ID: 923633449

View in Genome Browser
Species Human (GRCh38)
Location 1:235671237-235671259
Sequence CTCCATAAAAACAGGTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923633449_923633451 -8 Left 923633449 1:235671237-235671259 CCAAAGTACCTGTTTTTATGGAG 0: 2
1: 0
2: 2
3: 13
4: 184
Right 923633451 1:235671252-235671274 TTATGGAGTTTACATTCCAATGG 0: 2
1: 4
2: 38
3: 225
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923633449 Original CRISPR CTCCATAAAAACAGGTACTT TGG (reversed) Intronic
900814885 1:4836114-4836136 CTCAAGAAAACCAGCTACTTTGG + Intergenic
903089375 1:20897362-20897384 CTTCATAAAAAAGGCTACTTTGG + Intronic
908076655 1:60526784-60526806 CTCCATAAAAATACTTACTTAGG - Intergenic
909345159 1:74576500-74576522 CAGCATAAATACAGGTACTCTGG + Intronic
909753741 1:79196600-79196622 CTCCAAAAAAACTAGTATTTTGG - Intergenic
909768251 1:79385925-79385947 CTTTATAATTACAGGTACTTAGG - Intergenic
909848995 1:80435679-80435701 CTCCAGAAAAACAGAACCTTAGG - Intergenic
913510284 1:119554941-119554963 CTACAAAATTACAGGTACTTAGG + Intergenic
913514104 1:119588055-119588077 CTACAAAATTACAGGTACTTAGG + Intergenic
914646784 1:149660279-149660301 CTGCATATGAAAAGGTACTTGGG + Intergenic
914834712 1:151197577-151197599 CTCCATTAAAACAGGTTTTGTGG - Intergenic
916103859 1:161416153-161416175 CTCAAGAAAAACATGTATTTTGG + Intergenic
916770447 1:167902632-167902654 CTTCATAAAAGCAGGAACTATGG - Intronic
917662306 1:177189236-177189258 CTGAAAAAAAAAAGGTACTTTGG + Intronic
917991253 1:180381548-180381570 ATCAATAACAACAGGAACTTTGG + Intronic
918370940 1:183860785-183860807 CTTCATGAAAACAGAGACTTTGG + Intronic
918628311 1:186684086-186684108 CTCCATGAAAACCAGTACCTGGG + Intergenic
920285000 1:204872975-204872997 CTCTAAAAGAACAGGTTCTTGGG - Intronic
920977285 1:210797876-210797898 CTCCATAAGCGCAGGGACTTTGG - Intronic
923446847 1:234079426-234079448 CTAAAGAAAAACAGATACTTTGG + Intronic
923633449 1:235671237-235671259 CTCCATAAAAACAGGTACTTTGG - Intronic
924924829 1:248669924-248669946 TTCCATAAAAATATTTACTTTGG - Intergenic
1065423076 10:25568593-25568615 CACCATAAGAACTTGTACTTGGG - Intronic
1065837148 10:29668996-29669018 CTCCATAGAGACAGGGACATTGG - Intronic
1072978092 10:100076557-100076579 CTTCATGAAAACAGGTTCTGGGG - Intronic
1073104139 10:101022548-101022570 CTCAATAAAAAGAGGCAATTAGG - Intronic
1076066751 10:127454491-127454513 CCCCCTGAAAACTGGTACTTGGG - Intergenic
1078450099 11:11434431-11434453 CTCCATAAGGACAGGGACTGTGG - Intronic
1078562298 11:12383658-12383680 CTACAGAAAAAGATGTACTTTGG - Intronic
1079786676 11:24681897-24681919 CCCCATGCTAACAGGTACTTTGG + Intronic
1081090425 11:38858789-38858811 CTCAACAACAACAGGAACTTTGG - Intergenic
1083547500 11:63559790-63559812 CTCCATAACAACAAATACATAGG + Intronic
1084555725 11:69874734-69874756 CTCCATAAAAGTGGGTGCTTGGG - Intergenic
1086991695 11:93310815-93310837 TGGCATAAAAACAGGTACATAGG + Intergenic
1087476309 11:98639427-98639449 CTCCATAAAAACAAAGACTCAGG + Intergenic
1087647088 11:100820696-100820718 CTCTATATAAACAGATACTTGGG + Intronic
1087834255 11:102855577-102855599 TTCCATAAAAACAAGAACATTGG + Intergenic
1088002304 11:104896916-104896938 GCCCATAAAATCAGCTACTTAGG + Intergenic
1091744868 12:2984968-2984990 CTTTATAAAAACAGATACTTAGG + Intronic
1097657096 12:62378992-62379014 CTCCATGAAAGCAGGTACCAGGG - Intronic
1098286765 12:68915032-68915054 CACAATAAAAAGAGGTATTTGGG - Intronic
1098725736 12:73964160-73964182 CTCTTTAAAAACAGGTTCTTTGG - Intergenic
1105501456 13:20976307-20976329 CTCTATGAAAACAACTACTTAGG - Intronic
1108018758 13:46103422-46103444 CTCCATAAAATCTGGAAATTAGG - Intronic
1108373589 13:49793377-49793399 CTCAATGAGAGCAGGTACTTTGG + Intergenic
1109761343 13:66833972-66833994 CCCCATAGAAACAGATATTTTGG - Intronic
1111492806 13:89005596-89005618 GTTCAAAAAAACAGGTCCTTTGG - Intergenic
1111744691 13:92252630-92252652 TTCTATAAAAACAGTTACTTGGG + Intronic
1112624964 13:101093636-101093658 GTCCATAAAACCAGCTACATGGG - Intronic
1113269672 13:108659826-108659848 CCCCATAAAGGCAGGAACTTGGG - Intronic
1116752267 14:48901395-48901417 TTTCATAAAAATTGGTACTTTGG - Intergenic
1117539780 14:56735543-56735565 CTCAATATAAACATGTACTGTGG - Intergenic
1119121320 14:72080873-72080895 TGCCATAAAAACAGACACTTAGG - Intronic
1119200296 14:72747007-72747029 CTGCCTAAAAACATTTACTTTGG - Intronic
1120469001 14:84898611-84898633 CTCTATAATAAGAGGTACCTGGG + Intergenic
1123691939 15:22845510-22845532 TTCCTTAAAAACAATTACTTAGG - Intronic
1123725793 15:23100309-23100331 CTCCAAACAAAGAGGGACTTTGG - Intergenic
1123764137 15:23458746-23458768 TTCTATTAAAACAGTTACTTGGG + Intergenic
1124598494 15:31111576-31111598 CTGCATGAAAACAGGATCTTTGG + Intronic
1124830063 15:33139614-33139636 TTCAATAACAACAGCTACTTAGG - Intronic
1125380509 15:39081658-39081680 TTCAATAGAAAAAGGTACTTAGG + Intergenic
1125565421 15:40674284-40674306 CTCAATAACAACAGGAATTTTGG - Intergenic
1127952371 15:63821862-63821884 CTCCATGAAAGCAGGAACCTTGG - Intronic
1129807906 15:78480073-78480095 CTCCATGAGGACAGGAACTTTGG + Intronic
1132310410 15:100853585-100853607 CTTTATAAAAGTAGGTACTTCGG + Intergenic
1138193690 16:55036585-55036607 CTCCACAAAGACAGGGAGTTTGG + Intergenic
1139850561 16:69949671-69949693 CTCCATAAACACAGGTGGCTTGG + Intergenic
1139879545 16:70172583-70172605 CTCCATAAACACAGGTGGCTCGG + Intergenic
1140372979 16:74422965-74422987 CTCCATAAACACAGGTGGCTCGG - Intergenic
1140923950 16:79565224-79565246 TTCCACAAAAACAGGTAATTGGG - Intergenic
1143371911 17:6445494-6445516 CTTCATGAAAACAGGGACGTTGG + Intronic
1148397449 17:47321094-47321116 TTCCATAAAAACAGATGCATTGG + Intronic
1152155520 17:78630133-78630155 CTCCACAACGACAGGTGCTTTGG - Intergenic
1153294581 18:3533532-3533554 GTCCATAGATACAGGTACATTGG - Intronic
1157821160 18:50770728-50770750 CTCAATAACAAGAGGAACTTTGG + Intergenic
1158269422 18:55696867-55696889 CTCTATACAAACTGGGACTTTGG - Intergenic
1158905156 18:62004471-62004493 CTCCATAGATACAGGTAGTCAGG - Intergenic
1162497093 19:11029348-11029370 CTCCATAAGGACAAGGACTTTGG + Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163388030 19:17012019-17012041 CTCCAAAAAAAAAGATATTTGGG - Intronic
1165391997 19:35544158-35544180 CTCCAAGAAAACAGGGATTTAGG + Intronic
1166778967 19:45330134-45330156 CTCAATAAAAACAGTAAATTTGG - Intergenic
925081815 2:1075352-1075374 CCCCATAAAAGCAGGGTCTTTGG - Intronic
925758097 2:7154513-7154535 GTCCATAAAATCAGATAATTTGG - Intergenic
931462557 2:62461542-62461564 CTGCAAAAAACCAGGTACCTTGG - Intergenic
931918571 2:66987123-66987145 CTCCAGAAAAACAGCTTGTTTGG + Intergenic
933509196 2:83218489-83218511 ATTAATAAAAACAGGTAGTTTGG - Intergenic
935323886 2:101917389-101917411 CTCAAAAAAGACAAGTACTTAGG + Intergenic
935396492 2:102615202-102615224 CTCCATAAAATAAGGGACTTGGG - Intergenic
938088290 2:128416218-128416240 CTTCCTAAGAACAGGTTCTTGGG + Intergenic
939473631 2:142657448-142657470 CTCCAAAAAGAGTGGTACTTTGG + Intergenic
941375795 2:164728605-164728627 CTCAATAAAAAGGGGTATTTTGG + Intronic
941536695 2:166731328-166731350 GTCTGTAAAAGCAGGTACTTGGG + Intergenic
941662462 2:168209286-168209308 CACCAGAAAAACATGTATTTTGG + Intronic
942561763 2:177227261-177227283 CCCCTCAAAAACAGGAACTTGGG + Intergenic
942968001 2:181920890-181920912 CACCATAAAAACATGTACAGTGG + Intronic
943112632 2:183624873-183624895 CTTCATAAAAAGAGGTAATTTGG - Intergenic
943464096 2:188207285-188207307 CTCCATAAAAAATGGAACTAAGG + Intergenic
944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG + Intergenic
945304922 2:208250465-208250487 CTCCACTCAAACAGGTCCTTAGG + Intronic
947008870 2:225543562-225543584 ATCAATAAAAAGAGGAACTTTGG - Intronic
947018937 2:225653352-225653374 CTCAATGAAAGCAGGTTCTTGGG + Exonic
947331414 2:229033254-229033276 CTCCAGGAAAGCAGGTGCTTGGG - Intronic
1171302388 20:24075002-24075024 CTTCACAAAAACAGGAACATTGG - Intergenic
1173011329 20:39185582-39185604 CTTAATAAAAACAGGCACTAAGG - Intergenic
1175416713 20:58805986-58806008 CTCCAAATAAATAGGCACTTTGG + Intergenic
1175611478 20:60355079-60355101 CTCCATCAAACCAAGGACTTGGG - Intergenic
1176940541 21:14918839-14918861 CTCCATATAAACTGTTATTTTGG - Intergenic
1177409155 21:20707499-20707521 CTACATAAAAACAGGTTTTCAGG + Intergenic
1177467906 21:21513502-21513524 GTCAATAAAAAGAGGAACTTTGG - Intronic
1177758932 21:25380863-25380885 CTCCATAATCCCAGGTTCTTTGG - Intergenic
1183085312 22:35483472-35483494 CTCCCTAAGCACAGGGACTTTGG + Intergenic
1183154968 22:36067688-36067710 CTCCATATATACATGTATTTGGG - Intergenic
1184013969 22:41771434-41771456 CTCCAGAAAAAAAAGTACTGGGG - Intronic
1184305268 22:43594958-43594980 ATCAATAAAAAGAGGAACTTTGG + Intronic
953372991 3:42406035-42406057 CCCCTTAATCACAGGTACTTGGG + Intronic
955645736 3:61135267-61135289 CTGCATAAAAATATGAACTTAGG + Intronic
955683718 3:61528777-61528799 CTCCATTAAAACAAGAACTGTGG - Intergenic
956143569 3:66170023-66170045 CTCCATAAAATCACACACTTGGG + Intronic
956681723 3:71787206-71787228 GTCCATTAAAAAAGGTAGTTGGG + Intergenic
957369502 3:79274331-79274353 ATCAATAAAAACAGGAATTTTGG + Intronic
958001554 3:87756818-87756840 CTCCAGATAAACAAGTACTTGGG - Intergenic
960207738 3:114923358-114923380 CAGCATAAAAACAGACACTTAGG + Intronic
962132706 3:132698891-132698913 CTCCAAAAAAAAAGGGATTTGGG - Intronic
963185840 3:142415955-142415977 CTCCATAAAAGCAAATAATTGGG + Intronic
963347415 3:144112025-144112047 CACCATAAAAACAGGTGATTTGG - Intergenic
963412371 3:144946416-144946438 CTCCATAATAACATGAAATTAGG + Intergenic
963430828 3:145200162-145200184 ATCAATAAAAACAGATACTTTGG + Intergenic
963569546 3:146975602-146975624 TTCCAAAACAACAGGTGCTTTGG - Intergenic
970367796 4:15377986-15378008 CTCCACAAAGGCAGGGACTTTGG - Intronic
971276239 4:25199975-25199997 CTGCAAAAAAAAAGATACTTAGG - Intronic
973141964 4:46780728-46780750 CTCCATAAAAAGACTAACTTTGG + Intronic
974230089 4:59100746-59100768 TGCCATAAAAGCAGGTACTCTGG + Intergenic
974620071 4:64342271-64342293 CTCCATGAGAACAAGTACTCTGG + Intronic
976508433 4:85878712-85878734 CTCTATGATAACAAGTACTTTGG - Intronic
978627096 4:110699108-110699130 CTACAAAAAAAAATGTACTTAGG - Intergenic
979527971 4:121737292-121737314 CTCCTTAAAAACAGGTTCTTGGG - Intergenic
979566336 4:122157950-122157972 ACCCAAAAAAACAGGGACTTGGG - Intronic
983473807 4:168190011-168190033 ATCCATAACAAGAGGAACTTTGG + Intergenic
983658969 4:170112869-170112891 CTTAATTAAAACAGGTATTTAGG + Intergenic
985220698 4:187701030-187701052 CTCCTTAAAAGCAGGAACTGAGG + Intergenic
989112626 5:37921500-37921522 TTCCAAAAAAACAGGTACAAGGG - Intergenic
991057168 5:62333921-62333943 CTCCTCAATAGCAGGTACTTTGG - Intronic
992648673 5:78836053-78836075 CTATAAAAAAACATGTACTTAGG - Intronic
994773371 5:104012252-104012274 ATCCATAAGCCCAGGTACTTGGG + Intergenic
995614532 5:113946228-113946250 CTCCATACAAACAGAAACTGAGG + Intergenic
995901341 5:117070991-117071013 TGGCATAAAAACAGGTACATTGG - Intergenic
995993095 5:118266362-118266384 CTCCCTAAAAAAAGGTAATAAGG + Intergenic
996249130 5:121305332-121305354 CTAAATAAAAACAGATACTCTGG + Intergenic
996402025 5:123073116-123073138 GTCCATAAGAGCAGGTTCTTTGG - Intergenic
998452333 5:142244658-142244680 CTCCATAAATACAGTCACATTGG + Intergenic
1001162383 5:169332004-169332026 TTCCATAATATCAGGTTCTTGGG + Intergenic
1003380613 6:5621389-5621411 CTCCATAAAAACCGGGATCTTGG - Intronic
1003951448 6:11119651-11119673 CTCCAAAAAAACAGAAAATTTGG + Intronic
1008309808 6:49953034-49953056 TTCAATAAAAACAGGTTCTGAGG + Intergenic
1009621112 6:66078499-66078521 ATCAATAAAAAGAGGAACTTTGG - Intergenic
1010008525 6:71023761-71023783 CTACATGAAAACAGATACTGAGG - Intergenic
1011092427 6:83620398-83620420 ATCCATATAACCTGGTACTTCGG + Intronic
1011269862 6:85566962-85566984 CACCAAAAACAAAGGTACTTGGG + Intronic
1011468539 6:87684331-87684353 CTCCATACCATCAGATACTTAGG + Intronic
1014518198 6:122405073-122405095 CTCCATAAAGGTAGGCACTTTGG - Intronic
1016425045 6:143926422-143926444 ATCAATAACAACAGGAACTTTGG - Intronic
1016906875 6:149159434-149159456 ATCAATAAGATCAGGTACTTTGG - Intergenic
1017049884 6:150380626-150380648 CTCCATAGACACAGGTTCTGTGG - Intronic
1018435412 6:163754369-163754391 CTCAAAAAGAAAAGGTACTTTGG - Intergenic
1018538060 6:164844997-164845019 CACCATAAAAACATGAATTTTGG - Intergenic
1020687734 7:11316372-11316394 CTTCATAAAAACAAGTGCTGTGG + Intergenic
1021020362 7:15590738-15590760 ATCCATAAACACATTTACTTTGG - Intergenic
1021972176 7:25976210-25976232 CTCCATGAGAATAGGAACTTTGG - Intergenic
1022435096 7:30375557-30375579 ATTTATAAAAACAGGTACTTTGG - Intronic
1022605878 7:31813468-31813490 CTCCACTAAAACTGGAACTTGGG - Intronic
1028235348 7:88354648-88354670 CACCATAAGAGCAGGTACTCTGG + Intergenic
1030321018 7:108167536-108167558 CTTTAGAAAAACCGGTACTTGGG - Intronic
1030514741 7:110525613-110525635 ATTCATAAGAACAGGTACCTGGG + Intergenic
1030984754 7:116228361-116228383 GTCCAAGAAAACAGGTCCTTTGG - Intronic
1031826162 7:126568372-126568394 CTCTATTAACACAGGTAATTCGG + Intronic
1035231600 7:157469009-157469031 CTCCATAAGAACACGGGCTTTGG + Intergenic
1035970723 8:4245299-4245321 CTGCATAAAAGTATGTACTTGGG + Intronic
1039539745 8:38354967-38354989 GTTCATAAAAACAGATATTTTGG + Intronic
1042280961 8:67055565-67055587 CACCATCAAAAAAGGTACGTAGG + Intronic
1043617085 8:82139147-82139169 CTCCAAAAAAACAGTTAATTAGG + Intergenic
1045020426 8:98038704-98038726 TGCCATAAAAAAAGGTACTAAGG + Intronic
1046343657 8:112892864-112892886 CTCTATAAAAATAAGAACTTTGG + Intronic
1046487515 8:114906916-114906938 CTTCATAAAATCAGCTAGTTAGG - Intergenic
1047211190 8:122841718-122841740 CTCCACAAAAGCAGGGGCTTGGG - Intronic
1047850672 8:128853686-128853708 GTTCATTAAAACAGGAACTTTGG + Intergenic
1049165934 8:141126538-141126560 CTCCTTAAAACCAGATAATTGGG - Intronic
1050703962 9:8374308-8374330 CACCATATAATCAGGTACATTGG + Intronic
1056291057 9:85144297-85144319 CTTCAGAAAAACAGCCACTTTGG - Intergenic
1059108637 9:111533669-111533691 CTCAAAAAAAAAAAGTACTTAGG + Intronic
1187983371 X:24783543-24783565 GTCCATAAAAGAAGGTATTTTGG - Intronic
1195057932 X:101164631-101164653 CTCCATAAAAACAGGTACTTTGG - Intergenic
1196886886 X:120254501-120254523 ATCCATCAAAACTGGTATTTTGG - Exonic
1197662220 X:129186624-129186646 CTCCATAAAAATATGGAATTCGG - Intergenic
1198176318 X:134159184-134159206 CTCCATAAATACAGGTCCTTGGG + Intergenic
1199415369 X:147576195-147576217 ATCCATAAAAAAAGGAATTTTGG + Intergenic
1199734037 X:150667490-150667512 GGCCATAAAAATAGGTATTTGGG + Intronic
1201857510 Y:18561273-18561295 CTCCATAAAAACGCCTATTTGGG + Intronic
1201859442 Y:18580002-18580024 CTCCATAAAAACACCTGTTTGGG + Intronic
1201873879 Y:18740379-18740401 CTCCATAAAAACACCTGTTTGGG - Intronic
1201875811 Y:18759108-18759130 CTCCATAAAAACGCCTATTTGGG - Intronic