ID: 923641615

View in Genome Browser
Species Human (GRCh38)
Location 1:235767396-235767418
Sequence CAGCTATGAGAACTTGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923641615_923641618 1 Left 923641615 1:235767396-235767418 CCTTTGCCAAGTTCTCATAGCTG 0: 1
1: 0
2: 1
3: 17
4: 203
Right 923641618 1:235767420-235767442 CAAGTGGCAAAGACTAAGACAGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923641615 Original CRISPR CAGCTATGAGAACTTGGCAA AGG (reversed) Intronic
902136420 1:14310025-14310047 CAGCTATCAGGACTTGCCAATGG + Intergenic
902253794 1:15174129-15174151 CAGCTGTCAGCACTGGGCAAAGG + Intronic
902840584 1:19071533-19071555 CAGGTATGAGAATCTGGCCATGG + Intergenic
902886482 1:19408396-19408418 CAGCTTTGAGACCTTGGACAAGG - Intronic
906928384 1:50143606-50143628 TAGCTGTGTGACCTTGGCAAGGG - Intronic
907745435 1:57208349-57208371 CAGCTATGAGCAGTTAGCACTGG + Intronic
910630209 1:89346190-89346212 CACCTATGAGGACCTGACAAAGG - Intergenic
915586569 1:156846887-156846909 CACCTGTTAGACCTTGGCAAGGG + Intronic
916169134 1:161987526-161987548 CAGCCATGAGAAGCTGGAAAAGG + Intronic
916868747 1:168888714-168888736 CTTCTATGGGAACTTGGCATGGG + Intergenic
918950040 1:191125471-191125493 CAGCTATGAGAACTTCTCATAGG + Intergenic
919184263 1:194123812-194123834 TAGCTATAATAATTTGGCAATGG - Intergenic
923641615 1:235767396-235767418 CAGCTATGAGAACTTGGCAAAGG - Intronic
924257114 1:242193491-242193513 CAGCTGTGTGCCCTTGGCAAGGG - Intronic
1065124508 10:22561179-22561201 CAGCTGTCAGAATTTGACAATGG + Intronic
1074505829 10:114069638-114069660 CAGGTATGACAACTTGGTAAAGG - Intergenic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1075104192 10:119526894-119526916 TGGCAATGAGAACTTGGCGAAGG - Intronic
1076335844 10:129706010-129706032 CAGCAGTAAGAACATGGCAATGG - Intronic
1079079415 11:17403628-17403650 CAACTATGTGCACTTGGGAAAGG + Intronic
1079127316 11:17727032-17727054 CAGCTCTAAGATCTTGGGAATGG + Intergenic
1080020147 11:27551728-27551750 CACCTATGGGAGCTTGCCAAAGG + Intergenic
1080456749 11:32426339-32426361 CAGCAATGACACCCTGGCAATGG + Intronic
1081278646 11:41181964-41181986 CAGCCATTAAAACTTGTCAAAGG + Intronic
1081535548 11:43993533-43993555 CAGCTAAGAGCACTTTGCCATGG - Intergenic
1081966305 11:47172175-47172197 CAGCTATATGACTTTGGCAAAGG - Intronic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1090314355 11:125771775-125771797 CGGGTATGAAAACTAGGCAAGGG + Intergenic
1090920674 11:131203624-131203646 CAGCTCTGAGAAGTTGCCATGGG - Intergenic
1091100452 11:132868179-132868201 CAGTTATGAGAAATTGGGAAAGG - Intronic
1091912042 12:4240548-4240570 CAGCTAGGAGAATGTCGCAACGG - Intergenic
1093460387 12:19402538-19402560 CCCCCATGAGAACTTGGCATAGG - Intergenic
1093929505 12:24941267-24941289 CAGCTATATGAGTTTGGCAATGG + Intronic
1094200936 12:27793906-27793928 CAGCCATGGGAACTTCCCAAAGG + Intronic
1094667477 12:32535460-32535482 CAGCTACTAGAACCTGGGAACGG - Intronic
1095996089 12:48085807-48085829 CAGCTAGGAAAAGATGGCAAGGG + Intronic
1096421858 12:51465456-51465478 CAGTTATAAGATCTTGGTAATGG + Intronic
1097638283 12:62147879-62147901 CCGCAATAAGAAGTTGGCAAAGG + Intronic
1097702777 12:62837601-62837623 CAGCTATGGGTACTTGGGCAAGG + Intronic
1100759416 12:97790884-97790906 CAACTATGTGAACTTGGAAATGG - Intergenic
1102556665 12:113731227-113731249 CAGCCTTGAGATCTTGGCAGAGG - Intergenic
1103017870 12:117509550-117509572 GTGCTATGAGAACTTGTCAAAGG + Intronic
1103932546 12:124458262-124458284 CTGCGAGGAGATCTTGGCAAAGG - Intronic
1106864006 13:33943678-33943700 CAGCCATGTGAACTTGGAAGAGG - Intronic
1109091725 13:58054601-58054623 CAGCCATGAGAACGAAGCAAGGG - Intergenic
1109513705 13:63413497-63413519 CAGCTCTTAGAATTTGGGAAGGG - Intergenic
1109709307 13:66142270-66142292 CATCTATGAGTAGTTGGGAATGG + Intergenic
1112440041 13:99418520-99418542 CAGAGATGATAACTTGGCACGGG - Intergenic
1113274213 13:108710142-108710164 CAGCTTTCAGAAGCTGGCAAGGG - Intronic
1115721397 14:36165070-36165092 CAGCTGTGAGAAGTAGTCAATGG - Intergenic
1117748902 14:58900448-58900470 AAGCCATGTGAACTTGGGAAAGG - Intergenic
1119166157 14:72495506-72495528 CAGCAATCAGAACTAGGGAATGG - Intronic
1119329157 14:73781130-73781152 CAGCTGTGGGAACTTGGAGAAGG + Intronic
1120273709 14:82346694-82346716 CAACCATTAGAACTTGGTAATGG - Intergenic
1121689195 14:95863719-95863741 CAGCCGTGTGAACTTGGAAAGGG + Intergenic
1122832365 14:104405529-104405551 CAGCCATGGGAGGTTGGCAAAGG - Intergenic
1127274502 15:57430563-57430585 CAGTTAAGAGAAGTGGGCAAGGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1132226687 15:100147950-100147972 CAGCCATGAGAAGCTGGAAAAGG - Intronic
1134813715 16:17188604-17188626 GATCTATGAGCACTTTGCAAAGG - Intronic
1135841294 16:25878979-25879001 CAGCTATGAGAAAGAGGCATAGG - Intronic
1138376853 16:56570115-56570137 CTGCTCTGTGACCTTGGCAAAGG - Intergenic
1139631407 16:68234096-68234118 CAGCTGTGAGAACTGGGGATAGG + Exonic
1140521643 16:75586957-75586979 CAGCTCTGCCCACTTGGCAATGG - Intergenic
1141353070 16:83316964-83316986 CATCTATGAGAACATAGCAGAGG + Intronic
1146661798 17:34669796-34669818 CAGGTCTGTGACCTTGGCAATGG - Intergenic
1146836343 17:36113913-36113935 CACCTATGGGAACCTGCCAAAGG - Intergenic
1147703397 17:42409958-42409980 GAGCTATGTGTGCTTGGCAAAGG - Intronic
1149064351 17:52463007-52463029 CACCTATGGGAACTTGGAATTGG + Intergenic
1149337255 17:55648819-55648841 CAGCTTTGAGAAGTTGGAAAAGG - Intergenic
1149756492 17:59190807-59190829 CAGCCAAGAGAACTTGGCCTGGG + Intronic
1150132934 17:62679074-62679096 CAGCTATGAGGATTTGCCCATGG + Intronic
1151087130 17:71392715-71392737 CAACAATGACACCTTGGCAATGG + Intergenic
1153590800 18:6672476-6672498 CAGCTCTGGAAACTGGGCAAGGG + Intergenic
1153867879 18:9289699-9289721 TAACAATGAGAGCTTGGCAATGG + Intergenic
1156609459 18:38709158-38709180 CAGCTGTTAGAACTTGGTGATGG + Intergenic
1157547157 18:48554608-48554630 CAGAGAGGAGAACTTGGGAAAGG - Intronic
1160627892 18:80225377-80225399 CAGCTATGAGAACTTTAACATGG - Intronic
1163029169 19:14532622-14532644 CCTCTATGGGTACTTGGCAAAGG - Intronic
925233977 2:2261520-2261542 AAGTTTTGAGGACTTGGCAATGG - Intronic
925952437 2:8927691-8927713 CAGCCAGGAGAACTGGGGAAGGG + Intronic
926565255 2:14461885-14461907 CTGCTATGAGATCTTCTCAAAGG + Intergenic
926826751 2:16913578-16913600 CACCTATGGGAGCTTGCCAAAGG - Intergenic
927517822 2:23682343-23682365 CAGCTCTGTGACCTTGGGAAAGG - Intronic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928557459 2:32442703-32442725 CAGTTTGGAGAATTTGGCAAGGG + Intronic
928666254 2:33553271-33553293 TAGCTATGAGACCTTGCCAAGGG + Intronic
930252094 2:49045772-49045794 CAGCGTTGAGCACTTGGCACTGG - Intronic
931110522 2:59105807-59105829 CAGCTAATAGAATTAGGCAAAGG + Intergenic
934105452 2:88691299-88691321 CAGCAGTGAGAACGTGGCCATGG - Intergenic
937723092 2:125126446-125126468 CAGGGATGAGAACTTGCCCAAGG + Intergenic
938797905 2:134734280-134734302 CAGCTCTGGGAACATGGCAATGG - Intergenic
939422772 2:141995277-141995299 CAGCTAGTAGAATTTGGAAAAGG - Intronic
939598670 2:144161152-144161174 CAGCTAGTAGAACATGACAATGG - Intronic
940418209 2:153447297-153447319 GAGCTATGAGAGCTTAGCTATGG - Intergenic
940596989 2:155806909-155806931 CAACTATGTGAACTTGGAAGAGG + Intergenic
940892849 2:159051908-159051930 GATCCATGAGAAATTGGCAATGG + Intronic
941367959 2:164629793-164629815 CAGCTAGGAGAATATTGCAATGG - Intergenic
942957154 2:181786987-181787009 CTGCTCTCAGAACTGGGCAAAGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945303553 2:208236882-208236904 CACCTTTGTGAACATGGCAAGGG - Exonic
945777394 2:214123949-214123971 CAGCTATGAGAAGTTTGTAATGG + Intronic
946438359 2:219674605-219674627 CAGCTTTGTGAACTTGGGAAGGG - Intergenic
1168993150 20:2111975-2111997 CAGCTGTGAGAACTAGGAAGCGG - Intronic
1169175047 20:3503857-3503879 AAGCTATGCGAACTTGGTACAGG + Intronic
1171318590 20:24218860-24218882 AAGCTATAAGAACTTAGGAAGGG + Intergenic
1171947938 20:31395242-31395264 CAGCTAGGAGATCTGGGCCAAGG + Intergenic
1172290508 20:33772820-33772842 GAGCTCTGAGAAGTTGGCAGAGG + Intronic
1172380936 20:34490711-34490733 CAGCAATGCGCCCTTGGCAATGG - Intronic
1172813934 20:37671588-37671610 TAGCTGTGTGAACTTGGGAAAGG - Intergenic
1174304192 20:49603606-49603628 CAGGGATGAGCACTTGGCCAAGG - Intergenic
1177423125 21:20887767-20887789 CAGCTATGTGAATTTGTAAAAGG - Intergenic
1178921459 21:36741605-36741627 CACCTCTGAGAACTTGACAAAGG - Intronic
1181325023 22:22038387-22038409 CAGCTGTGAGGACTTAGCAGAGG - Intergenic
1181420640 22:22795742-22795764 CACCTATGGGAGCTTGCCAAAGG - Intronic
1182981054 22:34671808-34671830 CAAATCTGAAAACTTGGCAAGGG - Intergenic
1184565622 22:45289977-45289999 CTGCTATGAGGATTTAGCAAAGG - Intronic
949098133 3:111113-111135 CAGCTATGTGAACTTGAATAAGG + Intergenic
949439525 3:4065829-4065851 CAGCTCTGAGAACTCAGAAAGGG + Intronic
949586076 3:5439042-5439064 CAGCTTTGACAAATTGACAAAGG - Intergenic
950242948 3:11388076-11388098 CATCTAGGAGAGCTTGGGAATGG - Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
952387441 3:32852446-32852468 CAGATGTGAGAACTTAGAAACGG + Intronic
952957125 3:38564314-38564336 GAGCAAAGAGAACTTGGGAAGGG - Intronic
955789532 3:62574039-62574061 AAGCTTGAAGAACTTGGCAATGG - Intronic
957506486 3:81127406-81127428 CAGCTACGAGAACTCCTCAAGGG + Intergenic
958728536 3:97935520-97935542 CAGCTATGAAAGCTTGGGTAGGG - Intronic
958955872 3:100465669-100465691 CAGCCATGTGAACTTGGAAATGG + Intergenic
960512247 3:118564552-118564574 CACCCATGAGACCTTGGCTAAGG + Intergenic
961410715 3:126718465-126718487 CAGCTGTGTGACCTTGGCCAGGG - Intronic
961481834 3:127185508-127185530 CAGTTATGAGAACTTGAATATGG - Intergenic
961826682 3:129602918-129602940 CAGCTGTGTGACCTTGGCCAAGG - Intronic
962687196 3:137858997-137859019 AACCTATGAGAACTTGGTCAAGG - Intergenic
962888905 3:139653931-139653953 AAGCTATGAGATCTGGTCAAGGG + Intronic
964310072 3:155383086-155383108 AAGCTATGTGAATTTGACAAAGG - Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965242823 3:166225860-166225882 CTGCTATGAGATCTTGGCAAGGG + Intergenic
965853987 3:173065989-173066011 CAGCTATGAGACACTGGCCATGG + Intronic
966315741 3:178643827-178643849 CAGCTCTGAGAACTGGGAAGTGG - Intronic
967537939 3:190628457-190628479 CAGGTATGAGAATTTGGTTAAGG - Intronic
967545450 3:190721410-190721432 CAGCTAAGAAAGCTTGGCTAAGG + Intergenic
970656443 4:18235535-18235557 CAGATCTGAAAACTGGGCAAAGG - Intergenic
973711038 4:53630890-53630912 CAGCTTTTAGAATTTGGGAAGGG + Intronic
974289557 4:59912652-59912674 CACCTATGGGTACTTGCCAAAGG - Intergenic
975108875 4:70601131-70601153 CAGCTATGGGAACTTAGAGAAGG + Intronic
977361939 4:96016339-96016361 CAGCTTTTAGAAGTTGGAAAAGG + Intergenic
977513823 4:97995222-97995244 CAGGGATGAGAACTTGCCCAAGG + Intronic
980197420 4:129608766-129608788 CCACTATGAGTACTTGGAAAAGG - Intergenic
981667520 4:147246367-147246389 CAGCTGTGTGACCTTGGAAATGG + Intergenic
984512235 4:180693214-180693236 GAGCTATGAGAAGATGGCCATGG - Intergenic
986410596 5:7475119-7475141 CAGCTGTCAGAACTGGCCAATGG - Intronic
986830670 5:11573729-11573751 CAGGAATCAGAACTTGGAAATGG + Intronic
986881529 5:12178308-12178330 CAACCATGAGAACTTGGAATTGG - Intergenic
987657148 5:20821741-20821763 CACCTATGCGAACCTGCCAAAGG + Intergenic
988208614 5:28173276-28173298 CAGCTATGTGACTTTGGGAAAGG - Intergenic
988766403 5:34382207-34382229 CACCTATGTGAACCTGCCAAAGG - Intergenic
991728522 5:69560578-69560600 AAGCTATGTGAAACTGGCAAGGG - Intronic
991804953 5:70415725-70415747 AAGCTATGTGAAACTGGCAAGGG - Intergenic
991866431 5:71067297-71067319 AAGCTATGTGAAACTGGCAAGGG + Intronic
993049088 5:82904920-82904942 CAGCTAAGACAAATTGGAAAAGG - Intergenic
994013691 5:94939520-94939542 CTGCTATGAGAAACTGACAAGGG - Intronic
994021113 5:95027294-95027316 CAGCTATGAGCAAGGGGCAAGGG - Intronic
997365572 5:133323212-133323234 CAGCTGTGAGACCTTAGGAAAGG + Intronic
998028937 5:138846951-138846973 CAGCTCTGAGAACTATGAAAAGG + Intronic
999177367 5:149640759-149640781 CAGCATTGAGAACTGGGCACAGG + Intergenic
999474237 5:151883792-151883814 CAGCTCTGTGATCTTGGCCAAGG - Intronic
1003791208 6:9549903-9549925 CATCTATGGGAACCTGCCAAAGG - Intergenic
1004266642 6:14153832-14153854 CAGGTATGAGAACTCTCCAAAGG - Intergenic
1005952964 6:30644967-30644989 AAGCTTTGACATCTTGGCAAAGG - Intronic
1006412197 6:33880433-33880455 CAGCAGTGAGAGCGTGGCAATGG + Intergenic
1007478657 6:42135841-42135863 CAGCTGTGGGAACTTGGGCAAGG - Intronic
1007718646 6:43872132-43872154 CAGATATGAGAACCTGGTACAGG - Intergenic
1007964459 6:45990878-45990900 CAGCTCTGTGATCTTGGAAAAGG + Intronic
1009639194 6:66308639-66308661 CAGCCATTACAACTGGGCAATGG + Intergenic
1012910522 6:105112789-105112811 CAGCTATGTGAGCTAGGCACAGG - Intronic
1014534208 6:122596718-122596740 CACCTATGAGAGCCTGCCAAAGG + Intronic
1018557542 6:165064519-165064541 CACCTATGACGACTTGGGAAAGG - Intergenic
1018614599 6:165674844-165674866 CAGCTTTAAGAACTGGGGAAGGG - Intronic
1021150826 7:17148831-17148853 CAGCTCTGAAAACTATGCAAGGG + Intergenic
1024958264 7:54949170-54949192 CACCTATGGGAACCTGCCAAAGG + Intergenic
1026878523 7:73893695-73893717 CAGCGATGAGATCAAGGCAATGG - Intergenic
1026950079 7:74340988-74341010 CTGCTCTGAGAACCTGGCAAAGG + Intronic
1028113235 7:86967686-86967708 CAGCAATCAGAACATGGAAAAGG + Intronic
1029096309 7:98087572-98087594 TAGCTATGTGACCTTGGCCAAGG + Intergenic
1030836365 7:114292126-114292148 CAGCCAACAGAACATGGCAAAGG - Intronic
1031980553 7:128121800-128121822 GAGCTAGGAGAAGTTGCCAAAGG - Intergenic
1032263861 7:130356844-130356866 CAGCTGTGAGGACAAGGCAAAGG - Intronic
1033458331 7:141522433-141522455 CAGCTATTTGAACGTGGCCAAGG - Intergenic
1033470516 7:141643577-141643599 AAGCAATGAGAAATGGGCAAAGG + Intronic
1034699434 7:153083583-153083605 CACCCATGAGCACTTGGCAGTGG - Intergenic
1035227698 7:157442705-157442727 CAGCTTTGAGAAGTTGAAAAGGG + Intergenic
1035686668 8:1528453-1528475 CATCTATGAAAACTTCTCAAAGG + Intronic
1036290673 8:7486819-7486841 GAGCTTTGTAAACTTGGCAAAGG + Intergenic
1036330814 8:7824718-7824740 GAGCTTTGTAAACTTGGCAAAGG - Intergenic
1038063308 8:23936322-23936344 CAGCTCTGAGAACTTTGCGCGGG + Intergenic
1038406102 8:27324205-27324227 CAGGTGGGAGAACTTGGCCAGGG - Intronic
1040580522 8:48695194-48695216 CAGCTCTAAAACCTTGGCAAGGG - Intergenic
1041472404 8:58225365-58225387 CAGCCCTGAGACCTTGGCAGTGG - Intergenic
1045464363 8:102456096-102456118 CATCAATGTGTACTTGGCAAAGG - Intergenic
1047331243 8:123888921-123888943 AAGTCATGTGAACTTGGCAATGG - Intronic
1048076372 8:131075779-131075801 CAGCTATTAGAACATGACATGGG - Intergenic
1048831749 8:138484251-138484273 CAGCTGTGTGAACTTGAGAAAGG - Intronic
1049976980 9:869380-869402 CAGCTAGGAGAACTGGCAAATGG - Intronic
1055217523 9:73884417-73884439 CAGCAATTAGACCTTGACAAAGG - Intergenic
1055922204 9:81472762-81472784 CAGCTTTGAGAACTAAGCAGAGG + Intergenic
1056847514 9:90053698-90053720 CAAATATGAGGACTTGGAAAGGG - Intergenic
1058649501 9:107161647-107161669 AAGCCATGAGAACGTGGCAGGGG + Intergenic
1059063581 9:111059115-111059137 CATGAATGAGAACTTGCCAAAGG + Intergenic
1059982640 9:119790067-119790089 CAGCAAGAATAACTTGGCAATGG + Intergenic
1061261836 9:129484432-129484454 CAGCCCTGAGAACAAGGCAAGGG - Intergenic
1186018116 X:5222345-5222367 TAGCTATAAGAACTTTGGAAAGG + Intergenic
1188625615 X:32281103-32281125 CTGCTATGAGAACTGAACAATGG + Intronic
1189711215 X:43814218-43814240 CAGCTTTGAGAACCAGGCACAGG - Intronic
1190812339 X:53896759-53896781 CAGCTTTGAGAACTTAGGAATGG - Intergenic
1191759351 X:64629833-64629855 CACCTATGGGAACCTGCCAAAGG - Intergenic
1192938904 X:75892551-75892573 CAGCTATGACCATTTGGGAAAGG - Intergenic
1194515930 X:94854430-94854452 CAGGTATGAGAACTTGCCCCAGG - Intergenic
1196692101 X:118571014-118571036 CAGCTAACAGAGCTGGGCAATGG - Intronic
1198206401 X:134469119-134469141 CAGTTGTCAGAACTTGGCAATGG - Intronic
1198822628 X:140665319-140665341 CAGCTATGTGAGCTTGGGCAGGG - Intergenic
1199497669 X:148471296-148471318 TAGCTATGTGACCTTGGGAAAGG + Intergenic
1199792633 X:151169431-151169453 CAAATATGAGGACTTGGCATTGG - Intergenic