ID: 923634061

View in Genome Browser
Species Human (GRCh38)
Location 1:235677276-235677298
Sequence ATGTATGCCTTATGTACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923634061_923634063 19 Left 923634061 1:235677276-235677298 CCTATTGTACATAAGGCATACAT 0: 1
1: 0
2: 2
3: 10
4: 110
Right 923634063 1:235677318-235677340 TGACTTCAATAAAATATAATAGG 0: 1
1: 0
2: 6
3: 47
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923634061 Original CRISPR ATGTATGCCTTATGTACAAT AGG (reversed) Intronic
906078189 1:43067493-43067515 ATGTCTGCCTTCTGGCCAATGGG + Intergenic
909791491 1:79684599-79684621 ATGTATGCCTTATCAATAAGGGG - Intergenic
909857893 1:80562784-80562806 ATGTATATTTTATGTCCAATAGG + Intergenic
912726880 1:112066638-112066660 ATGTATTTCTATTGTACAATAGG + Intergenic
913154306 1:116079803-116079825 CTGTATGCCTGATTTACAAGAGG - Intergenic
915927011 1:160030308-160030330 ATGTTTGCCTTATATATAAAAGG - Exonic
917012610 1:170491140-170491162 ATGTATACCTCATGTATAAATGG + Intergenic
919644078 1:200075225-200075247 ATGTCTGACTTATGTATACTTGG - Intronic
923285284 1:232488490-232488512 ATGTTTTCCTCATGTACAATGGG + Intronic
923634061 1:235677276-235677298 ATGTATGCCTTATGTACAATAGG - Intronic
923995560 1:239490244-239490266 ATGAATGTCTTATGTACATGTGG + Intronic
1064594761 10:16932420-16932442 ATGTATGCCTTATACAAAATTGG - Intronic
1065559929 10:26952759-26952781 GTGAATGCCGTATGTCCAATTGG - Intergenic
1067919866 10:50443190-50443212 AGGGATGCCTTATCTACATTAGG - Intronic
1071420819 10:85496074-85496096 ATGTATGTCTTATTTTAAATAGG + Intergenic
1073088879 10:100915519-100915541 ATGTATGCCAAATGAATAATGGG - Intronic
1074523256 10:114243670-114243692 ATGTCTGCCTTCTCTACCATCGG - Intronic
1075883728 10:125878542-125878564 ATGTATGCCTCATGTATACACGG - Intronic
1078770509 11:14346819-14346841 ATGTATTTATTATGTACAACAGG - Intronic
1079489729 11:20974082-20974104 ATGTAAGCCTTATGAAGACTGGG + Intronic
1087387360 11:97488818-97488840 CTGTAGGCCTTATGTAGAACAGG - Intergenic
1088023460 11:105148825-105148847 GTGAGTGCTTTATGTACAATGGG + Intergenic
1088054126 11:105554743-105554765 ATGTATGCCTCCTATATAATTGG + Intergenic
1088418082 11:109611850-109611872 ATGTATGTATTATATATAATGGG + Intergenic
1088751843 11:112848961-112848983 ATGTATCCCTGATGACCAATTGG + Intergenic
1091637416 12:2207903-2207925 ATGTGTGCCTTTTTTACAAATGG + Intronic
1094040066 12:26113272-26113294 ATGTATGCATAATGTCCTATAGG - Intergenic
1099199567 12:79659492-79659514 ATGTATTACTTCTGTACAAATGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1101476385 12:105053048-105053070 ATGCATGTCTTCTGTACAGTCGG - Intronic
1103199220 12:119072851-119072873 AGTTATTCCTTCTGTACAATGGG - Intronic
1104220157 12:126774940-126774962 ATGTATTACTTATGTAAAAATGG + Intergenic
1105665880 13:22555614-22555636 ATCTATGCACTATTTACAATAGG - Intergenic
1106818715 13:33439304-33439326 ATATATGCCTTATTTTCAAGAGG + Intergenic
1108915995 13:55612564-55612586 ATGTTTGCCTTTTTAACAATAGG - Intergenic
1110784375 13:79506273-79506295 ATGTTTGTCTTATTTAAAATTGG + Intronic
1112106677 13:96247812-96247834 TTGTATGCAGTATGTACATTAGG - Intronic
1115090309 14:29567000-29567022 AGTTATGCCTTATATACAATGGG + Intergenic
1115426505 14:33266583-33266605 CTATATTCCTTATGTACACTTGG + Intronic
1116152782 14:41163345-41163367 ATGTATGCATTATGGAGATTTGG + Intergenic
1119966773 14:78925295-78925317 ATGTATGCCCTAGGTGCAGTGGG + Intronic
1120522507 14:85540988-85541010 ATATAAGTCTTATGTACTATGGG + Intronic
1121388170 14:93549758-93549780 ATGTTTGCCTTATTAACAGTTGG + Intronic
1121580709 14:95027512-95027534 ATGTTTCCCTTATGTACAATGGG - Intergenic
1121942379 14:98083555-98083577 ATGACTGCCTTATGTAGAAATGG - Intergenic
1123662259 15:22574887-22574909 TTGTATGCCTTATCTGCATTTGG + Intergenic
1124261959 15:28200619-28200641 TTGTATGCCTTATCTACATTTGG - Intronic
1124316059 15:28669169-28669191 TTGTATGCCTTATCTACATTTGG + Intergenic
1125835200 15:42743872-42743894 TTGTGTGCCTCATGTACACTTGG - Exonic
1126408079 15:48343578-48343600 ATTTCTGCATTCTGTACAATGGG - Intergenic
1128218634 15:65952166-65952188 ATGTATCCCTCATGGATAATGGG + Intronic
1133584141 16:7175579-7175601 AAGTGTGCCTTATGCACAAATGG - Intronic
1139048520 16:63094173-63094195 CTGGATGCCTTAGGTATAATAGG + Intergenic
1139122769 16:64041153-64041175 CTGTATGCCCAATGAACAATGGG + Intergenic
1140294130 16:73691646-73691668 CTGTAAGCCTGATGTAAAATGGG - Intergenic
1158221174 18:55152193-55152215 ATTTATGCTTTATTTGCAATCGG + Intergenic
1158654406 18:59316770-59316792 ATAGATGCCTTATCTGCAATCGG + Intronic
1160094873 18:75862115-75862137 ATGCATGCCTTATCTACCACAGG - Intergenic
925766945 2:7245332-7245354 ATGTATGGCTTATCTGCGATAGG + Intergenic
931646127 2:64423670-64423692 ATGTATGTCATATATACTATGGG + Intergenic
931910596 2:66895631-66895653 ATGTATGCCTGACATACAGTAGG - Intergenic
932552621 2:72786970-72786992 TTGTATGGCTTATGAACTATAGG + Intronic
933200392 2:79441212-79441234 AGGTATGCCTCATGAACAACAGG - Intronic
946993111 2:225358695-225358717 ACGTTTGCCTTATATACAACTGG + Intergenic
947042225 2:225936180-225936202 ATGTATGTGTTATGTAGACTAGG - Intergenic
1173953812 20:47015207-47015229 CTTTATGCCTTTTGTACTATTGG + Intronic
1178069446 21:28947052-28947074 ATGTTTGTCTTCTCTACAATAGG + Intronic
949230160 3:1741361-1741383 ATGTATGTTTTAAGAACAATTGG - Intergenic
952328071 3:32338665-32338687 AATTTTGCCTTATATACAATAGG - Intronic
952631518 3:35474972-35474994 ATGTATGCCCTATGGATAAGGGG - Intergenic
952651758 3:35736009-35736031 ATGTACTCATTATGTAAAATTGG + Intronic
954046300 3:47934039-47934061 ATGTGTGACCTATGTAAAATTGG - Intronic
955433649 3:58875720-58875742 ATTTATCCATTATCTACAATAGG - Intronic
956147403 3:66204785-66204807 ATGTCTGCCGTGTGTACAGTAGG + Intronic
956866699 3:73376149-73376171 ATGTTTCCCTTATGAACAACAGG - Intergenic
959300129 3:104588373-104588395 ATGTATGCCATATGTGTAATGGG + Intergenic
963211563 3:142698323-142698345 ATGTATTCTTTTTTTACAATTGG + Intronic
964423375 3:156528439-156528461 AGGTATGCCTTATTTGCAGTTGG - Intronic
964445740 3:156755398-156755420 ATGTATACCTTATGTATACATGG - Intergenic
967896904 3:194402764-194402786 ATGTATGCCTTTTTGACAAGAGG + Exonic
968034715 3:195537273-195537295 ATGTCTGCCTTATTTTAAATAGG - Intronic
971607164 4:28672476-28672498 CTGTATGGCTTTTGTACAATTGG - Intergenic
972496119 4:39636516-39636538 ATGTATCCCTTGTGGATAATGGG - Intronic
972931328 4:44074896-44074918 ATATATGTTTTATGTATAATTGG - Intergenic
977309757 4:95371330-95371352 AGGTCTGCCTTATGTACAGTGGG - Intronic
978023089 4:103838070-103838092 ATGTAGGCCATATGTACAATAGG + Intergenic
978170712 4:105666636-105666658 TGGTATGCCTTATGTAGAAAAGG - Intronic
978647126 4:110948383-110948405 ATGTATCCCTTATGAATAAGGGG - Intergenic
987592399 5:19947079-19947101 ATATATGCTTTATGTAGTATAGG - Intronic
987642200 5:20627285-20627307 ATGCTTGCATTATATACAATTGG - Intergenic
991626457 5:68606520-68606542 ATGTCTGCTATATGTATAATTGG + Intergenic
991993812 5:72367568-72367590 ATGTAAGGAATATGTACAATAGG - Intergenic
992992616 5:82299408-82299430 TTCTATGTCTGATGTACAATGGG + Intronic
999435787 5:151562347-151562369 ATGTCAGCCTTCTCTACAATAGG + Intronic
1006263695 6:32897504-32897526 ATTTACTCCTTATGTACACTTGG - Intergenic
1011016558 6:82762782-82762804 ATGGATACCTTATGAACTATTGG - Intergenic
1011648052 6:89479002-89479024 ATGTCTGCATTATGTAAACTGGG - Intronic
1012136563 6:95564543-95564565 ATGGATGCCTAATGTCAAATTGG + Intergenic
1018322424 6:162626005-162626027 ATGAATGACTTATTTACAACTGG + Intronic
1021858719 7:24884206-24884228 TTCCATGCCTTATGTACAAATGG - Intronic
1023022697 7:36024573-36024595 ATGTATGCCCTTTGTCCATTGGG + Intergenic
1024673704 7:51619498-51619520 ATGTATTCCCTATGGACAACAGG - Intergenic
1024919217 7:54540219-54540241 ATGTATGCATTATCTTCTATAGG - Intergenic
1030567057 7:111170688-111170710 ATGTATACCTTAGGTAAACTGGG - Intronic
1032673539 7:134107444-134107466 GTGTATGCCTTATGTAAATGAGG + Intergenic
1032950075 7:136898228-136898250 ATGTTAGCCTTATGTACTTTGGG + Intronic
1033706643 7:143893116-143893138 TAGTATGGCTTATGTACAATGGG + Intronic
1036019272 8:4825069-4825091 ATGTATGCAGTATTTAAAATGGG - Intronic
1036959795 8:13231501-13231523 ATGTATTCCTTTTGTAAATTAGG - Intronic
1038966909 8:32584030-32584052 ATTTATGCTTTTTGTAAAATAGG + Intronic
1039348443 8:36734144-36734166 CTGTATGGCTTATGTTCCATGGG - Intergenic
1044431890 8:92117239-92117261 ATGTATACTTTATATACAATTGG + Intergenic
1047527226 8:125643976-125643998 ATGTTTGCAAAATGTACAATAGG + Intergenic
1051661222 9:19428753-19428775 ATGAATGGCTTATGGACAAGTGG + Intronic
1052348602 9:27435319-27435341 ATGTATACTTTATGTACACATGG - Intronic
1055360589 9:75485720-75485742 AAAAATGCCTTATATACAATAGG - Intergenic
1058248100 9:102655854-102655876 ATGTGTGGCTTGTGTAAAATAGG + Intergenic
1188576113 X:31652161-31652183 ATGTGGGCCATATGTATAATTGG - Intronic
1189633909 X:42984761-42984783 ATGTATACCTTATGTATATGTGG + Intergenic
1193682261 X:84537101-84537123 ATGTTTGTCTTATGTAAAAAAGG - Intergenic
1193873087 X:86825596-86825618 ATATATGCCATATGTACATGTGG + Intronic
1194455229 X:94095107-94095129 CTGTAAGGCTTTTGTACAATGGG - Intergenic
1196678191 X:118442749-118442771 GTCTATGCCTTATGTTTAATGGG + Intronic