ID: 923643016

View in Genome Browser
Species Human (GRCh38)
Location 1:235784789-235784811
Sequence TAGTTAAATCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923643016_923643021 6 Left 923643016 1:235784789-235784811 CCCAGCTCCATCTGATTTAACTA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 923643021 1:235784818-235784840 CTGGAAACAAATTTGCTGATTGG 0: 1
1: 0
2: 1
3: 12
4: 209
923643016_923643022 21 Left 923643016 1:235784789-235784811 CCCAGCTCCATCTGATTTAACTA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 923643022 1:235784833-235784855 CTGATTGGCTACAGCTGCCATGG 0: 1
1: 0
2: 2
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923643016 Original CRISPR TAGTTAAATCAGATGGAGCT GGG (reversed) Intronic
901928471 1:12582113-12582135 TAGAGAAATCAGTTGGATCTGGG - Intronic
906721579 1:48009445-48009467 TAGTGAAATAACATGGATCTGGG - Intergenic
906820850 1:48928403-48928425 TAGTTGGGTCAGATGGATCTGGG + Intronic
908928027 1:69280378-69280400 TAAATAAATCAGATGCATCTGGG + Intergenic
909209217 1:72801215-72801237 AAATTAAATGAGATGGAGCATGG + Intergenic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
923643016 1:235784789-235784811 TAGTTAAATCAGATGGAGCTGGG - Intronic
924612277 1:245583570-245583592 TCGTTAAATCAGCTGGTTCTAGG + Intronic
1064508737 10:16065355-16065377 TAGATAAATAAAATGGGGCTGGG - Intergenic
1067073173 10:43152846-43152868 TAGTTAAAACAGATACCGCTAGG + Intronic
1067832261 10:49616972-49616994 TAGTGATAGCAGCTGGAGCTGGG - Intronic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1073829622 10:107367338-107367360 TGAATAAATCAGATGGATCTTGG + Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074970829 10:118535406-118535428 TAGTTTAATCAAATGTAGGTGGG + Intergenic
1076624223 10:131811658-131811680 TATTAAAATAAGATGGATCTGGG + Intergenic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1078918866 11:15808140-15808162 TAATGAAAACAAATGGAGCTGGG - Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079311712 11:19372446-19372468 TATTTTCTTCAGATGGAGCTTGG + Intronic
1080762434 11:35264866-35264888 TAGGTACATCAGATGATGCTGGG + Intronic
1081321026 11:41691742-41691764 TCTTTAAATGAGATGGACCTAGG + Intergenic
1089610092 11:119664241-119664263 CAGTGAAATCTGATGCAGCTGGG - Exonic
1092040078 12:5376341-5376363 TAAATAAATAAGATGCAGCTAGG + Intergenic
1093884050 12:24439477-24439499 AAGTGAAATGAGATTGAGCTGGG - Intergenic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1097371542 12:58787711-58787733 TAGTTTAATTAAATGGTGCTGGG - Intronic
1099556704 12:84117854-84117876 TAGTTAATTCATTTGGAGGTGGG + Intergenic
1102262078 12:111449221-111449243 TAGTTAAATTAACTGGGGCTAGG + Exonic
1104034234 12:125087440-125087462 TAGTTAATTGAGATGCAGGTAGG + Intronic
1105370870 13:19800837-19800859 TACTAAAATTACATGGAGCTAGG - Intergenic
1109729604 13:66394613-66394635 TATTTAAATGAGATGGAAGTTGG - Intronic
1111470957 13:88681959-88681981 TTCTTAAAACAGATGGATCTTGG - Intergenic
1111514466 13:89310290-89310312 CAGTTAAATAAGATGGAGTGGGG - Intergenic
1111774654 13:92644021-92644043 AAGTTAAATCAGAGGAAGCATGG + Intronic
1114476855 14:23001758-23001780 TATTTAAAGAAGAAGGAGCTGGG - Intronic
1114515119 14:23294327-23294349 TGGTTAAAGCAGTTGGTGCTGGG + Intronic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1118168267 14:63359346-63359368 TAATCAAATCAGAGGGACCTGGG + Intergenic
1118453159 14:65922433-65922455 TAATGAAATCAGATAGATCTGGG + Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121450645 14:94004952-94004974 TACCTTAATCAGATCGAGCTTGG - Intergenic
1125360424 15:38858797-38858819 TAGGCAAATAAGATGGAGCCAGG - Intergenic
1127817342 15:62622824-62622846 TAATAAAATAAGATGGAGTTTGG + Intronic
1128035540 15:64521950-64521972 TAGATAACACAGCTGGAGCTTGG - Intronic
1128048256 15:64639105-64639127 AAAATAAATAAGATGGAGCTTGG + Intronic
1130541365 15:84822765-84822787 CAGTTAATTCAGCAGGAGCTGGG - Intronic
1135151139 16:20007051-20007073 TAGTTCAATCTGCTGGAGCAGGG + Intergenic
1135621444 16:23959386-23959408 TAGGAAGATCAAATGGAGCTAGG - Intronic
1136116844 16:28099970-28099992 TAGTTATATCAGAAGCACCTGGG - Intronic
1138406222 16:56796375-56796397 AAGTTAAACCATATGCAGCTTGG + Intronic
1140641636 16:76980357-76980379 CTGTTAAATCAAATGGAGATGGG + Intergenic
1142147270 16:88497838-88497860 GAGATTAGTCAGATGGAGCTCGG - Intronic
1143603317 17:7964109-7964131 TACTTCAATCCAATGGAGCTTGG - Intergenic
1149197631 17:54140805-54140827 TAGGTAAATGGGATGGAGTTGGG - Intergenic
1153116587 18:1664359-1664381 TAGTTCTTTCTGATGGAGCTGGG - Intergenic
1153366960 18:4267469-4267491 TTGTTAAAACAAATGGAGGTGGG - Intronic
1157365091 18:47057561-47057583 TAGCTAACTCTGATGGAGATGGG - Intronic
1161853200 19:6749564-6749586 TTGTTAAATCACATGGAGCCCGG + Intronic
925928426 2:8686391-8686413 TAGTTAAAGCAGTGGGAGGTGGG + Intergenic
926347915 2:11966236-11966258 TAGTCAAATCAGATGAAGGCAGG - Intergenic
926404443 2:12536662-12536684 TAGTAAAATTAAATGAAGCTGGG + Intergenic
926918147 2:17913164-17913186 TAGTTAAGCCAGATAGAGGTAGG + Intronic
929279007 2:40057769-40057791 TAGTGAAAGCAGAGGGAGATGGG + Intergenic
942536517 2:176970071-176970093 CAGTTAAATCAGACTGAGCATGG + Intergenic
945517268 2:210778000-210778022 TAGGTAAATCACATGGAATTGGG - Intergenic
947719694 2:232363008-232363030 TAGGTAAATGAGATGAACCTGGG - Intergenic
1174728460 20:52889979-52890001 TGATTAAATCAGTTGGAGATAGG - Intergenic
1182889617 22:33806319-33806341 TAGCTGAAGCAAATGGAGCTAGG + Intronic
950244278 3:11401171-11401193 TTGTTAAAACAGAAGTAGCTGGG - Intronic
951838719 3:27010140-27010162 TGGCTAAATAAGATGGAGATTGG + Intergenic
955079349 3:55643762-55643784 TAGTAAAATCAGATGTAAGTTGG + Intronic
957935188 3:86933314-86933336 TAGTAGATTGAGATGGAGCTTGG + Intergenic
961176640 3:124841197-124841219 CAGTCAAATCAGCCGGAGCTCGG - Intronic
961728208 3:128946820-128946842 TAGTGAAATCAGATGCACCAAGG + Intronic
964888612 3:161513306-161513328 TATTTAAATAAAATGGTGCTGGG + Intergenic
971061066 4:22970558-22970580 TAGATTAATCAAAAGGAGCTAGG + Intergenic
972722148 4:41710863-41710885 TAACAAAATCAGTTGGAGCTGGG + Intergenic
978901921 4:113961399-113961421 ATGTTACATCAGATGGAGGTTGG + Intronic
979447253 4:120828756-120828778 TATTAATATCAGATGTAGCTAGG - Intronic
980265261 4:130506990-130507012 TAGTTAAGTCATATGGAGAAGGG - Intergenic
984311946 4:178072507-178072529 AAGATAAATTTGATGGAGCTTGG + Intergenic
984959073 4:185077016-185077038 TTTTCAAATCAGATGGACCTAGG + Intergenic
985934055 5:3080843-3080865 TAGATGAGTCAGATGGAGATAGG + Intergenic
986989019 5:13530094-13530116 TAGATAAAGCAGCTGAAGCTGGG + Intergenic
987742149 5:21923739-21923761 TAGGTAACTCATATGGATCTTGG + Intronic
988103641 5:26714134-26714156 TATTTAAAAATGATGGAGCTGGG - Intergenic
988642673 5:33058644-33058666 TGGCTAAATCAGAAGGAGCAAGG + Intergenic
989206097 5:38810019-38810041 TACTTAAGAAAGATGGAGCTGGG + Intergenic
990015639 5:51058765-51058787 TAGTTAAAACTGATGGCACTAGG - Intergenic
990599067 5:57339118-57339140 TAGAGAAATCAGATAGAGCTGGG + Intergenic
990617564 5:57522899-57522921 GAGTTAAATCAGTTGAAGGTGGG + Intergenic
990617886 5:57526071-57526093 TAGTCAACACATATGGAGCTGGG + Intergenic
996371817 5:122761261-122761283 TAGTTTCATCTGATGGAGCCTGG - Intergenic
997704499 5:135934356-135934378 AAGTGAAATCAAATGGAGGTTGG + Intronic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
1003805018 6:9718399-9718421 TTTTAAAATCAGATGGAACTGGG + Intronic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1004380769 6:15130400-15130422 TAGCTAAATCAGGTCGGGCTTGG + Intergenic
1008599593 6:53078021-53078043 TAGGTAAATAAGAGGCAGCTGGG + Intronic
1009241944 6:61194937-61194959 TAGTTAAATCAGAGGTTTCTTGG + Intergenic
1015025153 6:128523653-128523675 TATTTAAATCTGATAGAACTGGG - Intergenic
1016648081 6:146433771-146433793 CAGTTAAATCACACTGAGCTAGG + Intronic
1020472806 7:8558387-8558409 GAGTTAGAGCAGCTGGAGCTTGG + Intronic
1022640299 7:32176167-32176189 TAGTTAATTCAGATGTAGTTAGG - Intronic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1030571155 7:111226312-111226334 TAGTAAAATAAAATGTAGCTGGG - Intronic
1035974246 8:4289388-4289410 TAGTTAAAGTAGAGGGAGCCAGG + Intronic
1036539041 8:9685644-9685666 TAATTAATTCAGTTGGAGCTTGG + Intronic
1036597117 8:10223971-10223993 TAGTTAGATTAGGTAGAGCTGGG - Intronic
1038667746 8:29555539-29555561 TATCTAAAACAGATGGAGCCAGG - Intergenic
1040007158 8:42630235-42630257 TACCTAAATCAGGTGGAGGTAGG + Intergenic
1046824917 8:118678000-118678022 TTTTTAGATCAGATGGAGCTTGG + Intergenic
1047320088 8:123770929-123770951 TAGTAATCTCAGATGGAGCTCGG - Intronic
1048357280 8:133663932-133663954 TCCTGAAATCAGAAGGAGCTTGG + Intergenic
1050417406 9:5432191-5432213 TAGTTCAATCAGTTGGTGTTAGG - Intronic
1052021749 9:23533007-23533029 CAGTGAAGTCAGATGGAGCCAGG - Intergenic
1052890154 9:33691628-33691650 TAGTTCTATCAGATGGAGGCTGG + Intergenic
1059392740 9:114009159-114009181 TGGGTAATTCAGATGGGGCTTGG + Intronic
1059508895 9:114825543-114825565 TATTTGAATCAGATGGAGACAGG - Intergenic
1060285013 9:122243121-122243143 TAAAAAAATCAGATGGGGCTGGG - Intronic
1186683003 X:11895587-11895609 CAGTTAAATGAGATGGAAATGGG + Intergenic
1187117822 X:16371284-16371306 TTGTTGAATAATATGGAGCTGGG + Intergenic
1187651092 X:21407375-21407397 TAGTTAAGACAGATGTACCTGGG + Intronic
1189445737 X:41079126-41079148 TAGTCAAATCAAATGGAAATTGG + Intergenic
1192813208 X:74567421-74567443 TCTTAAAATCAGATGGAGCTGGG - Intergenic
1193513642 X:82436192-82436214 TATATAAATCAGACGGAGCATGG + Intergenic