ID: 923641876

View in Genome Browser
Species Human (GRCh38)
Location 1:235771469-235771491
Sequence GAATATGCTCAGTTGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923641876 Original CRISPR GAATATGCTCAGTTGCAGGT TGG (reversed) Intronic
900697402 1:4020908-4020930 GGATATCCTCAGTGGCAGGCAGG - Intergenic
906427824 1:45727774-45727796 GGATATACTCGGTTGCAGGGGGG - Exonic
908249339 1:62252809-62252831 GAATTTGCTCAGTTTCAGACTGG + Intronic
912455773 1:109796006-109796028 GTATATACTCACTAGCAGGTTGG - Intergenic
913163289 1:116164624-116164646 GAATATTCTAAGCTGCTGGTGGG + Intergenic
913163618 1:116166671-116166693 GAATATTCTAAGCTGCTGGTGGG + Intergenic
913198415 1:116476458-116476480 GAGTATGCTCAGCTGCGGTTTGG + Intergenic
913600990 1:120421025-120421047 GAAGCTGCCCAGCTGCAGGTGGG - Intergenic
914191957 1:145419559-145419581 GAAGCTGCCCAGCTGCAGGTGGG + Intergenic
914589864 1:149097509-149097531 GAAGCTGCCCAGCTGCAGGTGGG + Intronic
915296085 1:154922890-154922912 GAATATGCCCGGTATCAGGTGGG + Intergenic
916848161 1:168674561-168674583 GAATATGCTCTCTAGGAGGTTGG - Intergenic
917332604 1:173897663-173897685 GAATATGCTCAGTCTCTAGTGGG - Exonic
919628671 1:199937779-199937801 GAAAGTGGTCAGATGCAGGTTGG - Intergenic
919730055 1:200908048-200908070 GCACATGCTCAGTTGAAGATGGG + Intronic
920208303 1:204309248-204309270 GAAAATGCTCAGTAGGTGGTTGG - Intronic
921219565 1:212963487-212963509 GAATGTGCTCAGCTGGCGGTGGG + Intronic
921610556 1:217207627-217207649 TAAAATGCTCAGTCTCAGGTAGG + Intergenic
922069943 1:222182379-222182401 GGATATGATAAGTTGCAGGAGGG - Intergenic
923641876 1:235771469-235771491 GAATATGCTCAGTTGCAGGTTGG - Intronic
924831776 1:247603563-247603585 GTATGTGCTCACTTACAGGTGGG - Intergenic
1065033674 10:21614637-21614659 AAAAAAGATCAGTTGCAGGTTGG + Intronic
1070194045 10:74140090-74140112 AAGGATGCTCAGCTGCAGGTGGG - Intronic
1072524513 10:96259443-96259465 GAATATGCTCAGAAGTAGGGTGG + Intronic
1078814869 11:14810391-14810413 GCATATTCTCACTTGTAGGTGGG - Intronic
1081592410 11:44433719-44433741 CAATTTGCTGAGTTGCAGGAAGG - Intergenic
1083200020 11:61115270-61115292 TAAGATGCTCACATGCAGGTGGG + Intronic
1083684534 11:64368584-64368606 CAAGATCCTCAGTCGCAGGTGGG + Exonic
1084932417 11:72567639-72567661 GTATATTCTCTGTTGCATGTAGG + Intergenic
1086227619 11:84531241-84531263 GCATATTCTCACTTACAGGTGGG + Intronic
1086370237 11:86149095-86149117 GATTTTGCTCTGTTGCAGGCTGG + Intergenic
1090581273 11:128162192-128162214 GAATTTGATCTGTTGCCGGTAGG + Intergenic
1097716143 12:62968594-62968616 GAATATTCACAGTTGTATGTCGG + Intergenic
1101417518 12:104521311-104521333 GAATATGATTACATGCAGGTTGG + Intronic
1103236920 12:119381076-119381098 GAATATGCCCAGTGACAGGGAGG + Intronic
1105634376 13:22203227-22203249 GAGTAGGCTCAGGTACAGGTGGG - Intergenic
1105957519 13:25298399-25298421 GGTTCTGCTCAGTTGCAGATAGG + Intergenic
1107194831 13:37637883-37637905 CAATATACTCAGCTGCACGTTGG - Intronic
1108438635 13:50426272-50426294 GGATAGGCTCAGTTGGAGTTTGG + Intronic
1110418226 13:75275533-75275555 GCATGTTCTCACTTGCAGGTGGG - Intergenic
1110991804 13:82051136-82051158 GCATATGCTCACTTATAGGTGGG + Intergenic
1111084256 13:83352922-83352944 GCATATTCTCACTTACAGGTGGG + Intergenic
1111165711 13:84455240-84455262 GCATCTGTTCAGTTGGAGGTTGG + Intergenic
1112284315 13:98090509-98090531 GAATATGCTCATGTGCAATTTGG + Intergenic
1113933750 13:113982322-113982344 GGACATGCTCAGTGGCAGCTGGG - Intronic
1115350946 14:32395136-32395158 GAATATGTTCAGTTCCAAGCAGG + Intronic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1117327407 14:54682254-54682276 GAACTTGCTCAGTTCCATGTCGG + Intronic
1118659657 14:67994735-67994757 GAAAATCATCAGTTGCAGATGGG - Intronic
1120100429 14:80438599-80438621 GCATCTGCTCAGTTTCTGGTGGG - Intergenic
1120767813 14:88346736-88346758 GAATATTTTCAGTTTAAGGTGGG + Intergenic
1124502412 15:30240585-30240607 GCATATTCTCACTTACAGGTGGG - Intergenic
1125468047 15:39974421-39974443 CAATATACTCAGTTGATGGTGGG - Intronic
1125764389 15:42123524-42123546 GGCTATGCCCACTTGCAGGTTGG + Intergenic
1125926614 15:43568329-43568351 GAATATCATCAGGTGGAGGTAGG - Intronic
1125939758 15:43667894-43667916 GAATATCATCAGGTGGAGGTAGG - Intronic
1127696135 15:61449730-61449752 GAGTATATTCAGTTGCATGTGGG - Intergenic
1128610910 15:69072557-69072579 GAATCTCCTGAGTTTCAGGTGGG - Intergenic
1138680979 16:58683536-58683558 GATTTTGCTGAGTTGCTGGTTGG - Intronic
1138966542 16:62091317-62091339 GCATATTCTCACTTGTAGGTGGG + Intergenic
1139973909 16:70793698-70793720 GAACATCCTCAGCTGTAGGTGGG + Intronic
1146668700 17:34722075-34722097 CTGTATTCTCAGTTGCAGGTGGG - Intergenic
1149252185 17:54783240-54783262 GCATGTGCTCAGGAGCAGGTTGG - Intergenic
1155540128 18:26861414-26861436 GGAAATTCTCAGTTGAAGGTGGG - Intronic
1156159016 18:34336890-34336912 GCATATTCTCACTCGCAGGTGGG + Intergenic
925239286 2:2308858-2308880 GAATATGCTGAAGTGTAGGTGGG - Intronic
926632433 2:15148542-15148564 GAATATGCTCAGGTGAAGGTTGG + Intergenic
928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG + Intronic
929039405 2:37729045-37729067 GCATGTTCTCACTTGCAGGTGGG + Intronic
929297871 2:40268919-40268941 GAGTAACCTCAGTTGCAGCTTGG + Intronic
929344388 2:40863366-40863388 GCATATGCTCAGTTATAAGTGGG + Intergenic
930109062 2:47662775-47662797 GAAGATGCTCAGAAGAAGGTGGG + Intergenic
931784106 2:65603742-65603764 GCATAGGGTAAGTTGCAGGTTGG + Intergenic
935106809 2:100052462-100052484 GGATATGGTCAGCTCCAGGTAGG - Intronic
937085954 2:119171945-119171967 GAATCTTCTCAGATGCAGGCAGG - Intergenic
937699674 2:124850219-124850241 TAAAATCCTCAGTTCCAGGTGGG - Intronic
939400741 2:141690528-141690550 GAAGATGATCAGTTACAGTTGGG + Intronic
943792166 2:191945390-191945412 GAATGTGCTGGGTAGCAGGTGGG + Intergenic
947886725 2:233578064-233578086 GCATATTCTCACTTGTAGGTGGG - Intergenic
948484114 2:238269459-238269481 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948484117 2:238269504-238269526 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948484120 2:238269549-238269571 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
1169341156 20:4797488-4797510 GAGTAAGCTCAGTTTCAGGATGG + Intronic
1170662600 20:18357662-18357684 GATTTTGCTCAGTGGCTGGTGGG - Intergenic
1171738247 20:28825936-28825958 GCATATTCTCAGTTACAGGTGGG - Intergenic
1184285635 22:43469623-43469645 AAACATGCTCTCTTGCAGGTGGG - Intronic
950880366 3:16318035-16318057 GGAAATGCTTGGTTGCAGGTTGG - Intronic
957242726 3:77679612-77679634 GCATATGCTCACTTACAAGTGGG - Intergenic
957880515 3:86206222-86206244 GCATATTCTCACTTACAGGTGGG + Intergenic
959154129 3:102645773-102645795 GAATATTGCCAGCTGCAGGTTGG + Intergenic
961207445 3:125096262-125096284 GAAGATGCACTGTTTCAGGTAGG - Intronic
961564065 3:127750797-127750819 GCATATGTACAGTTGCAGTTTGG - Intronic
963054815 3:141177470-141177492 GAATATGCTCAGTTTGAGAGAGG - Intergenic
967745326 3:193048658-193048680 GAACATTCTCATTTACAGGTGGG + Intergenic
970716293 4:18928878-18928900 GAATATGCCAAGTTACAGCTGGG - Intergenic
971042986 4:22775950-22775972 GCATATGCTCAGTTATAAGTGGG + Intergenic
971663833 4:29456503-29456525 GAATATGCTCTGTTACATGTCGG - Intergenic
972488003 4:39560672-39560694 GAATATGTTAAGTGGAAGGTGGG - Intronic
973331914 4:48918095-48918117 GCATATTCTCACTTGTAGGTGGG - Intergenic
981710210 4:147701605-147701627 GAATCTGCACAGTTGAAGGCTGG + Intergenic
986162667 5:5244652-5244674 TAATGTGCTAAGTTGCAGTTTGG - Intronic
987949291 5:24654951-24654973 GCATATTCTCACTTACAGGTGGG - Intergenic
992885819 5:81159219-81159241 AAATATGCTAAGTTAGAGGTTGG + Intronic
993417847 5:87657692-87657714 GAATCTCCTGAGTTGCAGCTGGG - Intergenic
994645680 5:102465966-102465988 GAATATTCTGAGTTTCTGGTGGG - Intronic
994917212 5:105995495-105995517 GAACATGACCAGTTGCAGATAGG + Intergenic
995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG + Exonic
997075279 5:130667322-130667344 GAATGTTCTCACTTGTAGGTGGG + Intergenic
1001086610 5:168704407-168704429 GAGTATTCTCAGTTACAGGTGGG + Intronic
1002089470 5:176795974-176795996 GAAGATGCTCCCTTTCAGGTGGG - Intergenic
1004077017 6:12352940-12352962 GAATATTCTCACTTACATGTGGG - Intergenic
1004384262 6:15158873-15158895 GAGAATGCTCTGTTGCATGTGGG + Intergenic
1004615249 6:17282256-17282278 TAATATGCTCTGTTTCAGTTCGG - Intronic
1007274673 6:40664467-40664489 GAATGTGGACACTTGCAGGTGGG - Intergenic
1008398640 6:51038067-51038089 GAAGATGCTCAGTTTCAGGCAGG + Intergenic
1012775705 6:103491392-103491414 GCATATTCTCACTTACAGGTGGG - Intergenic
1013880339 6:114891657-114891679 GAAGATGCTCTGTTCTAGGTAGG + Intergenic
1014950944 6:127555103-127555125 GAATGTGCTCATTGGCAGGATGG + Intronic
1020386748 7:7614534-7614556 GAATGTGTTCAGTTGCTGATAGG - Intergenic
1020544403 7:9505766-9505788 AAATATGCTAAGTTGCAGTTGGG - Intergenic
1021879906 7:25084558-25084580 GAATATGCTCAATAACAGGATGG + Intergenic
1022949719 7:35325588-35325610 AAATATTCTCATTTGCAGGAGGG - Intergenic
1024590580 7:50879336-50879358 GCATATTCTCACTTGTAGGTGGG + Intergenic
1028075329 7:86505765-86505787 GCATGTTCTCACTTGCAGGTGGG + Intergenic
1030880088 7:114867042-114867064 GTATATTCTCACTTACAGGTGGG + Intergenic
1032023445 7:128422838-128422860 ACATTTGCTCTGTTGCAGGTCGG - Intergenic
1032527433 7:132589955-132589977 GAAAATACTCAGTTCCAGGTGGG + Intronic
1033079535 7:138281999-138282021 CAAAATGCTGAGTTACAGGTGGG + Intergenic
1033875066 7:145805695-145805717 GCATATTCTCACTCGCAGGTGGG - Intergenic
1036521002 8:9491632-9491654 GCATATTCTCATTTGCATGTTGG + Intergenic
1036953707 8:13165004-13165026 GAATATGGTAAGTTGCAGAATGG + Intronic
1038428992 8:27484882-27484904 GAATCTGCTTAGGTGCAGGTAGG + Intergenic
1046567072 8:115915369-115915391 GAATATGCTCACTTGCAAATGGG - Intergenic
1047928631 8:129704567-129704589 TAATATGCTCACTTCAAGGTTGG + Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048436256 8:134421090-134421112 CAATATGGTCAGTTTCATGTGGG + Intergenic
1048967088 8:139623275-139623297 GGATATGTTCATTTGCAGATGGG - Intronic
1051389433 9:16548133-16548155 AAATCTTCTCATTTGCAGGTGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053431477 9:38044559-38044581 GATTCTCCTCAGTGGCAGGTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057244937 9:93447145-93447167 CAATATGATCTGTTGCAGGAGGG + Exonic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060770949 9:126331865-126331887 AGAAATGTTCAGTTGCAGGTGGG + Intronic
1187916245 X:24154902-24154924 GAATATTCTCACATACAGGTGGG + Intronic
1193412432 X:81180966-81180988 GTATATTCTCAGTCGTAGGTGGG + Intronic
1200971987 Y:9162500-9162522 AAATATTCTGAGTTGCATGTGGG + Intergenic