ID: 923640493

View in Genome Browser
Species Human (GRCh38)
Location 1:235754518-235754540
Sequence CTGAAAAGACAGGTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 487}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923640493 Original CRISPR CTGAAAAGACAGGTGAGGCT GGG (reversed) Intronic
900156387 1:1204928-1204950 CTGACAGGAGAGGTCAGGCTGGG - Intronic
900687258 1:3956729-3956751 CTGAAAGGACAGGCCTGGCTGGG + Intergenic
900896443 1:5486214-5486236 CTGACTAGACAGGTGAGGGCTGG - Intergenic
902044048 1:13512510-13512532 CTGAGAGGCCAGGTTAGGCTCGG + Intronic
902383691 1:16064644-16064666 CTGAGAAGACAGGAGATGCTTGG - Intronic
902990574 1:20184856-20184878 TTGAGAAGAAAGGAGAGGCTGGG + Intergenic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904441870 1:30537090-30537112 CTGTAACAACAGGTGAGTCTTGG + Intergenic
905167843 1:36093503-36093525 CTGAGTACACCGGTGAGGCTGGG + Exonic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905536078 1:38722855-38722877 CTGAAAAGACAGCTGTGTCACGG - Intergenic
905536292 1:38724640-38724662 CATAAAAGTTAGGTGAGGCTTGG - Intergenic
905750557 1:40459417-40459439 CTGAAAGAACAGGGGAGGTTAGG - Intronic
906101260 1:43264658-43264680 ATGAAAAAACTGGTTAGGCTGGG - Intronic
907044147 1:51289452-51289474 CAGGAAAGACATCTGAGGCTGGG - Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907492804 1:54819664-54819686 CTTCAAAAACAGGTGAGGCCGGG - Intronic
907588246 1:55640927-55640949 CTGAGAAGGCAGCTGAGGTTGGG + Intergenic
907882120 1:58560318-58560340 ATGAAAAGACATGAAAGGCTGGG + Intergenic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
910011080 1:82463055-82463077 CTGAAAAGACACGACTGGCTTGG + Intergenic
910012370 1:82481212-82481234 CTGAAGTCACAGGTAAGGCTGGG + Intergenic
913044605 1:115062945-115062967 CTGAAAAGAACGCTGAGGCCAGG - Intronic
914457260 1:147847650-147847672 GTGAAAAGAACGGTGAGGGTGGG - Intergenic
914503770 1:148270591-148270613 CTGACAAGACATGTGTGGCAGGG - Intergenic
914509830 1:148321674-148321696 CTGAAAAGACACATGTGGCAGGG + Intergenic
915024898 1:152818469-152818491 GGGAAATGACAGGAGAGGCTGGG + Intergenic
916064243 1:161123342-161123364 TTGAAAAGACATGTGAGACCAGG + Intronic
916506049 1:165429034-165429056 CAGGAAAGAAAGGTGGGGCTAGG - Intronic
916580443 1:166102262-166102284 TTGTAAAGACCGTTGAGGCTAGG + Intronic
917283121 1:173397895-173397917 GTGAAAAGACAGATGGGTCTTGG + Intergenic
917979905 1:180262726-180262748 CTGAGTAGTCAGGGGAGGCTTGG - Intronic
918099261 1:181359489-181359511 CTGAAGGGAGAGGTGATGCTGGG + Intergenic
918168580 1:181974263-181974285 CTGAAAAGAATGATTAGGCTGGG + Intergenic
918256355 1:182752194-182752216 CTGACATGACAGCAGAGGCTGGG + Intergenic
918635831 1:186772976-186772998 CACAAAAGATAGGTGAGGCTGGG - Intergenic
919028975 1:192214841-192214863 CTGAAAAGACCAGTCAGTCTTGG + Intergenic
919493040 1:198229073-198229095 CTGAACAGACAGGCCTGGCTGGG + Intronic
919938662 1:202271509-202271531 CAGAAAATACAGGGGAGGCTGGG + Intronic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
920962386 1:210674908-210674930 TTCAAAAGACAGCTGTGGCTTGG - Exonic
921010879 1:211139721-211139743 CAGAAATGCCAGGTAAGGCTGGG + Intergenic
921011103 1:211142336-211142358 CTTAAAAGCCAGGAGAGACTGGG - Intergenic
921363356 1:214351066-214351088 ATGAAAAGGCAGCAGAGGCTGGG + Exonic
921440486 1:215180686-215180708 CTGACAAGCCAGGAGAGACTGGG - Intronic
921619513 1:217310542-217310564 GGGAAAATCCAGGTGAGGCTGGG + Intergenic
922393339 1:225170173-225170195 TTGCAAAGACCGTTGAGGCTAGG + Intronic
922722242 1:227905000-227905022 CTGAAGGGAGAGGTGAGGCAGGG - Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
923683502 1:236138314-236138336 ATGAAAAGCCAGGTCAGCCTTGG - Intergenic
924447356 1:244145607-244145629 GTGAAAAGTCAGGTGAGAGTTGG + Intergenic
924509213 1:244714837-244714859 CTTGAAAGACAGATGAGGCCAGG + Intergenic
1062879418 10:966121-966143 CTAAAAAGACAGTAGAGGCAAGG + Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063276346 10:4572592-4572614 CTGAACAGACAGGCCTGGCTGGG - Intergenic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1065053696 10:21821067-21821089 CTGAACAGACAGGCCTGGCTGGG - Intronic
1065200807 10:23311125-23311147 CTCAAAAGTGAGGTGTGGCTGGG - Intronic
1066490872 10:35893356-35893378 TTGAAAAGCCATGTCAGGCTGGG + Intergenic
1066569189 10:36753072-36753094 CTAAAAACACAGTTGAGGCCGGG - Intergenic
1066923646 10:41547559-41547581 ATGAAAAGAAAGGTGAAACTCGG - Intergenic
1067202047 10:44181464-44181486 ATGAAAAGAGATGTGAGGCCTGG - Intergenic
1067577042 10:47415495-47415517 GTACAAAGACAGGTGAGGGTGGG - Intergenic
1067580431 10:47442140-47442162 CTTAGAAGACAGCTGAGCCTTGG - Intergenic
1069948344 10:72002420-72002442 GTGAAAAGGCAGGTGCGGGTCGG - Intronic
1070166293 10:73900719-73900741 CTTAAAAGATGGGTGAGGTTGGG - Intergenic
1070351651 10:75598412-75598434 CTTAAAAGAGAGGTAAGGCCAGG - Intronic
1071158565 10:82720092-82720114 CTCAAAAGATAGTTAAGGCTGGG + Intronic
1071370829 10:84950027-84950049 CAGAAGAGTCAAGTGAGGCTGGG + Intergenic
1071436484 10:85652507-85652529 CTCAAAAGACACGGGAGGGTGGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072807773 10:98435482-98435504 CAGACAAGCCAGGGGAGGCTCGG + Intronic
1073327271 10:102650199-102650221 CTGGGCAGACGGGTGAGGCTTGG - Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1073796421 10:106993233-106993255 CTGAAAAGACATGTATGGGTAGG - Intronic
1073797625 10:107005167-107005189 ATGAAAAGCCAAGAGAGGCTTGG + Intronic
1074153292 10:110777708-110777730 CTGAAAGGACACGTGAGGAAGGG - Intronic
1074519898 10:114209713-114209735 CTGAAGACAAAGGGGAGGCTGGG - Intronic
1074871097 10:117576556-117576578 TTGAAGGGACAGTTGAGGCTGGG + Intergenic
1074877102 10:117622038-117622060 CGGAATAGAGAGGTGAGGTTGGG + Intergenic
1075018555 10:118929415-118929437 TTTAAAAGACAGTTGGGGCTGGG + Intergenic
1075816556 10:125269163-125269185 TTTAAAAGAAAGGTGGGGCTGGG + Intergenic
1075929755 10:126285799-126285821 CTGCAAAGACGGGTGCGGCCAGG + Intronic
1076716775 10:132369958-132369980 ATGGAGAGACAGGTGTGGCTGGG - Intronic
1076844862 10:133065179-133065201 TTGAAAAGGCAAGTGGGGCTGGG - Intergenic
1076854570 10:133109495-133109517 CTCAAAGGGCAGGTGAGGCCAGG - Intronic
1077014208 11:392761-392783 CTGAAAGGATGGGTGAGGCCCGG - Intronic
1078001602 11:7501158-7501180 CACAAGAGACAGGTTAGGCTTGG + Intronic
1078236314 11:9488036-9488058 CTGAAAAGACAAATGAGGTAGGG - Intronic
1078455060 11:11468570-11468592 CTCTAAGGGCAGGTGAGGCTGGG + Intronic
1079283294 11:19107095-19107117 ATGAAAAGAAAGCTGAGGGTGGG - Intergenic
1080624315 11:34014773-34014795 TTAAAAAGACAGTTAAGGCTGGG + Intergenic
1080855838 11:36110932-36110954 CTGAAAACAAACGTGGGGCTGGG + Intronic
1081310155 11:41560858-41560880 TTTAAAAGAGAGATGAGGCTGGG - Intergenic
1081913763 11:46718241-46718263 CCCAAAGGACAGGTGAGGCGAGG + Intergenic
1083786309 11:64950032-64950054 CAGAAAAGAAAGGATAGGCTGGG + Intronic
1084093962 11:66897949-66897971 CTGAAAAGAAAATTGAGGCTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085356489 11:75842733-75842755 ATGAAAAGGCAGGTCAGGCCAGG - Intronic
1085434437 11:76486980-76487002 TTAATAAGACAGATGAGGCTGGG + Intronic
1086414618 11:86576421-86576443 CAGAATGGACAGGAGAGGCTGGG - Intronic
1087774135 11:102242441-102242463 CTGAAAAGTCAGCTGAGGCTGGG + Intergenic
1088166433 11:106943908-106943930 ATAAAAAAACAGGTTAGGCTGGG + Intronic
1088870369 11:113885480-113885502 CAGAAAACAGAAGTGAGGCTGGG - Intergenic
1089491704 11:118887978-118888000 CTGAGAAGCAAGGTCAGGCTGGG + Intronic
1090000859 11:122956517-122956539 CAGAAAAGAGACGTGAAGCTTGG + Exonic
1090064423 11:123491035-123491057 CTTAAAAGACATTTGTGGCTGGG + Intergenic
1090717314 11:129441827-129441849 CAGATAAGAGAGTTGAGGCTTGG - Intronic
1092275445 12:7057465-7057487 CATAAAACACAGGTGAGGATAGG + Intronic
1093420350 12:18967507-18967529 GTGCATAGACAGGTGAGGCCCGG + Intergenic
1093504909 12:19853848-19853870 ATAAAAACACAGGTTAGGCTGGG - Intergenic
1093939151 12:25033653-25033675 CTGCACAGACTGGTGAGTCTAGG - Intronic
1094743218 12:33313662-33313684 CTGAACAGACAGGCAAGGCTGGG - Intergenic
1095089263 12:38088557-38088579 CAGAACACACAGGCGAGGCTGGG - Intergenic
1095785592 12:46105630-46105652 TTGAAAAGAAACCTGAGGCTGGG - Intergenic
1095897816 12:47297871-47297893 TTAAAAAGACTGTTGAGGCTGGG - Intergenic
1095981805 12:47978437-47978459 CTGAGAGGACAGAAGAGGCTGGG - Intronic
1096433616 12:51569732-51569754 TTGTAAAGACCGCTGAGGCTAGG - Intergenic
1097443310 12:59638188-59638210 CTGAACAGACAGGTTTTGCTGGG - Intronic
1099465080 12:82974827-82974849 CTGAACAGACAGGTCTTGCTGGG - Intronic
1100368504 12:93943488-93943510 CTGAAAAGACAGGCCTTGCTGGG + Intergenic
1101005448 12:100397106-100397128 CTGAAGAGGCTGGTGAAGCTAGG - Intronic
1101010695 12:100446240-100446262 TTGAAAATAAAGTTGAGGCTGGG + Intergenic
1101323344 12:103693156-103693178 CTCAAAAGACACTTGAGGCCAGG + Intronic
1101440238 12:104698480-104698502 CTGAAGAGACAGGTGATGATAGG - Intronic
1101663062 12:106784181-106784203 CTGAGAAGAAAGGTTAGGTTAGG + Intronic
1101775078 12:107786246-107786268 TTGAAAAGACATGACAGGCTGGG - Intergenic
1102965341 12:117121100-117121122 CTCAGAAGGCAGGGGAGGCTGGG + Intergenic
1104207205 12:126650672-126650694 CTGAAAAGGCAGGTGGTCCTAGG - Intergenic
1105034845 12:132911265-132911287 TTGAAAAGACTAGTGAGGCAGGG - Intronic
1106289601 13:28348360-28348382 CTGAAAAGAGAGGCAAGGTTGGG - Intronic
1106479051 13:30123306-30123328 CTGAAAGGACACATGAGGATGGG + Intergenic
1106760467 13:32862587-32862609 CTGATAAGAAAAGGGAGGCTGGG + Intergenic
1107599747 13:42001571-42001593 AATAAGAGACAGGTGAGGCTGGG - Intergenic
1107834279 13:44401093-44401115 TTTAAAATACAGGTGAGGCCAGG + Intergenic
1108620864 13:52182736-52182758 CTATAAAGACAGGTTAGGCCAGG + Intergenic
1108665931 13:52630564-52630586 CTATAAAGACAGGTTAGGCCGGG - Intergenic
1109341147 13:61060575-61060597 ATGAAAATACAGGTCAGGCACGG - Intergenic
1110194375 13:72769841-72769863 CAGAAAAAACAGGTTAAGCTTGG + Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1110339578 13:74373765-74373787 CTTAAAAGATAGTTGAGACTAGG + Intergenic
1110887723 13:80659040-80659062 GTGAAAAGAGAGGTGCGGGTGGG - Intergenic
1111763415 13:92495834-92495856 CTGAAGAGAAATGAGAGGCTGGG - Intronic
1112021138 13:95372322-95372344 GAGAAAGGACAGGAGAGGCTGGG - Intergenic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1113093313 13:106637248-106637270 TTGAAAAGATAAGTCAGGCTGGG - Intergenic
1114289515 14:21276412-21276434 CTGAAAATACAGGCCAGGCGCGG - Intergenic
1114312444 14:21479353-21479375 TTAAAAAAACAGGTGAGGCGGGG + Intronic
1114444290 14:22776393-22776415 CTGGAAAGACCGGTGTGGCAGGG - Intronic
1114550448 14:23529876-23529898 CTCAGTAGATAGGTGAGGCTTGG + Intronic
1115326867 14:32149472-32149494 CTGAAAAGAAAAGTGGGGCCAGG + Intronic
1115581251 14:34760981-34761003 CTAAAAAGACAACTGAGGCCAGG + Intronic
1115943220 14:38631469-38631491 CTAAAAAGACAGAAGAGACTGGG + Intergenic
1116871932 14:50075894-50075916 TTGTAAAGACCGTTGAGGCTAGG + Intergenic
1116884010 14:50201235-50201257 CTTAAAAAAAAGGTCAGGCTGGG + Intronic
1119346788 14:73931893-73931915 GTGAAAAGACAGCTGAGTCTGGG - Exonic
1119608969 14:76045688-76045710 TGGAAAACAGAGGTGAGGCTTGG - Intronic
1121343386 14:93117898-93117920 CTGAAAGACCAGTTGAGGCTGGG + Intergenic
1121390272 14:93567520-93567542 CAGAAAAGAAAAGTGAGGCCGGG - Intronic
1121867500 14:97376713-97376735 CTGAAAAGTCCAGTGAGGCTGGG - Intergenic
1123029421 14:105444496-105444518 TTAAAAAGTTAGGTGAGGCTGGG + Intronic
1124184838 15:27515513-27515535 CTGAAAAGCCACCTGAGGCCTGG - Intronic
1124844698 15:33279115-33279137 CTGACGGGACAGGTGAGGCTGGG + Intergenic
1124885111 15:33678069-33678091 CTGACAAGACAGGTGTGGCATGG - Intronic
1124992812 15:34692658-34692680 CTGAAAAGAAAGGTAGGGGTCGG - Intergenic
1125040448 15:35179697-35179719 TTGTAAAGACAGGGGATGCTAGG + Intergenic
1125060077 15:35409058-35409080 CTGAGAAGACAGGTGTGAATGGG + Intronic
1125533245 15:40427807-40427829 CTGGAAAGAAAGGAGGGGCTGGG - Intronic
1125726537 15:41871178-41871200 CTGTGAAGGAAGGTGAGGCTGGG - Intronic
1125731063 15:41893095-41893117 ATGGGAGGACAGGTGAGGCTGGG - Intronic
1128145461 15:65330282-65330304 CTGAGAGGACAGGTGAGGGCTGG - Exonic
1128498555 15:68211573-68211595 GTGAAAGGACAGGTGCGGCGAGG + Intronic
1129310869 15:74708052-74708074 TTGAAAAGACATCTGAGGCTGGG + Intergenic
1130141245 15:81228101-81228123 CTGCAAAGACAGGCGAGGAGAGG + Intronic
1132032817 15:98452221-98452243 CTGAAATGAAAGGTGAACCTGGG + Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132580522 16:682671-682693 CTGGAAAAGCAGGTGAGGGTGGG + Exonic
1132706522 16:1245897-1245919 CTGAACAGCCAGGTGGGGGTTGG + Intergenic
1133206185 16:4235176-4235198 CTAAGAAGACAGGTGAGGCCAGG + Intronic
1134006086 16:10819494-10819516 CTTAAAAGGCAGGTGAGGCCGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134669163 16:16041799-16041821 CTCAAAAGTCAGGTGTGGCTGGG + Intronic
1134759971 16:16705639-16705661 GTGAAGAGACACGTGAGGCCAGG + Intergenic
1134986100 16:18653566-18653588 GTGAAGAGACACGTGAGGCCAGG - Intergenic
1135147315 16:19973884-19973906 CAGAAAAGAAAACTGAGGCTTGG - Intergenic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1135327859 16:21538709-21538731 CCGATAAGAAAGCTGAGGCTCGG + Intergenic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136473096 16:30494839-30494861 CAGAGAAGACAGGTGGGGCCAGG + Exonic
1136498043 16:30655797-30655819 CTGAAGGGACAGGTAAGGCCTGG - Intronic
1138505217 16:57475089-57475111 GTGAACAGACAGGTGAGGCCGGG - Exonic
1139305089 16:65978547-65978569 CTGAGCAGAGAGGTGAGGCTAGG - Intergenic
1139376156 16:66498012-66498034 CTGTAAAGACCACTGAGGCTAGG + Intronic
1139444931 16:66991807-66991829 CAGAAAAATGAGGTGAGGCTGGG + Intronic
1139588585 16:67920119-67920141 ATGAAAAGACAGGAGAGGGAGGG - Intronic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1140208466 16:72952333-72952355 CTGAGAAGACATGGGAGGGTTGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141489613 16:84363300-84363322 CTAAGAAGAAAAGTGAGGCTGGG - Intergenic
1141545084 16:84761477-84761499 GGGAAAGGACAGGTGAGGCAGGG + Intronic
1141601087 16:85126839-85126861 CCGAAGAAACAGGAGAGGCTGGG - Intergenic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141737235 16:85861716-85861738 CAAAATAGCCAGGTGAGGCTGGG + Intergenic
1141964691 16:87433932-87433954 CTGAAAAGAAAGGCCAGGCACGG - Intronic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1142396652 16:89835772-89835794 CAGAGAAGCCAGGCGAGGCTGGG - Intronic
1142847497 17:2689363-2689385 CAGAACACACAGGTGAGCCTGGG + Intergenic
1143067930 17:4264298-4264320 TTGTAAAGAAAGGAGAGGCTGGG + Intergenic
1144535214 17:16082191-16082213 CTGAAAAGAAAAGTGGGGGTGGG + Intronic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145740034 17:27266062-27266084 CTAAAAAGTCAGGATAGGCTGGG - Intergenic
1145994404 17:29097212-29097234 CTGGAACGGCGGGTGAGGCTGGG - Exonic
1146055170 17:29577370-29577392 CTGACTAGCCAGGTGAAGCTAGG - Intronic
1146285854 17:31573789-31573811 CAGATAAGAGAGCTGAGGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146562111 17:33879161-33879183 CTGTAAAGACTACTGAGGCTAGG + Intronic
1146765151 17:35513645-35513667 CTGAAAAGAATGGAGAGGGTGGG - Intronic
1147047093 17:37760885-37760907 CTTAATAGACAGTTGAAGCTGGG - Intergenic
1147572782 17:41581664-41581686 CAGAAATGGCAGCTGAGGCTGGG + Intergenic
1147836783 17:43338508-43338530 AAGAAAAGACAGCTGGGGCTGGG + Intergenic
1148046178 17:44746501-44746523 CTTAAACGACAGGTGAAGATGGG - Intronic
1149020955 17:51963581-51963603 CTGACAAGTCAGGAGAGGCTGGG + Intronic
1149458908 17:56811443-56811465 CTGGAAGGAAAGGGGAGGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151134676 17:71934756-71934778 CTTAAAGGACAGGTAAGGCTGGG + Intergenic
1151421389 17:74000414-74000436 CTGAACAGACAGGCCTGGCTGGG - Intergenic
1152431325 17:80249608-80249630 AAAAAGAGACAGGTGAGGCTAGG + Intronic
1152761926 17:82113171-82113193 CTGAAAGGACAGGGCAGTCTTGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156775250 18:40779902-40779924 GTGAGAAGAAAGGTGAGTCTAGG + Intergenic
1157296253 18:46447408-46447430 CTGAAGAGAGAGGAAAGGCTGGG + Intronic
1158363769 18:56707276-56707298 CAGTAAAGTCAGTTGAGGCTGGG - Intronic
1159588680 18:70307469-70307491 CTATAAAGAAAGGTCAGGCTCGG - Intronic
1159906043 18:74093210-74093232 CTGGAAAGAAAGGTAAGGCAAGG + Intronic
1160785940 19:900354-900376 GTGAACATACAGGTGAGGGTAGG - Intronic
1160816672 19:1039200-1039222 CTGAAGCCACAGGTGAGTCTGGG + Intergenic
1161104972 19:2438787-2438809 CAGAACAGGCAGGAGAGGCTGGG - Intronic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1161472689 19:4467996-4468018 CTAAAAAGACACCTCAGGCTGGG + Intergenic
1161681082 19:5680188-5680210 CAGAGAAGACAACTGAGGCTCGG + Intronic
1162161741 19:8723139-8723161 CTGAAAGGAAAGGTGAGTTTGGG + Intergenic
1162196582 19:8989554-8989576 TTGAAAGGGCAGCTGAGGCTGGG + Intergenic
1162242595 19:9367023-9367045 TTCAAAAGTCAGCTGAGGCTGGG + Intronic
1163351574 19:16779454-16779476 CTGGACACACAGGTGAGACTTGG + Exonic
1163580368 19:18135167-18135189 CTGAAGTGACTTGTGAGGCTGGG + Intronic
1163788044 19:19287268-19287290 CTCAAAACATAGGTGAGGCGAGG + Intronic
1165384057 19:35500200-35500222 CAGTAAAGGCAGGTGAGGGTGGG - Intronic
1165854559 19:38871636-38871658 ATGAACACACAGGTGAGGCACGG - Exonic
1165858886 19:38896506-38896528 CTGAAAAACGAGGTGAGGCCGGG - Intronic
1167041709 19:47026658-47026680 CTGAAAAGAAAAGTGCGGCCGGG + Intronic
1167234228 19:48303942-48303964 GTGAAAAGCAGGGTGAGGCTGGG - Exonic
1167460990 19:49624694-49624716 CTCAAAGGACAGAGGAGGCTGGG - Intronic
1168097371 19:54123420-54123442 CAGAGAAGATAGGGGAGGCTCGG - Intronic
925780194 2:7375040-7375062 CATGAAAGACAGGTGAGGCCTGG - Intergenic
926230888 2:11003031-11003053 CTGCAAAGGCAGGGGAGACTGGG + Intergenic
926565030 2:14459471-14459493 GTAAAAAAACAGGTGAGACTTGG - Intergenic
926807162 2:16721707-16721729 CTGATAAGGCAACTGAGGCTAGG + Intergenic
929553794 2:42911203-42911225 CTGTAGCGACAGGGGAGGCTGGG + Intergenic
929971022 2:46576825-46576847 CAGAAGAGACAGTGGAGGCTGGG + Intronic
930692434 2:54378317-54378339 CTGCAAAGCCGTGTGAGGCTGGG - Intronic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
932742813 2:74304693-74304715 CACAAAAGACAGGGGAGGCAGGG + Intronic
933260456 2:80126168-80126190 CTGAAAAGAAAAATGAGGCAAGG + Intronic
933661438 2:84930669-84930691 ATGAAAATACAGGTCAGGCGCGG + Intergenic
934094503 2:88586885-88586907 ATCAAAAGACAAGTTAGGCTGGG - Intronic
934300435 2:91773280-91773302 ATTAACAGACAGGGGAGGCTGGG + Intergenic
934997642 2:98979857-98979879 TTGTAAAGACCGTTGAGGCTAGG + Intergenic
937033106 2:118757337-118757359 CTTTAAAGACTGCTGAGGCTGGG + Intergenic
937215492 2:120310228-120310250 CAGAAAAGTCAAGTGAGGCCGGG - Intergenic
939313125 2:140510513-140510535 CAGAAAAGAAAACTGAGGCTCGG + Intronic
940421684 2:153486228-153486250 ATTAAAAGGAAGGTGAGGCTGGG - Intergenic
940651010 2:156440889-156440911 CTGAGATGACAGGTGACTCTTGG + Intronic
941373819 2:164702803-164702825 TTGAAAACACAATTGAGGCTGGG - Intronic
941623779 2:167808390-167808412 CTGTAAAGACCATTGAGGCTAGG - Intergenic
942556659 2:177178449-177178471 CTGGAAAAGCAGGTGAGGGTGGG + Intergenic
943073498 2:183169344-183169366 CTGAAAAGACAGGACAGGACAGG - Intergenic
944298225 2:198091981-198092003 CTGGAGAGGCAGGTGAGGTTGGG - Intronic
944298244 2:198092073-198092095 CTAAAGAGGCAGGTGAGGTTGGG - Intronic
944298282 2:198092269-198092291 CTGGAGAGGCAGGTGAGGTTGGG - Intronic
944369607 2:198966454-198966476 CTAAGAAGGCAGGTGTGGCTGGG - Intergenic
944904224 2:204246264-204246286 CAGAAAAGACACCAGAGGCTGGG - Intergenic
944932676 2:204535939-204535961 CTGAACAGACAGGTCTTGCTAGG - Intergenic
945059949 2:205900180-205900202 CTTAAATGACAGGGGAGCCTGGG - Intergenic
945419478 2:209616944-209616966 CTGAACAGACAGGTCTTGCTGGG - Intronic
945481713 2:210352658-210352680 TTGTAAAGACCAGTGAGGCTAGG + Intergenic
945839843 2:214874286-214874308 CAGAAAAGAGAGGAGAAGCTAGG + Intergenic
945870078 2:215218189-215218211 CTGAAAAGAGAGGCCAGGCACGG - Intergenic
946850025 2:223896939-223896961 CTGAAAAAACTGGCGAGCCTGGG + Intronic
947208491 2:227684092-227684114 CTAAAAAGACAAATGAGGCCTGG - Intergenic
947495738 2:230635168-230635190 CTGAGAAGTCACTTGAGGCTAGG + Intergenic
947589891 2:231379556-231379578 CCGCAGAGACAGGGGAGGCTGGG + Intergenic
948752614 2:240141268-240141290 CTGGAAAGACAGGTCAGCATAGG - Intronic
1168829773 20:839516-839538 CTGACAAGAAAGCCGAGGCTGGG - Exonic
1169007609 20:2221622-2221644 CTGAAAAGACAAGTAGGGCTTGG - Intergenic
1169071691 20:2736707-2736729 CTGAAAAGAGTGGTGGGGGTTGG - Intronic
1170064246 20:12293429-12293451 GAGAGAAGACAGGTGAGGCTTGG + Intergenic
1170170041 20:13400058-13400080 CTAAAAAGAGATGTGAAGCTAGG - Intronic
1170526624 20:17244914-17244936 CTGGCAAGAAATGTGAGGCTGGG - Intronic
1170918766 20:20655608-20655630 CTGGAGAGGCAGGCGAGGCTGGG + Intronic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1172595498 20:36148510-36148532 CTGAAGAGCCAGGTGAGACCAGG + Intronic
1172760317 20:37316873-37316895 CTAAACAAACAGGTGAGGCCTGG - Exonic
1172899811 20:38326317-38326339 CTGCACAGACAGGTGTGGCGGGG - Exonic
1174037244 20:47675769-47675791 CTGGAAAGCCAGGGCAGGCTTGG - Intronic
1174098818 20:48110841-48110863 TTAAAAAGAGAGGTCAGGCTGGG - Intergenic
1174238921 20:49117255-49117277 GGGAAAAGAGAGCTGAGGCTAGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175314895 20:58040332-58040354 CTGCTAAGGCAGGTGAGGGTGGG - Intergenic
1175385154 20:58590078-58590100 CTGGAGAGACACGTGAGGCCTGG + Intergenic
1177738255 21:25120015-25120037 ATGAGAAGACAAGTGAGGCAAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178600341 21:33988972-33988994 CTGACAAGAAAACTGAGGCTGGG - Intergenic
1178600838 21:33993147-33993169 CAGATAACACAAGTGAGGCTGGG - Intergenic
1179021229 21:37642764-37642786 CTGGAGAGATGGGTGAGGCTGGG + Intronic
1179441260 21:41395899-41395921 CACAAAAATCAGGTGAGGCTAGG - Intronic
1181436045 22:22911539-22911561 CTGGAAAGTGGGGTGAGGCTGGG + Intergenic
1181698790 22:24608413-24608435 ATTAACAGACAGGCGAGGCTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182116355 22:27758670-27758692 CAGAGAAGAAAGGTGAGGCTCGG - Intronic
1182515157 22:30854052-30854074 AAGAAAAGAGAGGTGAGGCCTGG - Intronic
1183770880 22:39924786-39924808 CTGCAAAGAGGAGTGAGGCTGGG + Intronic
1183949557 22:41345174-41345196 TAGCAAAGACAGCTGAGGCTCGG + Intronic
1184298287 22:43540001-43540023 CTGAGAAGACGGGTGAGTCTGGG - Intronic
1184975155 22:48056451-48056473 CTGAATTTACAGGTGAGGGTGGG - Intergenic
950091838 3:10301242-10301264 GTGACAAGACAGGTGGGGCCTGG - Exonic
951354062 3:21642451-21642473 CTAAAAGGAGAGCTGAGGCTGGG - Intronic
951623943 3:24639445-24639467 CTGGAGAGACAGGTGAATCTAGG - Intergenic
952865270 3:37851086-37851108 TTGAAAAGACAGATTAGGCTGGG + Intergenic
952932780 3:38373051-38373073 CAGAAAAGACAGGTTAGGGATGG - Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953005738 3:38977636-38977658 CTGGAAAGGCAGGTGAAGGTAGG - Intergenic
953427741 3:42809409-42809431 CTGAACAGACAGGTCTTGCTAGG - Intronic
953611713 3:44452526-44452548 CTTAAAAGACAGTGGGGGCTGGG - Intronic
954335500 3:49914371-49914393 CAGAAAAGAAAGGTGGGGCACGG - Intronic
955179389 3:56652967-56652989 CTAAAAAGACAGGCCAGGCCGGG + Intronic
955205749 3:56894492-56894514 CTGAAAAGAAAGTTTAGGCCAGG + Intronic
955391289 3:58524287-58524309 CTGAGAGGACCGGGGAGGCTAGG + Intronic
956052671 3:65265343-65265365 CTGCAAACGCAGGTCAGGCTTGG + Intergenic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
956616494 3:71177932-71177954 CTGAGATGAAAGGTGAGCCTGGG - Intronic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957411194 3:79842581-79842603 CTGAAAAGAAGGGTGAGGTAAGG + Intergenic
958615923 3:96493738-96493760 CTGAAAAGGAAGGGGAGGCAAGG + Intergenic
958867201 3:99515281-99515303 CTTAAAAAACAAGTGAGGCTGGG - Intergenic
959891977 3:111567162-111567184 ATAAAAAGACAGTTAAGGCTAGG + Intronic
960365683 3:116769155-116769177 CAGAAAAGACAGGTCAGGAGGGG + Intronic
960804009 3:121565335-121565357 CTGAAAGTTCAGGAGAGGCTGGG + Intergenic
961292835 3:125861522-125861544 CACAAAAAACAGTTGAGGCTGGG + Intergenic
961626545 3:128268069-128268091 CTGGAAACAGAAGTGAGGCTAGG + Intronic
962775118 3:138651925-138651947 ATGAAAATACAGGTTTGGCTGGG + Intergenic
963420517 3:145055640-145055662 CTGCAGAGAATGGTGAGGCTTGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964089010 3:152851034-152851056 CTGAAAAGGAAGGTGGGGGTGGG - Intergenic
965097003 3:164242816-164242838 CTGAAAAGACATGAGAAGATGGG - Intergenic
965434529 3:168632417-168632439 TTGAAAAGACTGGTCAGGCACGG - Intergenic
966887198 3:184383282-184383304 GGGGCAAGACAGGTGAGGCTAGG - Intronic
967683878 3:192397285-192397307 AGGGAAAGACAGGTGAGGCAAGG + Intronic
967837829 3:193979501-193979523 CTGAAAAGAATGATCAGGCTGGG + Intergenic
970186280 4:13457182-13457204 ATGGAAAGACATGTGAAGCTGGG - Intronic
970668620 4:18368183-18368205 CTTACAAGCCAGGAGAGGCTAGG + Intergenic
971802391 4:31308843-31308865 ATGAAAATACAGTTAAGGCTGGG - Intergenic
972624514 4:40783555-40783577 CTGAAAAGACTGGCCAGGCACGG + Intronic
972960783 4:44449003-44449025 TTTAAATGACAGCTGAGGCTCGG - Intergenic
973816904 4:54627426-54627448 CTGAACAGACAGGTCTTGCTGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974631544 4:64496125-64496147 CTGAAAAGACAGCTGGTGTTAGG + Intergenic
974673438 4:65060150-65060172 CTGAGAAAGCAGGTGAGACTAGG + Intergenic
974940874 4:68466138-68466160 CTGAAAAGGAAGATGAGGTTAGG - Intronic
975287274 4:72635430-72635452 CTGCAAAGACCGTCGAGGCTAGG - Intergenic
976346602 4:84010285-84010307 TTGAAAAGTCAAGTGATGCTTGG - Intergenic
976674341 4:87687575-87687597 GTTAAAAGATGGGTGAGGCTGGG - Intergenic
977343876 4:95793412-95793434 CTGTAAAGACCATTGAGGCTAGG + Intergenic
977929431 4:102735072-102735094 CTAAACAAACAGGTGAGGCCTGG - Intronic
980224920 4:129970161-129970183 CTAAAAAGAGAGTTGAGGCTGGG - Intergenic
981218034 4:142194936-142194958 CTGAAAAGAAAAATGATGCTGGG + Intronic
983108771 4:163723112-163723134 CTGTAAAGACCACTGAGGCTAGG - Intronic
983226283 4:165089190-165089212 CTGAATAGACAGGTCTTGCTGGG - Intronic
983301501 4:165931991-165932013 CTGGAAAGCCAGGTGATGGTTGG + Intronic
984993868 4:185408894-185408916 CAGAGATGACAGGTGAGGCAGGG - Intronic
985250177 4:188016091-188016113 CTTAAAAAACAGGTGGGGCGCGG + Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
986286293 5:6361355-6361377 CAGAGCAGACAGGTGAGCCTGGG + Intergenic
986732934 5:10648833-10648855 CTTAAAAGGCAGGTTGGGCTGGG + Intronic
986884653 5:12218124-12218146 CTAAAAATACAGTTTAGGCTGGG + Intergenic
989272439 5:39549045-39549067 CTGAAGGGAAAGGTCAGGCTGGG + Intergenic
990885316 5:60584999-60585021 CTGAAAAGAGAGGTGGGGTCTGG + Intergenic
992047916 5:72915328-72915350 CTTTTAAGAGAGGTGAGGCTTGG + Exonic
992362366 5:76053217-76053239 CTGAAAAGACAAATGACACTTGG - Intergenic
992747621 5:79835125-79835147 CAGGAAAGTCAGCTGAGGCTGGG + Intergenic
992908236 5:81369609-81369631 CTGGAAAGTCAGTGGAGGCTAGG + Intronic
992994850 5:82322804-82322826 GTGAGAAAACAGGTGAGGGTGGG + Intronic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
994625850 5:102217767-102217789 ATGAGAAGACAGATTAGGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995221887 5:109657386-109657408 CTGGAAAGAGAAGTGAGGTTTGG - Intergenic
995692848 5:114846443-114846465 CTGTAAAGACCATTGAGGCTAGG + Intergenic
997286326 5:132681343-132681365 CTGAAAGGACAGGTCAGGTGAGG + Intronic
998671892 5:144362831-144362853 CTGATAAGGAAGCTGAGGCTGGG - Intronic
999088495 5:148914195-148914217 CTGAAATGACTGGCAAGGCTGGG + Intergenic
999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG + Intronic
999269697 5:150289633-150289655 CTGGGCAGGCAGGTGAGGCTTGG + Intronic
999504520 5:152181050-152181072 CTGTAAAGACATCTGAGACTGGG + Intergenic
999551761 5:152695264-152695286 CTGAGAAGAAAAATGAGGCTGGG - Intergenic
1001857772 5:175027644-175027666 CTGAAAGGATATGTGAGGCAGGG + Intergenic
1001858437 5:175032809-175032831 CTGAACAGACAGGCAATGCTGGG - Intergenic
1001949371 5:175805646-175805668 CTGGAAGGAAAGGTGGGGCTGGG - Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1002442643 5:179272418-179272440 CTGAGCAGCCAGGTGAGGGTTGG + Intronic
1002562515 5:180091933-180091955 CTCAAAAAACAAGAGAGGCTAGG - Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1002983515 6:2165295-2165317 CTGAAGAGCCAGGAGAGCCTTGG + Intronic
1003992137 6:11496787-11496809 CTGATAAGACTGGACAGGCTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005455054 6:26011781-26011803 CAGAAAAGACAGGCCAGGTTTGG + Intergenic
1006673814 6:35747530-35747552 ATGAGAAGGCAGGTGAGTCTGGG - Intronic
1006678039 6:35777649-35777671 GTGAAAAAACAGGTGGGGCCAGG - Intronic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007344933 6:41222427-41222449 CAGAACAGACAAGTGGGGCTTGG - Intergenic
1007688897 6:43685108-43685130 CTTATTAGACAGGTGATGCTGGG + Intronic
1008592933 6:53011596-53011618 CTCAAAAAAAAAGTGAGGCTTGG + Intronic
1010277326 6:73984515-73984537 CTGAACAGAAGGATGAGGCTAGG - Intergenic
1011468620 6:87685564-87685586 CTGATAATACAAGTGAAGCTTGG - Intronic
1011711956 6:90064354-90064376 CAGAAAGGACAAGTGAGGCATGG + Intronic
1013082769 6:106826893-106826915 CTTTAAAGAAAGGTAAGGCTGGG + Intergenic
1013968624 6:115987263-115987285 CTGAAAAGGAAGCTGAGGCATGG + Intronic
1016759921 6:147725682-147725704 TTTTAAAGACAGGTAAGGCTGGG - Intronic
1017292882 6:152761840-152761862 CTGAAACGAGAGGAGAGGCATGG - Intergenic
1018866310 6:167749055-167749077 TTGAAAACACAGGCGAGGCTTGG + Intergenic
1019178955 6:170175544-170175566 GTGAAAGGAGAGGTGAGGCTGGG + Intergenic
1019314523 7:378318-378340 CAGATAAGACAACTGAGGCTCGG - Intergenic
1020870043 7:13617390-13617412 GTGAAAGGACAAGTGAGACTAGG - Intergenic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1022194848 7:28054836-28054858 CTGAAAAGACGGCTGGCGCTAGG + Intronic
1022463637 7:30635834-30635856 ATGAAAAGGGAAGTGAGGCTTGG - Intergenic
1022798325 7:33750795-33750817 ATTAAAAGACAGGCAAGGCTGGG - Intergenic
1023109006 7:36791531-36791553 ATGAAAGGACTGGTGTGGCTTGG + Intergenic
1023702542 7:42906593-42906615 AGAAAAAGACAGGTCAGGCTGGG - Intergenic
1023931952 7:44711610-44711632 CTGGGAAGATGGGTGAGGCTGGG - Intergenic
1023956639 7:44891893-44891915 CTGCAAAGACCTGTGAGGCCTGG + Intergenic
1025869412 7:65416786-65416808 CTGTAAAGACCATTGAGGCTAGG + Intergenic
1025989492 7:66485247-66485269 TTGAAAAGACAAGACAGGCTGGG + Intergenic
1026039247 7:66853356-66853378 TTGAAAAGACAAGACAGGCTGGG - Intergenic
1026039756 7:66857957-66857979 TTGAAAAGACAAGGCAGGCTGGG - Intergenic
1026223735 7:68422748-68422770 CTTAAAAGGCAGGGGAGGCCAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026328997 7:69335885-69335907 CTGAAAAGGAAAGTGAGGCTGGG - Intergenic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1026967179 7:74447755-74447777 CTGAAAAGACAGGGAAAGCCAGG + Intergenic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1028330839 7:89589599-89589621 TTAAAAAGTCAGCTGAGGCTGGG - Intergenic
1028500016 7:91508758-91508780 CTGTAAAGACCATTGAGGCTAGG + Intergenic
1029542300 7:101191020-101191042 CTGAACAGACAGGCCTGGCTGGG - Intergenic
1030606468 7:111643784-111643806 CTGAAAAGGGAGGGGAGCCTCGG - Intergenic
1034553950 7:151838084-151838106 TGGAAAGGACAGGAGAGGCTGGG + Intronic
1035643127 8:1198706-1198728 CTGAAGAGACACGTGTGCCTGGG + Intergenic
1035665752 8:1378487-1378509 CAGGAAAGACAGGTGAGGCCAGG - Intergenic
1035665770 8:1378603-1378625 CAGGACAGACAGGTGAGGCCAGG - Intergenic
1035780192 8:2222014-2222036 CAGAAAAAACAGGAGAGACTAGG + Intergenic
1036259607 8:7229307-7229329 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1036307010 8:7610217-7610239 CAGGAAAGACAGGGGAGACTGGG - Intergenic
1036311650 8:7687877-7687899 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1036357858 8:8058204-8058226 CAGGAAAGACAGGGGAGACTGGG - Intergenic
1036358922 8:8064346-8064368 CAGGAAAGACAGGGGAGACTGGG - Intergenic
1036411204 8:8503397-8503419 CTGTATAGAGAGGAGAGGCTGGG - Intergenic
1036632255 8:10524076-10524098 TTGAAAAGACGGGTGAGGCATGG + Intergenic
1036893091 8:12608742-12608764 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1036900652 8:12666728-12666750 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039476155 8:37840375-37840397 CTCCAAAGACGGGGGAGGCTAGG + Intronic
1039764465 8:40613477-40613499 TTGAATGGGCAGGTGAGGCTGGG - Intronic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041682744 8:60609668-60609690 TAGAAAATCCAGGTGAGGCTGGG + Intronic
1042607183 8:70557361-70557383 TTCAAAAGAGATGTGAGGCTGGG - Intergenic
1044130349 8:88515760-88515782 CAGAAAAGACAGGAGTGTCTAGG + Intergenic
1044707007 8:95018581-95018603 CTGAGAAGACAGGTGGGGGTGGG + Intronic
1045044169 8:98258622-98258644 CTGTAAAAATAGGTGAGTCTTGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047595546 8:126374379-126374401 GTGGAAAGGCAGGTGAGGCCAGG + Intergenic
1047758826 8:127939170-127939192 GTGAGAAGGCAGGTGAGGATAGG - Intergenic
1048098683 8:131323162-131323184 CTGTAAAGACCATTGAGGCTAGG - Intergenic
1048978993 8:139693022-139693044 GTGAAAACTCAGGTGAGGTTGGG - Intronic
1049245819 8:141561973-141561995 CTGAAAGGGCTGCTGAGGCTGGG - Intergenic
1051442347 9:17098789-17098811 TAGAAACGACAGGTGAGGCTGGG - Intergenic
1052342235 9:27375124-27375146 TTGTAAGGCCAGGTGAGGCTTGG + Intronic
1053097180 9:35338808-35338830 CTGAAAAGGCAGGCCAGGTTTGG + Intronic
1054626738 9:67405686-67405708 CTGAAAAGCTAGGTCAGGCCAGG - Intergenic
1054705623 9:68458611-68458633 CTGATAAGACAGGCAAGGCAGGG + Intronic
1055741400 9:79393551-79393573 CTGAATGGACAGGTGATGCAGGG - Intergenic
1058056093 9:100450390-100450412 TTAAAAAGTCAGGTGTGGCTAGG + Intronic
1058128678 9:101225408-101225430 CTGCACAGAGAGGTGAGGCATGG - Intronic
1059103475 9:111491569-111491591 CTGAACAGACAGGCCTGGCTGGG - Intergenic
1059139886 9:111843012-111843034 ATTAAAAGAATGGTGAGGCTGGG - Intergenic
1060089893 9:120733334-120733356 CTGCAAAGGCAGTTGAGGCGGGG + Intergenic
1060198108 9:121636201-121636223 CCCAAAAGACATCTGAGGCTGGG - Intronic
1060359369 9:122940847-122940869 CTGAAAGCCCAGGTGGGGCTCGG + Intronic
1060360523 9:122952168-122952190 TTTAAAAGAGAGGTAAGGCTGGG + Intronic
1060548980 9:124476404-124476426 CCGGAGAGACAGGTGAGGCTGGG + Exonic
1060572190 9:124652269-124652291 CTGATAAGACAGTTGAGGAGGGG - Intronic
1060644141 9:125263649-125263671 CCGACAAGAAAGCTGAGGCTGGG - Intronic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1061699388 9:132404478-132404500 CTGAGAAGGCAGGAGAGGGTTGG - Intronic
1061860511 9:133465511-133465533 CCCAAAAGTCAGGTGAGGGTGGG + Intronic
1062330683 9:136043182-136043204 ATGAAAAGGCAGGTCAGACTAGG + Intronic
1062354264 9:136154355-136154377 CTGGAAGGACAGGAGAGACTGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187025616 X:15432997-15433019 CTGTCAAGACAGGTGAGGGTGGG + Intronic
1187575688 X:20552077-20552099 CTAAAAAATCTGGTGAGGCTGGG + Intergenic
1188283664 X:28301539-28301561 CTGAAAATACAAGTATGGCTTGG + Intergenic
1189031919 X:37459938-37459960 TTGAAAAGACTCGTGATGCTTGG + Intronic
1189573097 X:42320730-42320752 CTGAAAAGAGAAGTTAGGCAAGG - Intergenic
1190073188 X:47295575-47295597 CTGAGATGACAGGTCAGGCCAGG + Intergenic
1190135509 X:47792999-47793021 CTCAAAAATCAGTTGAGGCTGGG - Intergenic
1190262026 X:48803205-48803227 CTGGGATGACAGGTGAGGCTGGG + Exonic
1190288867 X:48978596-48978618 CAGAAAAAAGAGCTGAGGCTGGG + Intronic
1190310108 X:49111175-49111197 TAGAAAAGAGAGCTGAGGCTGGG + Intergenic
1190323241 X:49190814-49190836 CTTAAAAGAGAAGTGAGGGTCGG - Intronic
1190918383 X:54826747-54826769 CTTAACAGACAGGTCAGCCTTGG - Intergenic
1191135429 X:57058899-57058921 CTGAAAAGAGAGCTGAAGCCAGG - Intergenic
1192910610 X:75600586-75600608 TTGTAAAGACAGTCGAGGCTAGG - Intergenic
1193087852 X:77463393-77463415 TTCAAAAGCCAGGAGAGGCTGGG - Intergenic
1195711938 X:107780037-107780059 CTAAAAATTCAGGGGAGGCTGGG - Intronic
1195912115 X:109899560-109899582 CTGTAAAGACCATTGAGGCTAGG - Intergenic
1198087851 X:133297232-133297254 TTTAAAAGAAAGGTGAGGGTGGG + Intergenic
1198533098 X:137564104-137564126 GTGAAAAGAAAGGTGGGGCGGGG + Intergenic
1198688221 X:139250501-139250523 CTTAAAAGACAAGTGGGGATTGG + Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199791645 X:151160957-151160979 CTGGGAAGTGAGGTGAGGCTGGG - Intergenic
1201325696 Y:12755458-12755480 CAAAATAGGCAGGTGAGGCTGGG - Intronic
1201963382 Y:19706774-19706796 CTGGTAAGACAGGTGTGGTTTGG - Exonic