ID: 923645365

View in Genome Browser
Species Human (GRCh38)
Location 1:235815071-235815093
Sequence CTAAGTTTACTAAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923645365 Original CRISPR CTAAGTTTACTAAGGGAAGC AGG (reversed) Intronic
900913077 1:5616033-5616055 CTAAGTTTCCAAAGTGGAGCAGG + Intergenic
902681817 1:18049057-18049079 CTAAGACTGCAAAGGGAAGCGGG + Intergenic
903079520 1:20798035-20798057 ATTAGTTTACTAAGGAAATCAGG + Intergenic
907144785 1:52222113-52222135 CTAAATTTCCTAAGGGAACAAGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913668631 1:121073700-121073722 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914020375 1:143861143-143861165 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914658875 1:149769055-149769077 CTGAGTTGACTAAGGGAATAAGG + Intergenic
917822562 1:178779311-178779333 CTAAAGTTATTAAGGAAAGCAGG - Intronic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
1063826354 10:9902789-9902811 CTAGGTTTTCTATGGGCAGCAGG + Intergenic
1065411390 10:25433115-25433137 CTAATGTTACTTGGGGAAGCTGG + Intronic
1066017935 10:31267238-31267260 CTAATTTTTCCAAGGGATGCAGG - Intergenic
1068241218 10:54302984-54303006 CTAAGTTTTGTAAAGGAAGTGGG - Intronic
1068654266 10:59558661-59558683 TTGAGATTACTATGGGAAGCTGG + Intergenic
1068744845 10:60518379-60518401 CTAACGTTACTACAGGAAGCTGG + Intronic
1069227681 10:65964033-65964055 CAAAGTTTACTAAATAAAGCTGG - Intronic
1070334176 10:75439859-75439881 CTAAGTCTGCTCTGGGAAGCTGG - Intronic
1073169247 10:101489075-101489097 CTAAGTTTTTTCAGGGAAGAGGG - Intronic
1074842107 10:117364874-117364896 CTCATTTTACTAAGGGCAGAAGG + Intronic
1079971149 11:27037144-27037166 TTAAGTTTTCTTATGGAAGCTGG - Intergenic
1080505604 11:32910072-32910094 GTGAGTGTACTAAGGGAAGTGGG - Intronic
1089738216 11:120564311-120564333 ATAAGTTTACAAATGGAATCCGG - Intronic
1090080311 11:123608077-123608099 CTAAGTTTAAAAAGGGGAGTAGG + Intronic
1097963822 12:65558141-65558163 TCAAGTTTTCTAAGGGAAGAGGG + Intergenic
1105714785 13:23052377-23052399 CTGAGTTTGCCAAGGGAAACAGG - Intergenic
1106108544 13:26757108-26757130 CTGAGGTTACTTATGGAAGCAGG - Exonic
1106650517 13:31685498-31685520 CTAAGTGGACTGAGAGAAGCAGG - Intergenic
1108628218 13:52253902-52253924 CTAAGTTGACTATGAGAAGGGGG - Intergenic
1108657841 13:52552547-52552569 CTAAGTTGACTATGAGAAGGGGG + Intergenic
1110316374 13:74112822-74112844 GTAAGTTTAATGAGGGAGGCAGG + Intronic
1111103079 13:83612196-83612218 TTCAGTTTCATAAGGGAAGCAGG - Intergenic
1113511061 13:110855122-110855144 CTAAGCTCACTGAGGGAACCAGG - Intergenic
1114559480 14:23579760-23579782 CTAAGTAAACTAAGGGGAGAGGG - Intergenic
1119101008 14:71880228-71880250 TTCAGTTTTATAAGGGAAGCAGG + Intergenic
1120831144 14:88998779-88998801 CTAAGGTTAATAGAGGAAGCAGG - Intergenic
1202840382 14_GL000009v2_random:115642-115664 CTAAGTTAATGAAGGGAACCCGG + Intergenic
1202909766 14_GL000194v1_random:105839-105861 CTAAGTTAATGAAGGGAACCTGG + Intergenic
1124569819 15:30852849-30852871 CTAAGCTTCATAAGTGAAGCAGG - Intergenic
1127252017 15:57248429-57248451 ATAAGTTTACTAAGGGAGCTTGG + Intronic
1129469377 15:75742270-75742292 TTCAGTTTTATAAGGGAAGCAGG + Intergenic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1131199398 15:90384264-90384286 CTAAGTTTACACATGGAATCAGG + Intergenic
1133120972 16:3607482-3607504 CTCAGTATACCAAGGGCAGCAGG + Intronic
1141364890 16:83433514-83433536 CTAATTTTACCAAAGGCAGCTGG + Intronic
1149000580 17:51753182-51753204 CTACGTATATTGAGGGAAGCAGG + Intronic
1150866243 17:68853385-68853407 CTATGTAGACTAAGGGAATCAGG + Intergenic
1155449275 18:25946610-25946632 CCTAGTTTGCTAAGGGCAGCTGG - Intergenic
1156541031 18:37910701-37910723 CTAAGTTTACTATGTGACTCTGG - Intergenic
1156858626 18:41812133-41812155 ATAAGGTCACAAAGGGAAGCAGG + Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG + Intronic
928827103 2:35436389-35436411 CTAAGCTTAGTAAGCAAAGCAGG + Intergenic
930280505 2:49363112-49363134 TTCAGTTTTATAAGGGAAGCAGG - Intergenic
931083039 2:58797056-58797078 CTCAGTTTACTCACAGAAGCAGG + Intergenic
931571770 2:63676213-63676235 GAAAGTTTACAAAGGGGAGCCGG + Intronic
932294909 2:70616224-70616246 CTCAGCTCACTAAGGGCAGCAGG + Intronic
935626043 2:105172989-105173011 TTCAGTTTTATAAGGGAAGCAGG - Intergenic
938509549 2:131926135-131926157 TTAAGTTTATTAAGGAATGCAGG - Intergenic
939610195 2:144300735-144300757 CAAGGTCTACTAAGGGAAGCTGG + Intronic
943559130 2:189440672-189440694 GTAAGTTTACAAAGGAAAACTGG + Intergenic
945666806 2:212753606-212753628 CTAGGGTTACTCAGGCAAGCAGG + Intergenic
947501863 2:230676742-230676764 CACAGTTTACTCAGGGAGGCTGG + Intergenic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
1171374693 20:24684557-24684579 CCCTGTTTTCTAAGGGAAGCTGG - Intergenic
1172806386 20:37615029-37615051 CTGAGTTTACAATGGGATGCAGG - Intergenic
1176629113 21:9120547-9120569 CTAAGTTAATGAAGGGAACCTGG + Intergenic
1177839212 21:26217853-26217875 TTTAGTTTTATAAGGGAAGCAGG + Intergenic
1178363663 21:31970401-31970423 CTTAGGTTACCAAGGGAACCTGG + Intronic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1182942766 22:34293557-34293579 TTCAGTTTATTTAGGGAAGCTGG + Intergenic
1185166418 22:49265263-49265285 CTAACTTTACCAAGGGAATAGGG - Intergenic
949730405 3:7105482-7105504 CTTAGTCTACTAAGGTATGCAGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
952075161 3:29686920-29686942 CTATGTTTACTAAGGCTAGCAGG - Intronic
964035166 3:152187078-152187100 CTGGGTTTCCTAAGGTAAGCTGG + Intergenic
964088453 3:152846476-152846498 TTCAGTTTTATAAGGGAAGCAGG + Intergenic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
964573153 3:158133846-158133868 CTTAGTTTACTAAGTGGAACAGG + Intronic
964756820 3:160096361-160096383 CTAAGTTTACTAAGGCCAGGTGG - Intergenic
967491865 3:190101285-190101307 TTAAGTTTACTGAGGAAGGCAGG + Intronic
967930124 3:194685129-194685151 CTTAGTTTACTTTGGCAAGCCGG - Intergenic
969616914 4:8258648-8258670 ATAAGATCACTAGGGGAAGCTGG - Intergenic
970520953 4:16883389-16883411 TTAAGTTTACAGAGGGAAGAAGG + Intronic
977649363 4:99452477-99452499 CTAAGCTTCCTAAGTGAAGGAGG - Intergenic
977703050 4:100042309-100042331 CTCAGTTTTCTCAAGGAAGCAGG + Intergenic
978101148 4:104841826-104841848 TTCAGTTTTATAAGGGAAGCAGG - Intergenic
980522554 4:133952046-133952068 CTTAGTTTCCTAAGGGAAAGGGG - Intergenic
980688206 4:136257791-136257813 CGCAGTCTAGTAAGGGAAGCAGG - Intergenic
982705732 4:158706971-158706993 GTATGTTTCCTAAAGGAAGCTGG - Intronic
984837850 4:184039255-184039277 TTAAGCCTACCAAGGGAAGCAGG - Intergenic
984865311 4:184275662-184275684 CTGAGTTTATTAAAGGAAGTGGG + Intergenic
985317594 4:188674392-188674414 CTAAGTTTCATAAGTGAAGGAGG + Intergenic
987118586 5:14745750-14745772 TTAACCTTACAAAGGGAAGCAGG + Intronic
990145261 5:52752336-52752358 CCAAGTTTAGTAAAGGAAGAGGG + Intergenic
995919531 5:117295036-117295058 CTAAGGTTAGTAAGTGAGGCAGG + Intergenic
996243056 5:121226461-121226483 TTCAGTTTTATAAGGGAAGCAGG + Intergenic
999721785 5:154404019-154404041 CTGAGTGCACTAAGGGATGCTGG + Intronic
1000662566 5:163953648-163953670 CAAAGTTTAGTAGGGGAAGAGGG - Intergenic
1001186062 5:169574082-169574104 CCAAGTTTACTAATGGACGGAGG - Intergenic
1003881678 6:10484666-10484688 CAAACTTTACTGCGGGAAGCTGG - Intergenic
1005230066 6:23689638-23689660 TTAAGTGTACTAAGGGAGGGAGG - Intergenic
1005259646 6:24044511-24044533 CTAATTTGAATAAGGGAATCTGG - Intergenic
1006947421 6:37794135-37794157 ATATGTTCACTAAGGGAATCTGG - Intergenic
1008377477 6:50808739-50808761 CCAAGTTTACTAATGCAACCTGG + Intergenic
1012661418 6:101899861-101899883 CCAAGAATAGTAAGGGAAGCAGG - Intronic
1013277602 6:108600762-108600784 CTAATTTTTATAAGGGAAGAAGG + Intronic
1013415871 6:109924046-109924068 CAAAGTTTAGGAAGGAAAGCTGG + Intergenic
1013662022 6:112307755-112307777 CTCAGTTTTCTAAGGTCAGCAGG - Intergenic
1014672734 6:124326884-124326906 CTAAGGTCACTAAGGGGAGCTGG - Intronic
1020529693 7:9317455-9317477 CTGAGTTTACTAGGGAAATCGGG + Intergenic
1021885675 7:25136282-25136304 CTAGGTTTACTAAGGCTAACAGG + Exonic
1022972818 7:35532786-35532808 CTTCATTTTCTAAGGGAAGCTGG - Intergenic
1023169003 7:37372489-37372511 CTAAGTTCACAAAGTCAAGCAGG + Intronic
1026464421 7:70641606-70641628 CTAAGTTAACTAAGGTAATCAGG + Intronic
1026577877 7:71589194-71589216 CTTAGCTTACTAAGGCAAGCTGG + Intronic
1028291268 7:89067676-89067698 AAAATTTTACAAAGGGAAGCAGG + Intronic
1031586456 7:123536122-123536144 CAAAGTTTAATGAGGGAACCAGG + Intergenic
1033188371 7:139251432-139251454 CTAAGTTTAATATGGTAACCTGG - Intronic
1037843341 8:22261311-22261333 CTGAGATTGCTGAGGGAAGCAGG - Intergenic
1038015542 8:23511363-23511385 CTCATTTTACTAAGGAGAGCTGG + Intergenic
1039215715 8:35268104-35268126 CTAAGTTTTCTAAGGGAATATGG - Intronic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1046400356 8:113697179-113697201 TTCAGTTTTATAAGGGAAGCAGG + Intergenic
1049908333 9:240756-240778 GTAAGTTTCATGAGGGAAGCAGG - Intronic
1053568726 9:39281049-39281071 CAAAGTTTTCTACGGGCAGCAGG + Intronic
1053834695 9:42122080-42122102 CAAAGTTTTCTATGGGCAGCAGG + Intronic
1054128417 9:61337958-61337980 CAAAGTTTTCTACGGGCAGCAGG - Intergenic
1054595843 9:67065448-67065470 CAAAGTTTTCTATGGGCAGCAGG - Intergenic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1056923905 9:90816099-90816121 TTGAGCTTACTAATGGAAGCAGG + Intronic
1058874853 9:109235315-109235337 CTAAGTTTACAAAGGGAAAGGGG - Intronic
1060257787 9:122047735-122047757 CTAAGCATAGTAAGGGAATCAGG - Intronic
1203789949 EBV:145736-145758 ATAAGTTAACAAGGGGAAGCGGG - Intergenic
1203751956 Un_GL000218v1:88229-88251 CTAAGTTAATGAAGGGAACCTGG + Intergenic
1192326021 X:70133246-70133268 CTAAGTGCACGAAGGGAAGCCGG + Intergenic
1193636999 X:83963445-83963467 CTAAGCTTTCTAAGAGAAGGGGG - Intergenic
1193807936 X:86016180-86016202 TTCAGTTTTATAAGGGAAGCAGG + Intronic
1196133847 X:112185944-112185966 CTAAGGTCACAAAGGGAAGTGGG + Intergenic
1198800359 X:140441313-140441335 TGAAGTTTACTGAGGGAATCAGG + Intergenic
1200855118 Y:7929552-7929574 CTACAATTACTAAAGGAAGCAGG + Intergenic
1200862347 Y:8006420-8006442 CTAAAATTACCAAAGGAAGCAGG + Intergenic
1201165614 Y:11205848-11205870 CTAAGTTAATGAAGGGAACCGGG + Intergenic
1202246028 Y:22821209-22821231 CTAAAATTACTAAAGGAAGCAGG - Intergenic
1202261759 Y:22977645-22977667 CTACAATTACTAAAGGAAGCTGG - Intronic
1202399016 Y:24454957-24454979 CTAAAATTACTAAAGGAAGCAGG - Intergenic
1202414747 Y:24611386-24611408 CTACAATTACTAAAGGAAGCTGG - Intronic
1202456038 Y:25058700-25058722 CTACAATTACTAAAGGAAGCTGG + Intronic
1202471764 Y:25215129-25215151 CTAAAATTACTAAAGGAAGCAGG + Intergenic