ID: 923636347

View in Genome Browser
Species Human (GRCh38)
Location 1:235701039-235701061
Sequence AAGCATTTAAATGGGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923636347 Original CRISPR AAGCATTTAAATGGGGGTCA GGG Intronic
904158196 1:28502463-28502485 CAGCATTTAAATGGTGTTCGAGG - Intergenic
906400565 1:45501257-45501279 AACCGTGTAAATGGGGGTCGGGG - Intronic
906705693 1:47893570-47893592 AAGCATTGAAATGTGAGGCAAGG - Intronic
908334029 1:63101771-63101793 AAGCATGAGAATGGGGATCATGG - Intergenic
911415808 1:97571914-97571936 AAACATTTAGATGGGAGTCCAGG + Intronic
913304134 1:117406304-117406326 AAGCATTTAAAATGGGGGAAAGG - Intronic
914387327 1:147182753-147182775 CAGCAGTGAAATGAGGGTCAAGG + Intronic
914957701 1:152179298-152179320 AAGGATTTAACTGGGATTCAAGG - Intergenic
916823805 1:168425717-168425739 AAGAATTGAAATGGGGGTAGGGG - Intergenic
917517216 1:175718298-175718320 GAGCATTTAAATGAGAGTGAAGG - Intronic
919077187 1:192827957-192827979 AGGCATTTAAATAGGCATCAAGG + Intergenic
919617222 1:199822771-199822793 AAGCATTGAAATGGGCATCTTGG - Intergenic
919757567 1:201075419-201075441 AGGGCTTAAAATGGGGGTCAAGG - Intronic
921844245 1:219862001-219862023 AAGAATATAAATGTGGTTCAGGG + Intronic
922866003 1:228862085-228862107 AAGCCTTTAAATATGGGACATGG - Intergenic
923636347 1:235701039-235701061 AAGCATTTAAATGGGGGTCAGGG + Intronic
924174149 1:241372633-241372655 AAGCATTTTAATGGTGCTCTTGG - Intergenic
1064569017 10:16673138-16673160 AAGCATTTCAATGGGGTCAAAGG - Intronic
1066313460 10:34220662-34220684 AAGCTGTGAAATGGGGGTGATGG + Intronic
1066525149 10:36270004-36270026 AAGTATTGAAATGGAGGTCCTGG + Intergenic
1067757838 10:49018659-49018681 ATGGGTTTGAATGGGGGTCAGGG - Exonic
1071176646 10:82933960-82933982 AAGGAGGTAAATGGGGGTCTGGG + Intronic
1083447141 11:62715665-62715687 TCGCATTTAAAAGGGGGTCACGG - Intronic
1087245522 11:95831431-95831453 AAGCATTTAAATGGAAACCAGGG + Exonic
1093513241 12:19953796-19953818 AATCATGTGAATGGGGGTAAGGG + Intergenic
1093916869 12:24813060-24813082 AAAAATTGAAATGGGGGTGATGG - Intronic
1094361290 12:29634112-29634134 AAGCATTTTAATGAGGGGCTGGG - Intronic
1095828569 12:46557893-46557915 TATCATTTAAATGGGGGAAATGG + Intergenic
1098353392 12:69586096-69586118 AAGCATTTAAGTGGGAGAGAGGG - Intronic
1098394832 12:70006351-70006373 GAGCATTACACTGGGGGTCAGGG + Intergenic
1098430810 12:70418040-70418062 AGGCATTTAAAAGGAAGTCAAGG - Intronic
1098853771 12:75629014-75629036 AAGCATTTACATGGTGGCCCTGG + Intergenic
1099079744 12:78162082-78162104 AGGTTTTTAAATTGGGGTCATGG + Intronic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1110505618 13:76282760-76282782 AAGAATCCAAATGGGGGTGAAGG - Intergenic
1111118053 13:83807350-83807372 AACCATATAAAAGGTGGTCATGG + Intergenic
1111590800 13:90346781-90346803 AAGCAGTTAAAATGGAGTCATGG - Intergenic
1111802924 13:93002229-93002251 AAGCAGTAGAATGGGGGTTATGG + Intergenic
1112796659 13:103064533-103064555 AAGCTGTTTATTGGGGGTCAAGG + Intronic
1114424935 14:22613615-22613637 AAGGAAATGAATGGGGGTCAGGG + Intergenic
1118985315 14:70749437-70749459 AAGCATTCTAGTGGGAGTCAGGG + Intronic
1119195298 14:72713254-72713276 AAGCAGCCAAATGGGAGTCATGG + Intronic
1121388740 14:93555947-93555969 AAGTTTTTAAATTGGGTTCAGGG + Intronic
1121430041 14:93880071-93880093 AAGCATTTAAATGTGCGGCTGGG - Intergenic
1123501147 15:20882267-20882289 AAGCATTAAAATTGGGCACAAGG + Intergenic
1123558399 15:21455972-21455994 AAGCATTAAAATTGGGCACAAGG + Intergenic
1123594630 15:21893247-21893269 AAGCATTAAAATTGGGCACAAGG + Intergenic
1125113058 15:36056076-36056098 AAGCAGTTAAAGGGGGGTTGGGG + Intergenic
1125199737 15:37092549-37092571 AAGCCTGGAAATGGGGGACAGGG - Intronic
1126560155 15:50034673-50034695 GAGCAATTAAATGAGGGTCTTGG - Intronic
1126670247 15:51109792-51109814 AAGCAGGTAGATGGGAGTCAAGG + Intergenic
1127052637 15:55100805-55100827 AGGAATTTAAATGGGGCTGAAGG - Intergenic
1127265145 15:57355114-57355136 AAGGATTGCAGTGGGGGTCAGGG - Intergenic
1127812606 15:62577568-62577590 AAGGAATTAAATGGGGGCCTAGG + Intronic
1202966749 15_KI270727v1_random:183122-183144 AAGCATTAAAATTGGGCACAAGG + Intergenic
1134625305 16:15718824-15718846 CAGCATTGAAATGGGGGTCCAGG + Intronic
1136657594 16:31719740-31719762 AAGCAGTTAAATGGGAGCAAAGG + Intronic
1140449036 16:75055187-75055209 AAGCATTAAAATGGGAGCAATGG - Intronic
1144032352 17:11334100-11334122 GAGCATGAAGATGGGGGTCATGG + Intronic
1145922920 17:28624675-28624697 AAGAAATAAAATGGGGGTAAGGG - Intronic
1147261197 17:39210550-39210572 AAACATTTAATTAGGGGTCTGGG + Exonic
1147592148 17:41690741-41690763 AAAGTTTTAAATGGGGGACAGGG - Intronic
1149014806 17:51896094-51896116 AAGCTTTTATATTGGGTTCAGGG + Intronic
1150483918 17:65531144-65531166 AAGCATTTAATTGTGTCTCAGGG + Intronic
1150629027 17:66864258-66864280 AATCTTTCAAATGGGGGTCTGGG - Intronic
1151176288 17:72290964-72290986 AAGCATTCAAATAATGGTCAAGG - Intergenic
1153220360 18:2855434-2855456 TAGCATTCAAATAGGGGTAATGG + Intronic
1155366840 18:25057311-25057333 AATCATGTAAATGGGTGACAAGG - Intergenic
1157168691 18:45382369-45382391 GAGCAGTATAATGGGGGTCAAGG + Intronic
1157708877 18:49834298-49834320 AAGGATTAAAAAGGGGTTCAGGG - Intronic
1158699010 18:59729858-59729880 AAGCATGGGAATGGGTGTCAAGG + Intergenic
1158734287 18:60062207-60062229 AAGCATTTATATGGGTGTTAAGG - Intergenic
1159814939 18:73061299-73061321 ATGCATTTAAACAGGGGTAAAGG + Intergenic
1161679265 19:5671301-5671323 AAGCAGTTAAATGGGAGTCTGGG - Intergenic
1162959832 19:14118953-14118975 AAGCACTTAAGAGAGGGTCAGGG + Intergenic
1164635106 19:29786072-29786094 CAGCATCTCAGTGGGGGTCAGGG + Intergenic
929133815 2:38603353-38603375 AAGCATTTAAATTAGCGGCAGGG - Intronic
931236337 2:60415925-60415947 AAGCAGTTTAATGGGGGAAAGGG - Intergenic
934492286 2:94769584-94769606 CTGCATATAAAGGGGGGTCATGG + Intergenic
934992263 2:98930172-98930194 AAGCACTTGCATGGGGGCCACGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937481698 2:122268225-122268247 AAGCAGATAAATGGTTGTCAGGG - Intergenic
937797673 2:126043206-126043228 AAGTAGTTAAATGGGGGAAAAGG + Intergenic
940023532 2:149181080-149181102 TCTCATTTAAATGGGGGTGAGGG + Intronic
940338365 2:152552818-152552840 TAGGATTTAAATGGTGGTGAGGG + Intronic
940667468 2:156626086-156626108 AAACATTCAAATGGTGGTAAAGG + Intergenic
942326390 2:174780262-174780284 AATTATTTAAAGGGAGGTCAGGG - Intergenic
942588731 2:177517177-177517199 AAGCATTTAAAAGGGAGGTAAGG - Intronic
943266921 2:185743207-185743229 ATGCTTTTAAATGTGGATCATGG - Exonic
944120089 2:196231347-196231369 AAGCATTAAACTTGGGGTCAGGG - Intronic
944416620 2:199485487-199485509 CAGCTTTTAAATGCTGGTCAAGG + Intergenic
946344534 2:219098164-219098186 AACCATTTAAATGGGGTTTTGGG - Intronic
947308480 2:228774215-228774237 AAGCATTTTAATGAGGGTCTAGG - Intergenic
948093542 2:235315543-235315565 AAGCATAGAAATCTGGGTCAAGG + Intergenic
1171720752 20:28560699-28560721 GAGCATTTAAATGGATGTCCAGG - Intergenic
1171757294 20:29122619-29122641 GAGCATTTAAATGGACGTCCAGG + Intergenic
1171863314 20:30421506-30421528 GAGCATTTAAATGGATGTCCAGG + Intergenic
1172961463 20:38803257-38803279 CAGCATATGAATGGGGGTGAGGG + Intergenic
1173027836 20:39325789-39325811 CAGCATGTCAATGGGGTTCAGGG + Intergenic
1173523233 20:43714167-43714189 AGGCTTTTAACTGGGGCTCAGGG - Intronic
1175349015 20:58305079-58305101 TAGAATTTAAATGTGTGTCAGGG - Intergenic
1177412384 21:20747180-20747202 AGGCATTTAAATCAGGGTTATGG - Intergenic
1177413479 21:20762598-20762620 AAATTTTTAAATGGAGGTCAGGG + Intergenic
1178963110 21:37086484-37086506 ACGTATTTCAATGGGGGGCAAGG - Intronic
1179514247 21:41895578-41895600 AAGATTTTAAATGGGAGACAGGG + Intronic
1182933853 22:34201390-34201412 CAGCATTTAAAAAGGGGTCGAGG - Intergenic
949977467 3:9474185-9474207 AACATTTTAAATGGGGGTTAAGG + Intronic
950373711 3:12552699-12552721 AAAGATTTAAATGTGGGGCATGG - Intronic
953846986 3:46435535-46435557 AGGCTTTTAAATGGGGGGCGTGG - Intergenic
956442911 3:69297633-69297655 AAGCATTTAAATAGGAGTGCAGG - Intronic
956904283 3:73749897-73749919 CAGTATTTAATTGGTGGTCAGGG + Intergenic
957920115 3:86735884-86735906 GAGCATTTTAATGGAGGTTATGG - Intergenic
958439599 3:94139749-94139771 AATCAATTAAGTGGGGGTCAAGG - Intergenic
958897265 3:99843050-99843072 ATGAATTTAAATGGGGTTTAAGG + Intronic
959828059 3:110824520-110824542 AAGCATTTAAGTTGGGGTGAGGG - Intergenic
960239802 3:115327235-115327257 ATGTATTTAAATGGGGGTATTGG - Intergenic
960489395 3:118295226-118295248 AAGAAAATAAATGGGGCTCAGGG - Intergenic
960957811 3:123046648-123046670 AAGCATCTTAATGGGGTTAAAGG + Intergenic
972734036 4:41822722-41822744 AATCAATTAAACTGGGGTCAGGG + Intergenic
974111519 4:57531489-57531511 AAGTAATGAAATGGGGGTAAAGG + Intergenic
976543898 4:86310653-86310675 AAGCATTTCAATAGGTTTCAAGG - Intronic
976895245 4:90101575-90101597 AAGCAATTTAATGGTGGACATGG - Intergenic
979506214 4:121500708-121500730 AAACAATTAAATGGGGGTTGGGG + Intergenic
981113220 4:140959261-140959283 AGGCAGCTAGATGGGGGTCAAGG - Intronic
984247098 4:177287651-177287673 AAGAAATTACAGGGGGGTCAAGG + Intergenic
986937383 5:12905925-12905947 AAGTAATTAAATGGTGTTCATGG - Intergenic
987051247 5:14148156-14148178 AATCATTTAAATGGTGGAAATGG - Intronic
988242164 5:28627623-28627645 AAACATTTAAATGGGGGACCAGG + Intergenic
988287413 5:29238119-29238141 AAGCATTTAAAAGGGGACTAAGG - Intergenic
994319061 5:98368603-98368625 AAGCTATTAAATGATGGTCACGG + Intergenic
995175309 5:109169544-109169566 AAGAATGTAAATGGGAGGCAAGG + Intronic
996398289 5:123034806-123034828 AATCATTGAAATGGGGAGCAAGG - Intronic
996838549 5:127821488-127821510 AAGTATTTAAAAGGGACTCATGG - Intergenic
999610278 5:153361913-153361935 AGGCATTTAAATGGGACTCAGGG + Intergenic
1006791559 6:36704449-36704471 CAGCATTCAAATGGGGGTCTTGG - Intronic
1007310950 6:40945724-40945746 ATGCATGTAATTGGGGTTCAGGG - Intergenic
1008905443 6:56672613-56672635 GAGCATGTAAATGGTGGACATGG - Intronic
1009496793 6:64359333-64359355 AAGTATTTAAATTGGGTTAATGG - Intronic
1009498595 6:64382458-64382480 AAGCAACTAAATGGAGGTGAGGG - Intronic
1010285528 6:74073503-74073525 AAGCATTTCCATGGGGGCAAAGG + Intergenic
1012453109 6:99374719-99374741 AGGCATTTAAGTGGGGCTTAAGG - Intronic
1013228821 6:108142644-108142666 AAGGATTAAATTGGGGGTAATGG - Intronic
1013692287 6:112660249-112660271 AAGAATCTAAATGGGACTCAGGG - Intergenic
1015079876 6:129210782-129210804 AAGGATTCAAATGGGTGACATGG + Intronic
1016316732 6:142797854-142797876 AGGCATTCAATTGGGGGTCTTGG + Intronic
1016718433 6:147263228-147263250 AAGCCTTTCAATGGGAGGCATGG + Intronic
1017810265 6:157979422-157979444 AACCATTCCACTGGGGGTCAGGG + Intergenic
1018282534 6:162203011-162203033 AAGCTTTGAAAGGGGAGTCAGGG + Intronic
1018645650 6:165945451-165945473 AAGCATATAAATTGGGGTGTGGG - Intronic
1019385449 7:753217-753239 AAGCATTCAAATGGTGTCCAGGG - Intronic
1019518904 7:1451879-1451901 GAGCATTCTTATGGGGGTCAGGG - Intronic
1020970670 7:14933399-14933421 AAGAATTTAATTGGGGGCAAAGG - Intronic
1027247517 7:76377249-76377271 AAGCATTTAGCTGGGGTTGAAGG - Intergenic
1030305340 7:108012619-108012641 AAGCTCTTAAATTGGGATCATGG + Intergenic
1031151565 7:118059976-118059998 GGGCATTTAAATGGGGGTAGAGG - Intergenic
1031383141 7:121112920-121112942 AAATATTTAAATTGGGGGCAAGG + Intronic
1031668389 7:124513945-124513967 GATTATTGAAATGGGGGTCATGG + Intergenic
1033391970 7:140937148-140937170 ATGCATTTGCATGGGGGTCTGGG + Intergenic
1033778815 7:144645522-144645544 AGGCAGTAAAATGAGGGTCAAGG - Intronic
1034222583 7:149458118-149458140 TATCATTTAAGTTGGGGTCAGGG + Intronic
1038322138 8:26537006-26537028 AAGTATATAAATGGAGGTTATGG + Intronic
1038992544 8:32884425-32884447 AAGCTTTAAAATGGGGGAAATGG - Intergenic
1039696917 8:39922768-39922790 GATCATTTAATTGGGGGTAAAGG + Intronic
1041536674 8:58933964-58933986 AAGCATTGAAATGAGAGCCATGG - Intronic
1041611745 8:59858209-59858231 AAGCATTTAAATAGGAAGCAAGG + Intergenic
1041732280 8:61074976-61074998 AAGCATTTAAAAGGGGGGGGAGG - Intronic
1047459120 8:125045425-125045447 AACCATTGAAATGGTGGTTAAGG - Intronic
1052198903 9:25753428-25753450 AAGAATTTTAATTGGGGTCCAGG + Intergenic
1053748160 9:41221988-41222010 GAGCATTTAAATGGATGTCTTGG + Intergenic
1054338231 9:63828584-63828606 GAGCATTTAAATGGATGTCTTGG - Intergenic
1054842312 9:69756532-69756554 AAGAAATTAAATGAGAGTCAAGG + Intronic
1057269371 9:93640372-93640394 AAGCATGTGGGTGGGGGTCAAGG - Intronic
1061525810 9:131161238-131161260 AGGCATTTCAATAGGGTTCAAGG - Intronic
1202784290 9_KI270718v1_random:32701-32723 GAGCATTTAAATGGATGTCTTGG + Intergenic
1202801148 9_KI270720v1_random:201-223 GAGCATTTAAATGGATGTCCAGG - Intergenic
1186429876 X:9496182-9496204 AAGTGTTTAAATTGGGGACATGG + Intronic
1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG + Intronic
1189651405 X:43193575-43193597 AAGCAGTTAAATGAGGCACAAGG - Intergenic
1191715228 X:64189822-64189844 GAGCATGTGAATGGGGATCAGGG - Exonic
1192234059 X:69285103-69285125 TAGCATTTTAAAGGGGGCCATGG + Intergenic
1194419537 X:93656440-93656462 AAACATAGAAATGGGGGTCTAGG + Intergenic
1197336646 X:125217022-125217044 AAGCATCAAACTGGGGGTCTCGG - Intergenic
1198130176 X:133686238-133686260 TAGCATTTAGATGGTGCTCAAGG + Intronic
1198667297 X:139038418-139038440 AAGGTTTTAAAAGGTGGTCATGG - Intronic
1199576937 X:149321445-149321467 AAGAATTTAAAGGGGGGTGGGGG - Intergenic
1200872835 Y:8121904-8121926 AAGCATTAAAATGCAGGTCCAGG + Intergenic