAGG - Intergenic
1185900103 X:3888484-3888506 TTTTTGAGATGAAGTTTCCCAGG - Intergenic
1185905219 X:3926912-3926934 TTTTTGAGATGAAGTTTCCCAGG - Intergenic
1186249042 X:7646310-7646332 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1186263692 X:7808793-7808815 TGTTAGAAATGCATACTCTCAGG - Intergenic
1186344985 X:8682944-8682966 TCTTAGAAATGCAGACTCTCAGG + Intronic
1186516544 X:10170594-10170616 TGTTAGAAATGCAGATTCCCCGG + Intronic
1186519989 X:10197398-10197420 TATGAGACATGCAGACTCTCAGG - Intronic
1186575120 X:10757164-10757186 TGTTAGAAATGCAGATTCTCAGG - Intronic
1186580806 X:10815998-10816020 TGTTAGATGTGCAGACTCTCAGG + Intronic
1186663799 X:11698068-11698090 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1186683145 X:11896897-11896919 TGCTAGAAATGCAGAATCCCAGG - Intergenic
1186763518 X:12747649-12747671 TGCTAGAAATGCAGATTCCCTGG - Intergenic
1186874547 X:13804149-13804171 CGTTAGAAATGCAGAGTCCCAGG - Intronic
1186884385 X:13898479-13898501 TGTCAGAAATGCAGAATCCCAGG + Intronic
1186942673 X:14528163-14528185 TCTTAGAAATGCAGAATCTCAGG + Intergenic
1187232750 X:17438181-17438203 TGTGAGAAATGCAGAATCCCAGG - Intronic
1187238760 X:17493701-17493723 TATTAGAAATGCAGAATCTCAGG + Intronic
1187288766 X:17931997-17932019 TGTTAGAAATGCAGGCTCTCAGG + Intergenic
1187292382 X:17967512-17967534 TGTTAGAAATGCAGACTCTCAGG - Intergenic
1187493898 X:19777803-19777825 TGTTAGAAATGCAGACTCTCTGG + Intronic
1187562195 X:20413318-20413340 GCTTAGAAATGCAGACTCTCTGG + Intergenic
1187581028 X:20607508-20607530 TGTTGGAGATGCAGAATCTCAGG - Intergenic
1187688602 X:21841022-21841044 TGTTAGAAATGCAGAATCCCAGG + Intronic
1187716244 X:22105155-22105177 TGTCAGAAATGCAGACTCTCGGG + Intronic
1187720947 X:22150296-22150318 TGTTAGAAATGCAGACTCTCAGG - Intronic
1187724832 X:22191586-22191608 TGTTAGAAATGCAAATTCCCAGG + Intronic
1187733741 X:22282971-22282993 TGTTAGAAATGCAAATTCCCAGG + Intergenic
1187828060 X:23352828-23352850 TATTAGAACTGCAGACTCTCAGG + Intronic
1187882235 X:23857980-23858002 TGTTAGAAATGCAAACTCTCAGG - Intronic
1187950049 X:24462707-24462729 TGTTAGAAATGCAAACTCCTGGG - Intergenic
1187990920 X:24871322-24871344 TGTTAGAGATGCACATTCTCTGG - Intronic
1187991175 X:24874752-24874774 TGTTAGAGATGCAAATTCTCAGG + Intronic
1188022121 X:25170504-25170526 TGTTAGAGATGCAAATTCTCAGG - Intergenic
1188126696 X:26377200-26377222 ATTTAGAAACGCAGATTCCCAGG + Intergenic
1188150301 X:26666418-26666440 TTTTTGAGATTCAGAATACCAGG + Intergenic
1188274298 X:28180773-28180795 CGTTAGAAATGCAGACTCTCAGG + Intergenic
1188353716 X:29163323-29163345 TGTTAGAAATGCAGACTCCCAGG - Intronic
1188462077 X:30440088-30440110 TCTTAAAAATGCAGACTCTCAGG + Intergenic
1188517417 X:31002566-31002588 TCTTAGAGATGCACAATCCCAGG + Intergenic
1188568445 X:31553092-31553114 TGTTAGAGATGCAAATTCTCAGG + Intronic
1188574516 X:31631088-31631110 TATTAGAAATGCAAATTCCCAGG + Intronic
1188580145 X:31701791-31701813 TGTTAGAAATGCAGAATCTCAGG + Intronic
1188650362 X:32624619-32624641 TGTTAGAAATGCAGAATCTCAGG - Intronic
1188830846 X:34894833-34894855 TTTCAGAGATGCAGATTATCAGG - Intergenic
1189048153 X:37615254-37615276 TGTTAGAAATGCAGACTCCTAGG - Intronic
1189088563 X:38053176-38053198 TTTTAGGAATGCAGAATCTCAGG - Intronic
1189250715 X:39599024-39599046 TGTTAGAAATGCAGATTCTCAGG - Intergenic
1189336432 X:40173287-40173309 TTTTACAGATGAGGACTCCGAGG - Intronic
1189560820 X:42189758-42189780 TGTTAGAAGTGCAGACTCTCTGG + Intergenic
1189575565 X:42349472-42349494 TTTTAAAAATGCAGATTCTCAGG + Intergenic
1190237984 X:48632051-48632073 TATTAAAAATGCATACTCCCAGG + Intergenic
1190261256 X:48798884-48798906 TTTTTGAGATGGAGTCGCCCAGG + Intergenic
1190497798 X:51043385-51043407 TGTTAGAGATGCAGATTATCGGG - Intergenic
1190531330 X:51380323-51380345 TTTTTGAGACGGAGTCTCCCAGG - Intergenic
1190935171 X:54993279-54993301 TTTGAGAGAGGCAGTCTCTCAGG - Intronic
1192175725 X:68884036-68884058 TATTAGAAATGCAGAGTCCCAGG + Intergenic
1192264205 X:69527815-69527837 TGTGAGAGATGCAGAATCTCAGG - Intronic
1192320259 X:70085150-70085172 TGTTAGAAATGCAGACTCTCAGG - Intergenic
1192594947 X:72396394-72396416 CTTTAGAGACACAGTCTCCCTGG - Intronic
1192609071 X:72549491-72549513 TGTTAGAAATGCAGATTCCTAGG + Intronic
1192893308 X:75413338-75413360 TATTTGAGATGCAGTATCCCTGG - Intronic
1193709329 X:84860483-84860505 ATTTAGAGCTGCAGGCTTCCAGG - Intergenic
1194001841 X:88439559-88439581 TTTTTGAGATGGAGTCTCCTTGG + Intergenic
1194818707 X:98478782-98478804 TGTTAGAAATGCAGAATCCTGGG + Intergenic
1195047270 X:101065431-101065453 TTTTAGAAATGCATATTCTCAGG - Intergenic
1195591718 X:106636362-106636384 TATTAGAAATGCAGAATCTCAGG + Intronic
1195712721 X:107787138-107787160 TTTTAGAAATGCAGGATCTCAGG - Intronic
1195913820 X:109916041-109916063 TTTTTGAGATGCAGATTCCTTGG - Intergenic
1195981232 X:110580722-110580744 TGTTAGAAATGCAGACTCTCAGG - Intergenic
1196022693 X:111007011-111007033 TATTAGAAATGCAGAATCTCAGG - Intronic
1196343191 X:114621179-114621201 GGTTAGAAATGCAGACTCTCAGG - Intronic
1196383916 X:115127078-115127100 GTTTAGAAATGCAGAATCTCAGG + Intronic
1196495874 X:116324567-116324589 TTTAAGAAATGCAGAATCTCAGG - Intergenic
1196689244 X:118541608-118541630 TTTTACAGATGCAGAGACTCTGG - Intronic
1196732605 X:118956148-118956170 TTTTGGAAATGCAGAGTCTCAGG - Intergenic
1196799504 X:119530152-119530174 TTATAGAAATGCAGAGTCACAGG - Intergenic
1196926838 X:120641886-120641908 TTGTAGAGACGAAGTCTCCCTGG + Intergenic
1197009727 X:121545938-121545960 TTTCAGAGATTCTGACTCCCAGG + Intergenic
1197252798 X:124232764-124232786 TTTTAGAAATGCAGATTTTCAGG - Intronic
1197264917 X:124358856-124358878 TGTTAGAAATGTAGACTTCCAGG - Intronic
1198018713 X:132637167-132637189 TGTTAGAAATGCACACTCTCAGG + Intronic
1198155981 X:133961269-133961291 TTTTACAGAGGCAGAGTCCATGG - Intronic
1198546569 X:137698493-137698515 TTTTACAGATGCAGACACTGAGG - Intergenic
1198651349 X:138866719-138866741 TGTTAGAAATGCAGACTTGCAGG + Intronic
1198849870 X:140954823-140954845 TGTTAAAGATGCAGATTCCTGGG + Intergenic
1199463265 X:148107295-148107317 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1200839530 Y:7766540-7766562 TCTTAGAGTTGCAGACTCTCAGG - Intergenic
1201318758 Y:12674457-12674479 TTTTTGAGATTGAGTCTCCCTGG + Intergenic
1201422374 Y:13813509-13813531 TCTTAGAAATGCAGACTCTCAGG - Intergenic