ID: 923646075

View in Genome Browser
Species Human (GRCh38)
Location 1:235821633-235821655
Sequence ATCTGGTTCTTTATATAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 633}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923646075_923646077 -3 Left 923646075 1:235821633-235821655 CCTTTTTATATAAAGAACCAGAT 0: 1
1: 0
2: 4
3: 64
4: 633
Right 923646077 1:235821653-235821675 GATAGTAAATATTTTAGACTTGG 0: 1
1: 10
2: 38
3: 109
4: 398
923646075_923646078 11 Left 923646075 1:235821633-235821655 CCTTTTTATATAAAGAACCAGAT 0: 1
1: 0
2: 4
3: 64
4: 633
Right 923646078 1:235821667-235821689 TAGACTTGGTGAGTCATATATGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923646075 Original CRISPR ATCTGGTTCTTTATATAAAA AGG (reversed) Intronic
901720766 1:11195406-11195428 ATATGGTTCTTTTTAGCAAAGGG - Exonic
901950726 1:12743816-12743838 ATTTGGTTCTTTATGTCAAAAGG - Intergenic
902068577 1:13711993-13712015 ATCTTTTTCTTAATAAAAAAAGG - Intronic
902231908 1:15033159-15033181 CTCAAGTCCTTTATATAAAATGG - Intronic
902546244 1:17192389-17192411 ATTTCGTTCTTTATAGCAAAAGG - Intergenic
903695603 1:25204283-25204305 ATCTGGCTCTTTACAGAAAAAGG - Intergenic
905910675 1:41651597-41651619 CTCAAGTCCTTTATATAAAATGG - Intronic
907752767 1:57279228-57279250 TTCAAGTTCTTTATATAAAATGG + Intronic
908630013 1:66093360-66093382 CTCAGTTTCTTAATATAAAAAGG - Intronic
908922429 1:69211775-69211797 ATCTGCTTGGCTATATAAAATGG - Intergenic
908995206 1:70143736-70143758 ATTTGATTTTTTTTATAAAATGG - Intronic
908996623 1:70163393-70163415 ATCAGATTCTTTTTAGAAAAAGG - Intronic
909351225 1:74655663-74655685 ATCTGTTACTTTACATGAAAAGG - Intronic
909650912 1:77974942-77974964 CTCAAGTTCCTTATATAAAATGG + Intronic
910578400 1:88793686-88793708 CTCAAGTCCTTTATATAAAATGG + Intronic
910907004 1:92192062-92192084 TTCAAGGTCTTTATATAAAATGG + Intergenic
911763680 1:101646571-101646593 CTCAAGTCCTTTATATAAAATGG + Intergenic
912401066 1:109393221-109393243 ATCTGGTTCCTTAAATAAACAGG - Intronic
912458358 1:109814775-109814797 ATCTGGTTCTTTGTCTAGTAAGG + Intergenic
912459383 1:109820900-109820922 CTCAGGTTCCTGATATAAAATGG - Intergenic
912912748 1:113779140-113779162 AGCTGTACCTTTATATAAAATGG + Intronic
912915248 1:113808207-113808229 ATCAAGTCCTTCATATAAAATGG + Intronic
913278877 1:117165969-117165991 AGCTGGTTATTTGGATAAAATGG - Intronic
913281863 1:117193139-117193161 CTCAAGTTCCTTATATAAAATGG - Intronic
913460028 1:119075360-119075382 CTCAAGTTCCTTATATAAAATGG - Intronic
914515748 1:148372653-148372675 AATTGGCTCTTTATATCAAAAGG - Intergenic
915144335 1:153786341-153786363 TTCTGGTTATTTAAATAATATGG + Intergenic
916771681 1:167915052-167915074 TTCTGCTTCATTATATAAACAGG + Intergenic
917153258 1:171966779-171966801 ATTTGGCTCTTTAAATCAAAGGG + Intronic
917311881 1:173687377-173687399 AACTGGTTGTTTAAATAAAAGGG - Intergenic
917916054 1:179703212-179703234 ATTTGGCTCTTTACATTAAAAGG - Intergenic
918333539 1:183484191-183484213 AGGTGCTCCTTTATATAAAATGG + Intronic
918686733 1:187426376-187426398 ATCTGCTATTTTATGTAAAATGG - Intergenic
920267112 1:204732279-204732301 ATTTGGCTCTTTACATCAAAAGG + Intergenic
920886038 1:209929001-209929023 CTTAAGTTCTTTATATAAAATGG - Intergenic
920887283 1:209941853-209941875 ATCAAGTTCTTTATATCATATGG + Intronic
921380796 1:214522691-214522713 TTCTTGTCCTTTATTTAAAACGG - Intronic
921768485 1:219003811-219003833 ATATATGTCTTTATATAAAAAGG + Intergenic
922003038 1:221500366-221500388 CTCAAGTACTTTATATAAAATGG + Intergenic
922283497 1:224147583-224147605 CTCAAGTCCTTTATATAAAATGG - Intronic
922970432 1:229731795-229731817 ATCTGGTTCTTAATCTAGAGTGG - Intergenic
923173366 1:231438390-231438412 CTCAAGTTCCTTATATAAAATGG - Intergenic
923646075 1:235821633-235821655 ATCTGGTTCTTTATATAAAAAGG - Intronic
923903577 1:238356807-238356829 ATATGGTTCTTTCTATCACATGG + Intergenic
923926448 1:238633165-238633187 CTCAAGTCCTTTATATAAAATGG + Intergenic
924047422 1:240046132-240046154 ATCAGTTTCTTTATAAAAACGGG - Intronic
924085384 1:240446143-240446165 ATTTAGTTCTTTTTAAAAAATGG + Intronic
924245702 1:242082107-242082129 TTGTAGTTATTTATATAAAAAGG - Intergenic
1062781181 10:209753-209775 ATCTTGTTCTTTATCTCAACAGG + Intronic
1063497027 10:6519684-6519706 ATTTGGCTCTTTACATCAAAAGG - Intronic
1064553672 10:16527035-16527057 ATCTGGCTCTTAAAATAATAAGG + Intergenic
1065555621 10:26912690-26912712 ATGTGGTACCTTATATAAAGTGG - Intergenic
1065743018 10:28814073-28814095 ATCTGCTAGTTTATATAGAATGG + Intergenic
1066197822 10:33118158-33118180 AGCTGGATCTTGATATAAATGGG + Intergenic
1067000834 10:42611546-42611568 TTTTGGTACTTTATCTAAAAGGG - Intronic
1067159192 10:43808420-43808442 ATCTGGTTCTTAAAAGGAAATGG - Intergenic
1067973301 10:50994989-50995011 CTCAAGTCCTTTATATAAAATGG - Intronic
1068144429 10:53049158-53049180 ATCTGCTTTGCTATATAAAAAGG - Intergenic
1068694900 10:59957196-59957218 ATTTTCTCCTTTATATAAAAGGG - Exonic
1068903585 10:62298024-62298046 ATCTGTTCGTTTATATTAAATGG - Intergenic
1068941299 10:62683744-62683766 ATTTGTTTCTTTATAGACAAAGG - Intergenic
1069266106 10:66459935-66459957 TTTTGGTTCTTTATTTTAAATGG + Intronic
1069346284 10:67474187-67474209 CTCAAGTCCTTTATATAAAATGG - Intronic
1069533005 10:69232748-69232770 ATTTGTTTCTTAATAGAAAATGG + Exonic
1069570248 10:69490337-69490359 CTCAAGTCCTTTATATAAAATGG + Intronic
1070025001 10:72623917-72623939 AACTGGTTCTTATTTTAAAAGGG + Intronic
1071470506 10:85980800-85980822 ATCTGCTTCTTAATAGAAACAGG + Intronic
1071833654 10:89397010-89397032 ATTTGGTTCTTTATAAAATAGGG + Intronic
1072051841 10:91712491-91712513 TTCAGTTTCTTTATTTAAAATGG - Intergenic
1072280019 10:93857455-93857477 ATTTGGCTCTTTACATCAAAAGG - Intergenic
1072332390 10:94366369-94366391 AACTGTTTGTTTATAGAAAATGG - Intergenic
1073586354 10:104714007-104714029 ATTTGATACTTCATATAAAATGG - Intronic
1074036598 10:109745395-109745417 GTCTGGTTCTTTATAGCAAGTGG - Intergenic
1074070821 10:110067431-110067453 ATATGATGCTTTAAATAAAAAGG - Intronic
1074395478 10:113094545-113094567 ATCTGCTTCTTTATATAATCAGG - Intronic
1074464576 10:113669873-113669895 CTCAAGTTCCTTATATAAAATGG + Intergenic
1075031001 10:119024871-119024893 GTTTGCTTCCTTATATAAAAAGG - Intergenic
1075503799 10:123003381-123003403 CTCCAGTCCTTTATATAAAATGG - Intronic
1075751907 10:124779438-124779460 TTCTGTTTCTTTATAGAAAATGG - Intronic
1076148877 10:128147091-128147113 ACCTGGATTTTCATATAAAAGGG + Intergenic
1076822836 10:132949226-132949248 AGCTGGTTCTTTTAAAAAAAAGG - Intergenic
1077751555 11:4976285-4976307 ATCATGTTCTTTATATTAATAGG + Intronic
1077825338 11:5802194-5802216 ATCAAGTCCTTTATATAAAATGG - Intronic
1077934311 11:6767760-6767782 ATCTGGTTATTTTTATAACATGG + Intergenic
1077991562 11:7416702-7416724 CTCAGGTCCCTTATATAAAATGG - Intronic
1078306590 11:10194395-10194417 CTCAAGTTCCTTATATAAAATGG - Intronic
1078958177 11:16227687-16227709 AACTTGTTCTTAATAAAAAATGG - Intronic
1079918196 11:26397489-26397511 ATGAAGTTCTCTATATAAAAAGG + Intronic
1080340817 11:31261645-31261667 CTCAGGTCCCTTATATAAAATGG - Intronic
1080359915 11:31500908-31500930 ATTTGGTCTTTTATAGAAAAAGG + Intronic
1080491731 11:32771930-32771952 TTCTCGTTCTTTGTATAACATGG - Intronic
1080840622 11:35980428-35980450 TTCTGTTTATATATATAAAATGG + Intronic
1080927439 11:36772558-36772580 ATCTGCTTCTTCAAAAAAAAAGG + Intergenic
1081028648 11:38049003-38049025 ATCTGGCCCTTTAGAGAAAATGG + Intergenic
1085996251 11:81917849-81917871 ATCTGTTTCTTCATCTATAAAGG + Intergenic
1086054151 11:82627819-82627841 AACTGGTTGTGTATATTAAAAGG - Intergenic
1086253294 11:84843593-84843615 CTCAAGTCCTTTATATAAAATGG + Intronic
1086566693 11:88234867-88234889 TTCTGTTTCTTCATCTAAAATGG + Intergenic
1086761999 11:90643079-90643101 TTCACGTTCTTGATATAAAATGG - Intergenic
1086783992 11:90942470-90942492 CCATGGTACTTTATATAAAATGG - Intergenic
1087622034 11:100553805-100553827 ATTTGGCTCTTTATGTTAAAAGG - Intergenic
1088817379 11:113430875-113430897 TTCTTGTTCTTTTTTTAAAATGG + Intronic
1089093844 11:115901327-115901349 ATCTGATTCTTGCTATAAAATGG + Intergenic
1090298867 11:125616217-125616239 CTCAGGTCCCTTATATAAAATGG + Intronic
1091093645 11:132796128-132796150 CTCAAGTTCTTGATATAAAATGG - Intronic
1091520705 12:1238823-1238845 ATCTTTTAGTTTATATAAAAAGG - Intronic
1091611331 12:2012486-2012508 ATCTAGTCCTTTACAGAAAAAGG + Intronic
1091642660 12:2249306-2249328 ATCTGCTTTTGTAAATAAAATGG + Intronic
1091872200 12:3903165-3903187 CTCAAGTTCCTTATATAAAATGG + Intergenic
1092624452 12:10311896-10311918 AGTTGGTTCTTCAAATAAAATGG - Intergenic
1092887059 12:12934084-12934106 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
1093756216 12:22854949-22854971 TTATAGTTCTTTATATGAAAGGG - Intergenic
1093897294 12:24588599-24588621 CTCAAGTTCCTTATATAAAATGG + Intergenic
1094111625 12:26868771-26868793 ATCAGGTTCTATATGTCAAAAGG + Intergenic
1094618591 12:32058768-32058790 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095342015 12:41101281-41101303 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095365843 12:41404002-41404024 CTGAAGTTCTTTATATAAAATGG + Intronic
1095412723 12:41941926-41941948 ACCTGGTTCTTTATCCATAAGGG - Intergenic
1095503657 12:42868583-42868605 GTGTGGTTTTTTAAATAAAAGGG + Intergenic
1095583439 12:43825574-43825596 ATCACGTTCTTTATGTCAAAGGG - Intergenic
1095809603 12:46357794-46357816 ATCTGGTTTTTTACTTAAGAAGG - Intergenic
1095813226 12:46393732-46393754 AGCTGGATTTTTATATACAAAGG - Intergenic
1096063455 12:48721157-48721179 ATCTGATTGTTTTTAAAAAATGG - Intergenic
1096165075 12:49415713-49415735 ATCTGGCCCTTTACAGAAAAAGG - Intronic
1097353026 12:58569965-58569987 GTCTGTTTCTTGATATCAAAAGG - Intronic
1097500811 12:60399154-60399176 ATCTGGTTAATGAAATAAAATGG + Intergenic
1097568515 12:61300909-61300931 ATCTGCTTGTCTATATAAAAAGG + Intergenic
1097655609 12:62358878-62358900 CTCAAGTTCTTGATATAAAATGG - Intronic
1097887820 12:64747677-64747699 ATCTGTTTCTTTTTTTATAATGG - Intronic
1097897078 12:64835472-64835494 AACTGGTTCTATATATATAATGG - Intronic
1098083396 12:66813898-66813920 TTCTGGTTGTTTATGGAAAATGG + Intergenic
1098360400 12:69648849-69648871 ATTTGGTACTTTATGTAGAAAGG - Intronic
1099852615 12:88121515-88121537 ATTTAGTTCTTTATTTCAAATGG - Intronic
1100153107 12:91765281-91765303 ATTTTTTTCTTTCTATAAAATGG + Intergenic
1100303648 12:93330626-93330648 AGCTGGTTCTTTACAGAAAAAGG + Intergenic
1101341207 12:103842542-103842564 CTCAAGTCCTTTATATAAAATGG + Intronic
1101420753 12:104548995-104549017 ACCTGGTCCTTCATATAGAATGG + Intronic
1101491477 12:105213810-105213832 TTCTGGGTCTTTACATCAAAAGG + Intronic
1102481565 12:113227301-113227323 ATCTGTTTCTTTTTTTAACAAGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104039801 12:125122323-125122345 ATCTGGTTCATGTTATTAAAAGG + Intronic
1104538394 12:129640185-129640207 ATCTGGCTCTTTCCAGAAAAAGG - Intronic
1105942899 13:25166183-25166205 ATCTGCTTATTTAAATACAAAGG - Intronic
1106061751 13:26299845-26299867 ATCTGGCCCTTTACAGAAAAGGG - Intronic
1106293100 13:28383922-28383944 CTCAAGTTCCTTATATAAAATGG - Intronic
1106543032 13:30706893-30706915 ATTTGGCTCTTTATGTTAAAAGG + Intergenic
1106847252 13:33749405-33749427 CTCAAGTTCCTTATATAAAATGG - Intergenic
1107170580 13:37338068-37338090 ATCAAGTCCCTTATATAAAATGG + Intergenic
1107274005 13:38656417-38656439 ATTAGGTTCTATATATTAAAAGG - Intergenic
1107914933 13:45139908-45139930 CTCAAGTCCTTTATATAAAATGG + Intronic
1107927290 13:45275276-45275298 ATCAAGTTCTGGATATAAAATGG + Intronic
1108101334 13:46959708-46959730 ATTTTGTTCTCTACATAAAAGGG + Intergenic
1108306861 13:49145658-49145680 ATCTGTTTATATAGATAAAATGG - Intronic
1108317008 13:49246749-49246771 ATATGGTTCTTTATATATTCTGG + Intergenic
1108531393 13:51330483-51330505 AGCTGATTGTTTATAAAAAATGG - Intergenic
1108681260 13:52782491-52782513 TTCTGGTCCTTTTTCTAAAATGG + Intergenic
1109058668 13:57583952-57583974 ATCTGTTTCTTCATAGAACAAGG - Intergenic
1109132484 13:58604803-58604825 ATCAGCTTCTGTATGTAAAAGGG - Intergenic
1109226784 13:59706051-59706073 CTCTAGTCCTTGATATAAAATGG + Intronic
1109384032 13:61604085-61604107 ATATGGCTCTTTACATCAAAAGG + Intergenic
1110858568 13:80323355-80323377 ATAAGGTACTTTATTTAAAAGGG + Intergenic
1111377007 13:87393464-87393486 ATCTGCTTGGCTATATAAAAAGG + Intergenic
1111473663 13:88718664-88718686 ATCAAGTTCCTTACATAAAATGG + Intergenic
1111547854 13:89767290-89767312 CTCAAGTTCTTTGTATAAAATGG + Intergenic
1111827347 13:93284150-93284172 ATCTGATTTTATATTTAAAAGGG + Intronic
1111858328 13:93669084-93669106 ATCTTCTTGTTTATAAAAAATGG - Intronic
1112555505 13:100464602-100464624 ATTTGGTTTTTCAAATAAAAGGG - Intronic
1112577449 13:100648433-100648455 ATCTGTTTCTTTTTATAACGCGG + Intronic
1113126419 13:106984240-106984262 ATCTGTTTCTCAAAATAAAAGGG + Intergenic
1113356700 13:109587995-109588017 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1114387691 14:22272029-22272051 ATGTGGTTCTTTCTTTATAAAGG + Intergenic
1114592865 14:23884146-23884168 ATTTGGCTCTTTACATCAAAAGG + Intergenic
1115246480 14:31300895-31300917 AACTGGTTTTTTTTAAAAAATGG - Intronic
1115448138 14:33515621-33515643 ATCTGGTCCTTTACAGGAAAAGG + Intronic
1115948171 14:38688112-38688134 ATAAGGTTCTTTATATGAAGTGG + Intergenic
1116171108 14:41403852-41403874 ATCTGCTTGGCTATATAAAACGG + Intergenic
1116706186 14:48304646-48304668 ATTTGGTTCTTTATGTCAAAAGG + Intergenic
1117838319 14:59830632-59830654 ATCTGGCTCTTAATTTGAAAAGG - Intronic
1118037642 14:61885274-61885296 CTCAGTTTCTTTATCTAAAAAGG + Intergenic
1118611966 14:67548363-67548385 ATCTGCTTCTTTATGCCAAAAGG + Intronic
1118658719 14:67983291-67983313 ATTGGTCTCTTTATATAAAAAGG + Intronic
1118686800 14:68299540-68299562 CTCAAGTCCTTTATATAAAATGG - Intronic
1119358262 14:74025265-74025287 ATCTGCCTCCTTATATCAAAGGG + Intronic
1119911526 14:78353842-78353864 TTCTGGTTCCTCATAGAAAAAGG + Intronic
1120401374 14:84036748-84036770 ATCTGCATCTTTAAAAAAAAGGG + Intergenic
1120656386 14:87195195-87195217 ATATGGATATTTATATATAATGG - Intergenic
1122050097 14:99052339-99052361 ATCTGGTCCTCTACAGAAAATGG - Intergenic
1122085178 14:99295717-99295739 ATCTGATGGTTTTTATAAAAAGG + Intergenic
1122446687 14:101774833-101774855 ATCTGGCCCTTTACAGAAAAAGG - Intronic
1122617545 14:103030297-103030319 ATCTGGTTCTTTTAAAAAAGAGG + Intronic
1123768876 15:23509348-23509370 ATCTGGTTTTTTATCTATCATGG + Intergenic
1124032260 15:26022354-26022376 ATTTGGGTCTTTATGTCAAAAGG + Intergenic
1124076003 15:26444727-26444749 ATTTGGGTCTTTATTTCAAAAGG + Intergenic
1124527290 15:30468748-30468770 ATTTGTTTTTTTATATAAATAGG - Intergenic
1124771363 15:32538935-32538957 ATTTGTTTTTTTATATAAATAGG + Intergenic
1126031379 15:44502475-44502497 AACTGGCCCTTTATAGAAAAAGG - Intronic
1126073894 15:44889757-44889779 CTCTGTCTGTTTATATAAAAAGG + Intergenic
1126084298 15:44997106-44997128 CTCTGTCTGTTTATATAAAAAGG - Intergenic
1126949769 15:53868353-53868375 CTATGGTTCTTTATAACAAAAGG + Intergenic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1127558616 15:60113132-60113154 ATCTAGTTCTTAATCTTAAAAGG - Intergenic
1127745608 15:61968433-61968455 CTCAAGTTCCTTATATAAAATGG - Intronic
1129015823 15:72467957-72467979 CTCAAGTTCCTTATATAAAATGG - Intergenic
1129041777 15:72693450-72693472 ATCTGGCCCTTTACAAAAAAAGG - Intronic
1130178873 15:81605482-81605504 TTCTGGTTGTGTGTATAAAATGG - Intergenic
1130690029 15:86074285-86074307 ATTTAGCTCTTTATATACAAGGG + Intergenic
1131181866 15:90245757-90245779 ATATGTTTCTCCATATAAAAAGG + Exonic
1131297664 15:91165526-91165548 CTCAAGTTCTTTATATTAAATGG - Intronic
1131334859 15:91539104-91539126 ATCTGGCCCTTTACAGAAAATGG + Intergenic
1131757631 15:95582828-95582850 ATTTGTCTCTTTATAAAAAAGGG - Intergenic
1131886011 15:96913694-96913716 CACTGGCTCTGTATATAAAAAGG + Intergenic
1132105660 15:99060701-99060723 CTCAAGTTCCTTATATAAAATGG - Intergenic
1132394413 15:101461891-101461913 ATCTTGTTCTTGATTTTAAAGGG - Intronic
1133210380 16:4260341-4260363 CTCTGCTTCTTAATATAAAGGGG - Intronic
1134288782 16:12886467-12886489 ATCTGGTTCTTTAAAAGGAAAGG + Intergenic
1135240498 16:20803005-20803027 AACTGGTTGTTTAATTAAAATGG - Intronic
1135817626 16:25650057-25650079 ATGTGATTCTATATATAGAAGGG - Intergenic
1135853431 16:25985135-25985157 ATCTGTTTCCTTATTTAAATAGG + Intronic
1136612330 16:31373747-31373769 ATCTAGCCCTTTATAGAAAAAGG - Intronic
1137842812 16:51655607-51655629 ATCAGCTTCTTTATTTATAAAGG + Intergenic
1138364594 16:56463981-56464003 ATTTGGTCCTTTATAGCAAAAGG + Intronic
1138367551 16:56493517-56493539 AACTGGTTATTTATAGTAAAAGG + Intronic
1138801532 16:60036342-60036364 ATCTGGCTCTCTAAATAGAATGG + Intergenic
1138883572 16:61047447-61047469 ATCTATTGCTTTATATATAAAGG - Intergenic
1139787509 16:69405809-69405831 CTCTTTTTCTTTATATATAATGG - Intronic
1140223605 16:73061832-73061854 AGCTTGTTTCTTATATAAAACGG + Intergenic
1141055565 16:80810636-80810658 CTCTGCTTCTTTATAGCAAAAGG - Intergenic
1141508173 16:84494544-84494566 AAATGGTTCTGTATATAAATAGG - Intronic
1141769386 16:86080004-86080026 CTCAGGTCCTTCATATAAAACGG + Intergenic
1144114218 17:12070798-12070820 ATCTGGTTCTTTACAGAAAAAGG + Intronic
1144149188 17:12427225-12427247 CTCAGGTCCCTTATATAAAATGG - Intergenic
1144265496 17:13564449-13564471 CTCAAGTTCCTTATATAAAATGG + Intronic
1145406171 17:22597704-22597726 ATCTGTTTGGCTATATAAAAGGG - Intergenic
1145820553 17:27830886-27830908 TTCTGCCTCTTTATTTAAAAAGG - Intronic
1145821388 17:27838936-27838958 TTCTGCCTCTTTATTTAAAAAGG + Intronic
1146191663 17:30773080-30773102 ATATGCTGATTTATATAAAAGGG - Intronic
1146336833 17:31979748-31979770 ATATGCTGATTTATATAAAAGGG - Intronic
1146966087 17:37031352-37031374 CTCAAGTTCCTTATATAAAATGG - Intronic
1147678768 17:42225588-42225610 CTCAAGTTCCTTATATAAAATGG + Intronic
1148182594 17:45617583-45617605 AGCTGGTTTTTTTTTTAAAAGGG - Intergenic
1148919829 17:51020785-51020807 CTCAGGTCCCTTATATAAAATGG + Intronic
1149784256 17:59422189-59422211 ATCTTCTTATGTATATAAAAGGG - Intergenic
1151153746 17:72109998-72110020 ATCTGGATCAAGATATAAAAAGG + Intergenic
1153281487 18:3418426-3418448 CTCAAGTTCATTATATAAAATGG + Intronic
1153763060 18:8350244-8350266 ATTTGGCTCTTTACATCAAAAGG - Intronic
1154027184 18:10719032-10719054 ATGAGGTTCTTTATAGAAAATGG + Intronic
1155707416 18:28834062-28834084 AGCTGAATCTTTATATAAATAGG + Intergenic
1156247831 18:35319503-35319525 ATGTGTTTTTTTTTATAAAAAGG + Intergenic
1156659629 18:39331495-39331517 CTCACGTTCCTTATATAAAATGG + Intergenic
1157247583 18:46068262-46068284 CTCAGATTCTTTCTATAAAATGG - Intronic
1157766432 18:50300789-50300811 TTTTGCTTATTTATATAAAAGGG + Intergenic
1158781757 18:60661057-60661079 CTCAGGTTCCTTATATAAAGTGG + Intergenic
1159231384 18:65611451-65611473 ATCTGCTTGGCTATATAAAAGGG + Intergenic
1161909716 19:7184108-7184130 ATCTGGTCCTTTAGAGAAAAAGG + Intronic
1162599085 19:11653575-11653597 CTCAAGTGCTTTATATAAAATGG + Intergenic
1162878642 19:13640115-13640137 TTCTGGTCCTTTATATAAAAAGG - Intergenic
1163839973 19:19601513-19601535 ATATGGTACTTTACAAAAAATGG + Intronic
1164541888 19:29127657-29127679 ATCTAGTTTGTTAAATAAAACGG - Intergenic
1164879306 19:31717655-31717677 TTCTCCTGCTTTATATAAAAAGG - Intergenic
1165041815 19:33073783-33073805 ATTTTGTACTTTATATAAAATGG - Intergenic
1165195315 19:34097952-34097974 CTCAAGTCCTTTATATAAAATGG + Intergenic
1166453615 19:42921680-42921702 AGCTAGTTCTTTATATTAACTGG + Intronic
1166527655 19:43522929-43522951 ATCTGGTCCTTCACAGAAAAAGG + Intronic
1167401317 19:49272626-49272648 ATATGATTCTGTATATAAAAAGG + Intergenic
1168433515 19:56300243-56300265 ATCTGCTTGGCTATATAAAAGGG - Intronic
925664896 2:6242340-6242362 CTCAGGTCCTTTGTATAAAACGG - Intergenic
926512753 2:13802946-13802968 CTCAAGTTCCTTATATAAAACGG + Intergenic
926546969 2:14254279-14254301 ATGAAGTTCTTTAAATAAAAGGG - Intergenic
927456556 2:23255334-23255356 ATCTGGCTCTTTACAAATAATGG + Intergenic
927760305 2:25746968-25746990 CTCAAGTCCTTTATATAAAATGG + Intronic
928982072 2:37146378-37146400 CTCAAGTCCTTTATATAAAATGG - Intronic
929148705 2:38729087-38729109 CTCTAGTTCCTTCTATAAAATGG + Intronic
929842430 2:45482805-45482827 CTCAAGTCCTTTATATAAAATGG + Intronic
930062399 2:47301046-47301068 ATTTGGTGCTTTATGTGAAAAGG + Intergenic
930352362 2:50273299-50273321 AACTGGCTATTTATATAAACAGG - Intronic
930383346 2:50659935-50659957 ATCTGTTTTTTAATATAAAGCGG - Intronic
930445914 2:51472033-51472055 ATCTGCATCTTGAAATAAAAGGG - Intergenic
930705904 2:54504651-54504673 CTCAGGTCCCTTATATAAAATGG - Intronic
930917905 2:56716404-56716426 TTCAAGTTCTTTCTATAAAATGG - Intergenic
931008315 2:57878603-57878625 CTCTGTTTATGTATATAAAATGG - Intergenic
931265787 2:60659109-60659131 ACCTAGTTATTTAAATAAAATGG + Intergenic
931536474 2:63282829-63282851 TTCATGTCCTTTATATAAAATGG + Intronic
931747810 2:65305927-65305949 ATCTGATTCTGTATATGAAAGGG + Intergenic
931979455 2:67678704-67678726 ATCTTCTTGTTTACATAAAAAGG + Intergenic
932313337 2:70762029-70762051 CCCTTGTTCTTTAGATAAAAGGG - Intronic
933572483 2:84029677-84029699 ACCTGGTTGTTTATTTTAAAAGG + Intergenic
933999261 2:87692950-87692972 ATTTGGCTCTTTACATCAAAAGG + Intergenic
934050126 2:88202875-88202897 ACCTTGCTCTTTATATTAAATGG - Intergenic
934069523 2:88371096-88371118 CTCAAGTCCTTTATATAAAATGG + Intergenic
935016545 2:99187939-99187961 ATCTGGTCCTTTACAGAAAACGG + Intronic
935430713 2:102972964-102972986 ATCTGGTTCCTGATAGAATAGGG + Intergenic
936294588 2:111257941-111257963 ATTTGGCTCTTTACATCAAAAGG - Intergenic
936882169 2:117266790-117266812 CTCAAGTTCTTTATATAAAATGG - Intergenic
936966611 2:118133482-118133504 ACCTTGTTCTTTATTGAAAAGGG + Intergenic
937543482 2:122988428-122988450 ATCTGGCCCTTTACAAAAAAAGG - Intergenic
938677497 2:133653481-133653503 CTCTGGTTTCTTTTATAAAAGGG - Intergenic
939671329 2:145016292-145016314 ATCTGCTCCTCTATTTAAAAGGG - Intergenic
939736144 2:145849169-145849191 TAGTAGTTCTTTATATAAAATGG + Intergenic
940128162 2:150350958-150350980 ATCTATTTATTTATATAAATAGG + Intergenic
940228074 2:151421354-151421376 GTCTGGTTCTTTATCTACATGGG - Intronic
940710764 2:157160865-157160887 CTCAAGTTGTTTATATAAAATGG - Intergenic
940922903 2:159329355-159329377 CTCAGGTTCCTTATATAAAATGG - Intronic
941505237 2:166336036-166336058 CTCAAGTTCTTTACATAAAATGG - Intronic
941562736 2:167069062-167069084 CTCAAGTCCTTTATATAAAACGG + Intronic
941572048 2:167182675-167182697 CTCAGTTTCTTTCTATAAAATGG + Intronic
941618498 2:167750948-167750970 ATCTGGCCCTTTATAGAAAAAGG - Intergenic
941641106 2:167989407-167989429 AACTGGTTCTTTGGAGAAAATGG - Intronic
941822765 2:169858983-169859005 AACTGATTCATTATATACAAAGG - Intronic
941837717 2:170044572-170044594 ATTTAGTTCTTTATGTACAAGGG + Intronic
942361716 2:175179963-175179985 ATCTAGTTTTTTGGATAAAAGGG + Intronic
942647605 2:178130657-178130679 ATTTGGCACTTTTTATAAAAAGG + Intronic
942867839 2:180697925-180697947 ATGTGGTTATTTGTATAAGAGGG + Intergenic
942894831 2:181039817-181039839 CTCAAGTTCCTTATATAAAATGG + Intronic
943149030 2:184086402-184086424 CTCTAGTCCTTTATATAAAATGG - Intergenic
943272952 2:185830495-185830517 CTCAAGGTCTTTATATAAAATGG + Intronic
943311274 2:186328131-186328153 ATCTGTTTTGTTATATAAAAAGG + Intergenic
943487705 2:188507949-188507971 ATATAGTTCTGTATATATAAAGG + Intronic
943551227 2:189341944-189341966 ATCTTTTTCTTTAGATAATACGG - Intergenic
943574429 2:189614582-189614604 CTCAAGTTCTTTATATAAAATGG - Intergenic
943644570 2:190395937-190395959 ATATTGTTCTGTATATACAATGG + Intergenic
944462110 2:199960691-199960713 CTCAAGTCCTTTATATAAAATGG - Intronic
945079351 2:206073236-206073258 AACTTCTTCTTTATTTAAAAAGG - Intronic
945728417 2:213502431-213502453 ATGTGGTTCCTTGTATAAAAAGG - Intronic
946041619 2:216787715-216787737 ATCTGGTCTTTTACATAAAATGG + Intergenic
946641260 2:221785690-221785712 CTCACGTCCTTTATATAAAATGG + Intergenic
947341739 2:229147843-229147865 ATCTGATTCTCTATAGTAAAAGG + Intronic
947677799 2:232000056-232000078 CTCAGGTCCCTTATATAAAATGG + Intronic
948034759 2:234849022-234849044 ATCTGGGTCTCTATGGAAAAGGG - Intergenic
948419759 2:237849969-237849991 TTATGGTTATTTATATTAAAAGG + Intergenic
948573445 2:238933301-238933323 ATATGGTTCATTATATTAAAAGG + Intergenic
1168864200 20:1071053-1071075 TTCTGGTTCTTAATATCACAGGG + Intergenic
1168983574 20:2027614-2027636 CTCAAGTCCTTTATATAAAATGG + Intergenic
1169095214 20:2891779-2891801 CTCAGGTGCCTTATATAAAATGG + Intronic
1169306369 20:4494335-4494357 TTTTGGTTTTGTATATAAAAAGG + Intergenic
1169491745 20:6076946-6076968 CTCTTGTTTTTTCTATAAAATGG - Exonic
1169665346 20:8028157-8028179 GTGTAGTTCTTTATATCAAAGGG + Intergenic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1171162094 20:22936398-22936420 AAGTGGCTCATTATATAAAAGGG - Intergenic
1172827999 20:37806669-37806691 ATTTGGCTCTTTATATCAAAAGG + Intronic
1172945297 20:38683009-38683031 ATTTGGCTCTTTATATCAAAAGG + Intergenic
1174162662 20:48562826-48562848 ATCTGGCTCTTTCTGAAAAAGGG + Intergenic
1174512881 20:51068273-51068295 AGCTGGTTCTTGACAAAAAAGGG - Intergenic
1174562597 20:51442125-51442147 ATCTGCTTTTTAATATAACAGGG - Intronic
1174831347 20:53815249-53815271 ATTTGGTTCTTTACATCAAAAGG - Intergenic
1175013927 20:55768015-55768037 ATTTGGTTCTTCACAGAAAAGGG + Intergenic
1176981769 21:15390157-15390179 CTCAAGTCCTTTATATAAAATGG - Intergenic
1176997435 21:15572163-15572185 CTCAAGTTCCTTATATAAAATGG + Intergenic
1177834992 21:26178051-26178073 ATTTGGCTCTTTACATCAAAAGG - Intergenic
1177915342 21:27081965-27081987 ATCAAGTACCTTATATAAAATGG - Intergenic
1178008574 21:28254750-28254772 CTCAAGTCCTTTATATAAAATGG - Intergenic
1178068901 21:28939248-28939270 CTCAAGTTCCTTATATAAAATGG - Intronic
1179225460 21:39449050-39449072 ATTTGGCTCTTTATATCAACAGG - Intronic
1180241970 21:46515011-46515033 ATCTGGGTGTATATTTAAAAGGG - Intronic
1181349740 22:22246372-22246394 ACCTGGCTCTTTATAGAAAATGG - Intergenic
1181655182 22:24291764-24291786 ATCTGTTTCTTCATTTTAAAAGG - Intronic
1182942467 22:34290481-34290503 ATCTGCGTCTTTATATCTAAGGG - Intergenic
1184072937 22:42157269-42157291 CTCAGGTTCCTTATGTAAAATGG + Intergenic
1184599592 22:45535179-45535201 ATCTGGTACATCATAAAAAAAGG - Exonic
949236907 3:1820020-1820042 TTCTGGATATTCATATAAAATGG + Intergenic
949351003 3:3125312-3125334 TTCAAGTTCTTTACATAAAATGG - Intronic
949811745 3:8013631-8013653 ATTTGGCTCTTTACATCAAAAGG + Intergenic
950159367 3:10748095-10748117 ATCTGGCTCTTTACAGAAAAAGG - Intergenic
950961240 3:17110307-17110329 CTCAAGTTCTGTATATAAAATGG - Intergenic
951491837 3:23279551-23279573 ATTTGGTTCTTTGCATCAAAAGG + Intronic
951715299 3:25636519-25636541 ATCAAGTCCCTTATATAAAATGG - Intronic
951920317 3:27847579-27847601 CTCAAGTCCTTTATATAAAATGG - Intergenic
952396719 3:32927488-32927510 CTCAGGTTCCTTACATAAAATGG + Intergenic
952664298 3:35885897-35885919 ATTAGTTTCTTTATAAAAAATGG - Intergenic
953854470 3:46490220-46490242 ATCTGGCTCTTTACAGAAAGAGG - Intergenic
954101404 3:48375518-48375540 ATCCTGTTCTATATATGAAACGG + Intronic
954922092 3:54200057-54200079 ATCTGGCCCTTTATAGGAAAAGG + Intronic
955747328 3:62153160-62153182 CTTTGGTACTTTATAGAAAACGG + Intronic
955827222 3:62961296-62961318 CTCAGGTCCTGTATATAAAATGG - Intergenic
956069216 3:65429944-65429966 AATTGGTTCTTTATCCAAAATGG + Exonic
956634206 3:71347178-71347200 ATTTGGTTCTTTCTTTAAGAAGG + Intronic
956797675 3:72731243-72731265 ATCTGGACCTTTACAGAAAAAGG - Intergenic
956798412 3:72736348-72736370 ATCTGGACCTTTACAGAAAAAGG - Intergenic
957284029 3:78193404-78193426 CTCAAGTTCTTTGTATAAAATGG - Intergenic
957351639 3:79030681-79030703 ATCTAGAGCTTTATATAAAGAGG + Intronic
957608615 3:82437329-82437351 ATCTGGCACTTTACAGAAAAAGG - Intergenic
957643513 3:82888396-82888418 AGTGGGTTCATTATATAAAAGGG - Intergenic
957962098 3:87269354-87269376 GTCTGGTTCTTTACAGAAAAGGG + Intronic
958534380 3:95379343-95379365 ATCTGCTTTGTTATATCAAAGGG + Intergenic
958541512 3:95481227-95481249 CTCTGGTTCCTTCTATAAAATGG + Intergenic
958724529 3:97888272-97888294 GTCTGGTTCTGTAAGTAAAAAGG - Intronic
959137603 3:102443832-102443854 TTCTGGTTCTCTGTATAGAAAGG + Intronic
959201018 3:103247406-103247428 ATCTTGTTTTTAATATAAACAGG - Intergenic
959651884 3:108758137-108758159 ATCTTGCTCTTAAAATAAAAAGG - Intergenic
960033343 3:113077662-113077684 CTCTAGTTCCTTTTATAAAATGG + Intergenic
960119860 3:113936873-113936895 ATCTGAGTTTTTATATAAAAAGG - Intronic
960434993 3:117615191-117615213 CTCTGGTTCTTAATTTAATAAGG - Intergenic
960438983 3:117663550-117663572 CTCAAGTCCTTTATATAAAATGG + Intergenic
960444166 3:117727179-117727201 ATCTGTTACTTTTTATAATACGG + Intergenic
960953726 3:123016369-123016391 TTCAAGTTCCTTATATAAAATGG + Intronic
960963446 3:123088679-123088701 CTCAAGTCCTTTATATAAAATGG + Intronic
961742670 3:129043135-129043157 ATCTGGATCTATATAAAGAAAGG + Intergenic
961800224 3:129442045-129442067 ATCTGGGTTTTTATGTGAAATGG + Intronic
963283557 3:143411298-143411320 ATTTGGTCCTTTAGATTAAAAGG - Intronic
964063151 3:152549934-152549956 TTTTAGTTCTTTATATAAAATGG + Intergenic
964313687 3:155420939-155420961 GTCTGGGTCTTTAAATCAAATGG - Intronic
964516889 3:157520559-157520581 CTCTGGTTCTTTATAAGCAATGG + Intronic
964566730 3:158064114-158064136 ATTTGGTTTTTAAAATAAAATGG - Intergenic
964770079 3:160215455-160215477 CTCAAGTCCTTTATATAAAATGG + Intergenic
965330897 3:167373277-167373299 CTCAGGTTCCTTATATAAAATGG - Intronic
965452552 3:168856868-168856890 ATCTGTGTCTTTGTATTAAAGGG + Intergenic
965682109 3:171262225-171262247 ATCTGGTTGTTTTATTAAAAAGG - Intronic
966284464 3:178277566-178277588 ATCTGGTGTTTTACAGAAAAAGG - Intergenic
966706517 3:182922232-182922254 ATCTGTTTTTATATTTAAAAAGG + Intergenic
966980047 3:185124175-185124197 CTCAAGTTCCTTATATAAAAGGG - Intronic
967083339 3:186071018-186071040 AACTAGTTCTTTAAATAAACTGG - Intronic
967147640 3:186619701-186619723 ATATGATTCTATATATAACATGG - Intronic
967371654 3:188753174-188753196 ATCAGGTTTCTTATCTAAAAAGG + Intronic
967476794 3:189930819-189930841 CTCAAGTTCCTTATATAAAATGG + Intergenic
967960666 3:194920795-194920817 ATCTGAGTCTTTATATTTAAAGG + Intergenic
968159471 3:196413807-196413829 CTCAAGTTCTTCATATAAAATGG + Intronic
969385986 4:6848591-6848613 TTCAAGTTCCTTATATAAAATGG - Intronic
970161953 4:13198036-13198058 CTCTGGTTCCTTATCTAGAAAGG - Intergenic
970813177 4:20120625-20120647 ATCTGGTTGTGCATATATAATGG + Intergenic
971111799 4:23593286-23593308 CTCATGTTCCTTATATAAAATGG - Intergenic
971131454 4:23815418-23815440 ATGTTGTGCTCTATATAAAATGG - Intronic
971304124 4:25465489-25465511 ATCTGATTGTGTATATAACATGG + Intergenic
971638560 4:29098038-29098060 CTCTTGTTCTTTACAGAAAAGGG + Intergenic
973628831 4:52799475-52799497 CTCAAGTTCCTTATATAAAATGG - Intergenic
973839767 4:54849475-54849497 ATCTAATTCTTTCTCTAAAATGG - Intergenic
974374987 4:61064536-61064558 AACTGGTGCTTCAGATAAAAGGG + Intergenic
974600465 4:64073133-64073155 ACCTGATTCTATTTATAAAAAGG - Intergenic
975257218 4:72252308-72252330 AAATAGTTTTTTATATAAAAAGG + Intergenic
975319597 4:72995231-72995253 CACTGTTTCTTTTTATAAAATGG - Intergenic
975821872 4:78279081-78279103 ATGTGTTCCTTTACATAAAATGG + Intronic
975939661 4:79627595-79627617 ATGTGTTTCTTTCTAGAAAAAGG + Intergenic
976505895 4:85846997-85847019 AACTGGTTCTATAAACAAAAGGG + Intronic
977357037 4:95959451-95959473 ATCTGATTATTTAAATAAGATGG + Intergenic
977407262 4:96615806-96615828 ATGTCGTTCTTTATATATATTGG - Intergenic
977472999 4:97465629-97465651 TTCAGGTTCCTGATATAAAATGG + Intronic
978000248 4:103548429-103548451 TTCAAGTGCTTTATATAAAATGG + Intergenic
978037871 4:104018820-104018842 ATTTCTTTTTTTATATAAAAAGG + Intergenic
978101476 4:104846714-104846736 TTCTGGTTGTTTATCAAAAATGG - Intergenic
978345417 4:107762956-107762978 TTTGGGTTCCTTATATAAAATGG - Intergenic
978844988 4:113262789-113262811 CTCAAGTCCTTTATATAAAATGG - Intronic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
979651321 4:123135745-123135767 CTCAAGTCCTTTATATAAAATGG - Intronic
979873229 4:125852367-125852389 ATCTTATTATTTATATAAATAGG - Intergenic
980281232 4:130722878-130722900 ATTTGATTCATTATACAAAATGG + Intergenic
980696993 4:136370705-136370727 CTCAAGCTCTTTATATAAAATGG - Intergenic
980716021 4:136631054-136631076 ATCTGTTTGGCTATATAAAAGGG - Intergenic
980725043 4:136747823-136747845 ATATAATTCTGTATATAAAATGG - Intergenic
981582830 4:146267712-146267734 ATATGATTCTTTGTATGAAAAGG - Intronic
982080392 4:151783949-151783971 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
982588474 4:157273204-157273226 CTCTAGTGCATTATATAAAATGG - Intronic
982743713 4:159084612-159084634 ATATGATTCCTTATATAATAGGG - Intergenic
983079149 4:163364167-163364189 ATCTGCCTATTTTTATAAAATGG - Intergenic
983090806 4:163499589-163499611 CTCAGGTCCCTTATATAAAATGG + Intronic
983498197 4:168468565-168468587 ACCTGGTTCTTGATCTTAAAGGG - Intronic
983752234 4:171289301-171289323 TTCTTGTTCTTTATTTAAAGGGG - Intergenic
984389045 4:179103439-179103461 GTCTGCTTCTGTATACAAAATGG + Intergenic
984774594 4:183469943-183469965 ATCTTAATCTTTATATATAAGGG - Intergenic
985846407 5:2352854-2352876 TTCTGATTTTTTATATAAACTGG + Intergenic
986057284 5:4150934-4150956 CTCAAGTCCTTTATATAAAATGG - Intergenic
986398796 5:7358852-7358874 CTCAAGTTCCTTATATAAAATGG - Intergenic
986694776 5:10341946-10341968 ATCAAGTTCCTTATATAAAATGG + Intergenic
987019946 5:13859968-13859990 CTCTGGTTTTTCATATAATATGG + Intronic
987187192 5:15434908-15434930 ATCTGTGTCTTTAGATATAATGG - Intergenic
987227586 5:15859619-15859641 ATCTGATTGTTTTTATAAAAGGG - Intronic
987434611 5:17879385-17879407 ATCTCTTTCTGTAAATAAAATGG - Intergenic
987753749 5:22073756-22073778 ATCTGATTCTTTAAATACAAGGG + Intronic
988028503 5:25731147-25731169 CTCTATTTCCTTATATAAAATGG - Intergenic
988151351 5:27385906-27385928 CTCAAGTCCTTTATATAAAATGG + Intergenic
988392740 5:30657124-30657146 ATGAGGTTATTTATTTAAAATGG - Intergenic
989222571 5:38985217-38985239 CTCAAGTCCTTTATATAAAATGG + Intronic
989752046 5:44906732-44906754 ATCTGCTTGTCTATTTAAAAAGG + Intergenic
990917395 5:60924558-60924580 ATCTGGAACTTTATATAAGAGGG - Intronic
991514452 5:67418793-67418815 ATCTGGTTCTTTATTTATGTAGG + Intergenic
991913101 5:71581022-71581044 CTCAAGTCCTTTATATAAAATGG + Intergenic
992259808 5:74958383-74958405 ATATGGTTCTTTGTGTAACATGG - Intergenic
992291019 5:75280254-75280276 ATGTGGCTCTTTATATAACATGG - Intergenic
992536587 5:77711321-77711343 ATCTGGTCCTTTACAAAAAAGGG + Intronic
992629143 5:78664127-78664149 CTCAAGTCCTTTATATAAAATGG - Intronic
992706187 5:79395616-79395638 AACAGATTCCTTATATAAAATGG - Intronic
993191806 5:84692722-84692744 ATGTGCTACTTTATATGAAATGG - Intergenic
993213790 5:84992683-84992705 ATTTGATTCTTTATATAAGGGGG + Intergenic
993355270 5:86898788-86898810 CTCAAGTCCTTTATATAAAATGG - Intergenic
993557657 5:89361619-89361641 ATTTGGCTCTTTACAGAAAAGGG + Intergenic
993766960 5:91871942-91871964 ATCTTGTTTTATATATTAAAGGG - Intergenic
994269387 5:97759184-97759206 ATATGGTTCTTTATATATTATGG - Intergenic
994342913 5:98653042-98653064 AACTGGTTCCTCAAATAAAATGG + Intergenic
994862143 5:105210347-105210369 CTCACGTCCTTTATATAAAATGG - Intergenic
995025696 5:107419333-107419355 AACTCATTCTTTAAATAAAAAGG + Intronic
995178572 5:109208286-109208308 GTTTGGATCTTTATATAAATGGG - Intergenic
995235042 5:109818960-109818982 CTCAAGTCCTTTATATAAAATGG + Intronic
995610798 5:113908670-113908692 ATATGGTTTTAAATATAAAATGG - Intergenic
996078097 5:119221665-119221687 ATCCAGTCCTTTATAAAAAAAGG + Intronic
996712218 5:126554524-126554546 ATCTGGTTCTTTATGGAAAAAGG - Intronic
996852714 5:127970497-127970519 ATTTGGTTCTCTATAGAAAAAGG - Intergenic
997101262 5:130971572-130971594 AGCTGGTTGTTTAAATAACATGG - Intergenic
997477204 5:134150540-134150562 ATCTAGTTAATTGTATAAAAAGG + Exonic
997684848 5:135781371-135781393 ATCTGGTTCATAATATACAGGGG + Intergenic
997686304 5:135789717-135789739 ATATGGTTCTTAATATTAAGGGG + Intergenic
998318197 5:141202950-141202972 ACCTGTTACTTAATATAAAAAGG - Exonic
998354561 5:141524226-141524248 ATCTTGTTCTTTATAACAGAGGG - Exonic
998936234 5:147233531-147233553 ATATGGTTCCTGATATAAAGGGG + Intergenic
999563571 5:152832675-152832697 TTCAAGTTCCTTATATAAAATGG - Intergenic
1000376886 5:160590985-160591007 GTCTGGAACTTTATATAAAAAGG + Intronic
1000800377 5:165719314-165719336 TTCTGTTTTTTTCTATAAAAAGG - Intergenic
1000886523 5:166753970-166753992 ATCTGGCCCTCTATAGAAAAAGG - Intergenic
1001006321 5:168053701-168053723 CTCAAGCTCTTTATATAAAATGG - Intronic
1001050807 5:168412870-168412892 CTCAAGTGCTTTATATAAAATGG - Intronic
1001355167 5:171014206-171014228 ATCTATGTCTTTATATAAATAGG + Intronic
1002375935 5:178789217-178789239 ATCTGGTTCATGTTATTAAAAGG - Intergenic
1002884829 6:1284034-1284056 GGCTGGTCCTTTATATAAACTGG + Intergenic
1003131353 6:3397841-3397863 ATATGGTTCTTTCTAAAAAGAGG + Intronic
1003197479 6:3927992-3928014 ATTTGGTTCTTTTTATTAACTGG - Intergenic
1003224967 6:4195372-4195394 CTCAGGTTCCTGATATAAAATGG - Intergenic
1003379496 6:5610572-5610594 CTCAGGTCCCTTATATAAAATGG - Intronic
1004013127 6:11708491-11708513 ATCTGGCTCTCCATATGAAATGG + Intergenic
1004987985 6:21104449-21104471 ATCTGGCCCTTTATAGAGAAAGG - Intronic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005093033 6:22079157-22079179 ATCTGGACCTTTACATAAAAAGG - Intergenic
1005254584 6:23987292-23987314 ATCAGGTTCTGTATTTGAAATGG - Intergenic
1005335263 6:24789786-24789808 ATGAAGTTCTTTATATTAAAGGG + Intergenic
1006560157 6:34904116-34904138 CTCAAGTCCTTTATATAAAATGG + Intronic
1006656727 6:35601239-35601261 TTTTGGTTTTTTATATAAACTGG - Intronic
1006998568 6:38286181-38286203 ATGTGGCCCTTTATAAAAAAGGG + Intronic
1007002181 6:38324276-38324298 ATCTGTTTCCTTAAATAAAATGG - Intronic
1008031239 6:46697119-46697141 ATTTTGTACTTTATATTAAATGG + Intronic
1008288559 6:49684212-49684234 CTCAAGTCCTTTATATAAAATGG + Intergenic
1008795874 6:55302397-55302419 CTCAGGTCCCTTATATAAAATGG + Intergenic
1009285760 6:61814902-61814924 CTCAAGTTCCTTATATAAAATGG + Intronic
1009365034 6:62851385-62851407 ATATGGTTTTTAATATTAAAAGG + Intergenic
1009419443 6:63449056-63449078 CTCAAGTTCCTTATATAAAATGG - Intergenic
1009485947 6:64221777-64221799 ATCAAGTTTCTTATATAAAATGG - Intronic
1009782715 6:68291612-68291634 ATCTGGTTCTTCAAGTCAAAGGG - Intergenic
1009809478 6:68641893-68641915 ATATGGTAGTTTATTTAAAATGG - Intronic
1009868633 6:69429445-69429467 ATGTGGTTCTTTAGAAAAAAGGG + Intergenic
1010292038 6:74148407-74148429 TTCTGTTTCTTTATATAATGAGG + Intergenic
1012819891 6:104072914-104072936 CTCAAGTCCTTTATATAAAATGG + Intergenic
1012889046 6:104878455-104878477 ATCTATTTCTTTATATGACATGG + Intergenic
1013088968 6:106882150-106882172 ATCTGGAATTTTATTTAAAAAGG + Intergenic
1013200903 6:107894999-107895021 ATCTGGATGTTTAAAGAAAAAGG + Intronic
1013922243 6:115420057-115420079 ATCTTGATGTTTATATAAATAGG + Intergenic
1014030055 6:116690789-116690811 CTCAGGTCCTTTATGTAAAATGG + Intronic
1014203995 6:118635985-118636007 ATCTGGCTCTTGACAGAAAAAGG - Intronic
1014399970 6:120976154-120976176 ATTAGGTTCTATACATAAAAAGG - Intergenic
1014508996 6:122297251-122297273 TTCTAGTTTTTTATTTAAAATGG + Intergenic
1014794546 6:125709554-125709576 ATCTGTGTCTTCATATAAAGTGG + Intergenic
1014905211 6:127017744-127017766 ATCAAGATCTTTATACAAAAAGG + Intergenic
1015300488 6:131647824-131647846 ATCTCATTATTTATTTAAAAGGG + Intronic
1015328739 6:131952704-131952726 ATCACTCTCTTTATATAAAATGG - Intergenic
1016689476 6:146919971-146919993 AGCTGGTTATATAAATAAAAAGG - Intergenic
1016736730 6:147487739-147487761 ATCTGGTCTTTTACAGAAAAAGG + Intergenic
1016764265 6:147774430-147774452 CTCAGGTTCCTTATATAAAATGG + Intergenic
1017468170 6:154714392-154714414 TTCTGGTTATTTATACAAGAGGG + Intergenic
1017714933 6:157202840-157202862 ATATATTTCTATATATAAAATGG - Intronic
1017797556 6:157860101-157860123 ATCTGGTCCTGTACAGAAAAAGG + Intronic
1018276353 6:162135848-162135870 ATTTTGTTCTTTAAATAAAGTGG - Intronic
1018379834 6:163248717-163248739 ATGTGCTTCTTTCTAGAAAAAGG + Intronic
1018858313 6:167691314-167691336 ATCTGGTGCTTTATTTAAACCGG - Intergenic
1018938642 6:168292391-168292413 ACCTGGTTCTTTAGAAAAACGGG + Intergenic
1020762206 7:12282520-12282542 ATCTGGTTGACTATATAAAGGGG + Intergenic
1020859841 7:13477954-13477976 ATCTGGATATTTATTTAGAAAGG - Intergenic
1021115296 7:16739991-16740013 ATCTGGTTGATGATATAAGAGGG + Intergenic
1021348732 7:19561696-19561718 ATCTGATTCTTCATAAAAACTGG - Intergenic
1021677407 7:23095705-23095727 AAGTGATTTTTTATATAAAAAGG - Intergenic
1021779203 7:24085482-24085504 ATCTGTTTCTTTAAATAGAGGGG + Intergenic
1021812719 7:24419031-24419053 ATCTGGATCTTTATGTGAGAGGG - Intergenic
1021860829 7:24904563-24904585 TTCAGGTTCCTGATATAAAATGG - Intronic
1022012784 7:26323466-26323488 TTTTTGCTCTTTATATAAAAAGG + Intronic
1022016400 7:26352657-26352679 ATGTGGTTCATTTTTTAAAAAGG - Intronic
1022528994 7:31055399-31055421 ATCTGGCACTTTACAGAAAAAGG - Intronic
1023179198 7:37464427-37464449 ATCTGTTTCTTTATCTTCAAAGG + Intergenic
1023255683 7:38310327-38310349 ATTTGGTCCTTTAAAGAAAAAGG - Intergenic
1023506668 7:40906686-40906708 TTCGAGTCCTTTATATAAAACGG - Intergenic
1023535557 7:41205321-41205343 CTCTGGCTCTTTACAGAAAAAGG - Intergenic
1024284120 7:47742443-47742465 ATCAAGTTGTTTATATACAACGG - Intronic
1024320835 7:48067644-48067666 ATCTGGTTCTTGATCTTAGAGGG - Intergenic
1024748589 7:52436115-52436137 ATCAGGTTTTTTTTTTAAAAAGG + Intergenic
1024949743 7:54847741-54847763 CTCAAGTTCTTTATATGAAATGG - Intergenic
1024951372 7:54864159-54864181 AGCTGGGTCTTTATACACAAAGG - Intergenic
1025143865 7:56488070-56488092 ATCTGGTTCTGTATATATTTTGG + Intergenic
1027586886 7:80068945-80068967 CTCAAGTACTTTATATAAAAAGG - Intergenic
1028169817 7:87582588-87582610 ATCTGGCCCTTTATAGAAAAAGG - Intronic
1028189409 7:87827649-87827671 TTCTGTTTCCTTATATAAAGGGG - Intronic
1028194131 7:87885771-87885793 GTCTGGTCCTTTGCATAAAAAGG + Intronic
1028299980 7:89186626-89186648 ATCTTCTTTTGTATATAAAAGGG + Intronic
1028507077 7:91582579-91582601 CTCAAGTTCCTTATATAAAATGG - Intergenic
1028535267 7:91884646-91884668 ATTTGGTCCTTTATAGGAAAAGG - Intergenic
1028660273 7:93264029-93264051 CTCAAGTTCTTTATATAAAATGG - Intronic
1029131645 7:98335880-98335902 ATTTGGTTCAGTATAAAAAATGG - Intronic
1030413081 7:109206223-109206245 CTCAAGTTCTTCATATAAAATGG - Intergenic
1030574946 7:111273914-111273936 ATATAGTTCTTAATAAAAAATGG - Intronic
1030717525 7:112827573-112827595 TTCAAGTCCTTTATATAAAATGG + Intronic
1031063845 7:117082706-117082728 GTCTGGCTCTTTACAGAAAAGGG - Intronic
1031188876 7:118520458-118520480 ATCGGCTTATCTATATAAAAGGG - Intergenic
1031932641 7:127701751-127701773 CTCGAGTCCTTTATATAAAATGG + Intronic
1032004524 7:128289845-128289867 ATCTGGTGCTATGTATAAAGAGG + Intergenic
1032091149 7:128912281-128912303 CTCTGATTCTTTCTGTAAAATGG - Intergenic
1032895198 7:136242479-136242501 ATCTGGTTTTTTTTAACAAATGG + Intergenic
1033287533 7:140055371-140055393 ATCAGGATCTTAATATAAAAAGG + Intronic
1033725727 7:144115723-144115745 ACCTTGTCCTTTATATTAAATGG - Intergenic
1036037674 8:5037827-5037849 CTCAAGTTCCTTATATAAAATGG + Intergenic
1037476188 8:19259988-19260010 ATCTGCTGCTTTATTTAAAAAGG + Intergenic
1038882109 8:31626206-31626228 GTTTGCTGCTTTATATAAAATGG + Intergenic
1038904808 8:31888665-31888687 ATCTGTTTTTTTTTATGAAAAGG + Intronic
1039126971 8:34214740-34214762 ATCTGGACCTTTACACAAAAAGG + Intergenic
1039294476 8:36134518-36134540 ATCTGTTTCTTTATGAATAAGGG + Intergenic
1039337022 8:36602526-36602548 ATATGGCTCTTTATGTCAAAAGG - Intergenic
1039365033 8:36920243-36920265 CTCAAGTCCTTTATATAAAATGG + Intronic
1039564804 8:38543649-38543671 ATATGGTTGTTTAAATAAGATGG + Intergenic
1040859868 8:51988223-51988245 ATTTGGTTCTTTACATCAAAAGG - Intergenic
1041142513 8:54837745-54837767 GTCTGGTCCTTTACAGAAAAAGG - Intergenic
1041451517 8:58011456-58011478 ATTTGGCTCTTTATGTCAAAAGG - Intronic
1041595555 8:59646630-59646652 CTCAAGTTCCTTATATAAAATGG + Intergenic
1041780304 8:61571396-61571418 CTCAGGTTCCTGATATAAAATGG + Intronic
1042296691 8:67226488-67226510 CTCGGTTTCTTGATATAAAATGG + Intronic
1042401499 8:68353895-68353917 CTCAAGTTCCTTATATAAAATGG - Intronic
1042469449 8:69167474-69167496 ATCTGGCTGTTTACATCAAAAGG + Intergenic
1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG + Intergenic
1043570578 8:81598439-81598461 AGCTGGTCCTTTATGTGAAAAGG + Intergenic
1044139472 8:88632601-88632623 TTCTGGTTGTTAAAATAAAAGGG - Intergenic
1044235726 8:89827874-89827896 ATCTAGTTTTTTACATAGAAAGG + Intergenic
1044285500 8:90407974-90407996 CTCAGGTCCTTTATATAAAATGG - Intergenic
1044287624 8:90427570-90427592 CTTTGGTTCTTTACATCAAAAGG + Intergenic
1044361242 8:91286825-91286847 TTCTGGTTCATAATATAAACTGG - Intronic
1044553542 8:93537692-93537714 GTCTGATGCCTTATATAAAATGG - Intergenic
1045113833 8:98960486-98960508 ATCTGATTCTTTTTTGAAAACGG - Intergenic
1045144736 8:99328675-99328697 ATGTTGGTCTTTTTATAAAATGG + Intronic
1045925115 8:107573482-107573504 ATATTGTTCTTAATATAAAGAGG + Intergenic
1046642571 8:116748766-116748788 CTCAAGTCCTTTATATAAAATGG + Intronic
1046677774 8:117130684-117130706 GTCTTTTTATTTATATAAAAAGG - Intronic
1047361195 8:124171109-124171131 CTCAGGTCCTTTATATAAAATGG - Intergenic
1047707787 8:127518024-127518046 ATGTGTTTATATATATAAAATGG + Intergenic
1047889236 8:129289298-129289320 CTCAAGTTCCTTATATAAAATGG + Intergenic
1048337439 8:133513587-133513609 ATCTGATTCTTTCTAGAAAAAGG + Intronic
1048688164 8:136927754-136927776 ATTTGGCTCTTTACATCAAAAGG - Intergenic
1050235079 9:3569349-3569371 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1050389276 9:5121281-5121303 ATCAGGTTGGCTATATAAAAGGG - Intronic
1050663490 9:7909366-7909388 ATTTGAATCTTGATATAAAAGGG - Intergenic
1050867663 9:10523514-10523536 ACCTGCTTGTTTATATTAAAGGG - Intronic
1050897694 9:10904088-10904110 GTCTGGTTCTTTAAAATAAATGG - Intergenic
1050980638 9:12009678-12009700 ATTTTTTTCTTTATATAAATAGG - Intergenic
1051158118 9:14173630-14173652 TTATGGTTCTTGGTATAAAATGG + Intronic
1051501689 9:17785046-17785068 ATTTGCTTTTTCATATAAAAGGG - Intronic
1052785448 9:32823982-32824004 ATTTGGCTCTTTACATCAAAAGG - Intergenic
1053227934 9:36377692-36377714 CTCAGGTTCCTGATATAAAATGG + Intronic
1053382948 9:37663745-37663767 CTCAAGTCCTTTATATAAAATGG + Intronic
1053619863 9:39803858-39803880 ATTTGTGTCTTTATAAAAAAGGG - Intergenic
1053878041 9:42563173-42563195 ATTTGTGTCTTTATAAAAAAGGG - Intergenic
1053894623 9:42731192-42731214 ATTTGTGTCTTTATAAAAAAGGG + Intergenic
1053907390 9:42856448-42856470 ATCTGTTTCTTGATCTAACACGG + Intergenic
1054233654 9:62538521-62538543 ATTTGTGTCTTTATAAAAAAGGG + Intergenic
1054264294 9:62903585-62903607 ATTTGTGTCTTTATAAAAAAGGG + Intergenic
1055941814 9:81657722-81657744 CTCAAGTCCTTTATATAAAATGG + Intronic
1056410072 9:86317045-86317067 CTCAAGTTCCTTATATAAAATGG - Intronic
1056496788 9:87163714-87163736 TTCAAGTCCTTTATATAAAATGG + Intergenic
1057116037 9:92523292-92523314 ATCTGGCCCTTTATAGAAAAAGG - Intronic
1057116688 9:92530104-92530126 CTCAAGTTCCTTATATAAAATGG - Intronic
1057324816 9:94051721-94051743 ATGTGATTAATTATATAAAATGG - Intronic
1058297353 9:103326083-103326105 ATCTGTTTCATTATATAAAAGGG + Intergenic
1058353046 9:104049508-104049530 ATCAGCTTCTCTATATATAATGG + Intergenic
1058548215 9:106084122-106084144 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1059080045 9:111239133-111239155 TTCAAGTCCTTTATATAAAATGG - Intergenic
1059177745 9:112182727-112182749 CTCTGCTTCTTTGTATAGAATGG + Intergenic
1059380973 9:113924273-113924295 ATTTGGTAATTTAGATAAAATGG - Intronic
1059532509 9:115048858-115048880 ATGTAGTTCTTTATACAAATAGG + Intronic
1059600708 9:115774911-115774933 CTCAGTTTCTTTATATGAAAAGG - Intergenic
1059631436 9:116127758-116127780 CTCAAGTTCCTTATATAAAATGG - Intergenic
1060165544 9:121411251-121411273 TTCAAGTTCCTTATATAAAATGG + Intergenic
1060234077 9:121849899-121849921 CTCGAGTTCCTTATATAAAATGG + Intronic
1060546034 9:124459810-124459832 CTCAAGTTTTTTATATAAAATGG - Intronic
1060582952 9:124769349-124769371 ATCTGGTGTTTTTTACAAAAGGG - Intronic
1186082323 X:5946467-5946489 ATTTGATTCTCTACATAAAATGG - Intronic
1186291148 X:8100447-8100469 ATCTGTCTCTATATTTAAAATGG - Intergenic
1186555246 X:10551035-10551057 CTCAGGTCCCTTATATAAAATGG + Intronic
1186879155 X:13847527-13847549 ATCCATTTCTTTATAGAAAATGG + Intronic
1187534118 X:20122643-20122665 ATCTGGTCCTTTGTAGAAAGGGG - Intergenic
1187811797 X:23187327-23187349 AACTGTTTTTTTATGTAAAATGG - Intergenic
1188132487 X:26454174-26454196 ATCATGTTCTTTATAACAAAAGG - Intergenic
1188147472 X:26630936-26630958 CTCAAGTTCCTTATATAAAATGG - Intergenic
1188389807 X:29605722-29605744 TTCTCAGTCTTTATATAAAAAGG - Intronic
1188521102 X:31038949-31038971 TTCTGATTGTTTAGATAAAAAGG - Intergenic
1189686408 X:43568310-43568332 ATCTGTTTCTTTATATATTTTGG - Intergenic
1189945451 X:46172598-46172620 ATCTGGTGGTTTTTAAAAAAGGG - Intergenic
1190144214 X:47875846-47875868 ATCTGCTTGGCTATATAAAAGGG - Intronic
1193201678 X:78698626-78698648 ATTTGATTCTTTTTATCAAATGG - Intergenic
1193534580 X:82697660-82697682 ATTTGGTTGTTTTTATAAATAGG + Intergenic
1193861992 X:86680093-86680115 GTCTGGATCTTTTTAAAAAACGG - Intronic
1194251534 X:91581449-91581471 CTCTGGTTCTGTATATCAAGCGG + Intergenic
1194539060 X:95147793-95147815 ATATGGCTCTTTTTAAAAAAAGG - Intergenic
1194706028 X:97176873-97176895 CTCAAGTTCTTTATTTAAAATGG + Intronic
1194911484 X:99650382-99650404 AGTTGGCTTTTTATATAAAATGG - Intergenic
1195499636 X:105580251-105580273 GTCTATTTCTTTATATATAACGG - Intronic
1196093589 X:111774270-111774292 ATGTTTTTCTTTTTATAAAATGG + Intergenic
1196100195 X:111839626-111839648 CTCAAGTTCCTTATATAAAATGG + Intronic
1197124612 X:122929742-122929764 TTCTAGTTGTTTATTTAAAACGG + Intergenic
1197278073 X:124503099-124503121 ATCTGTCTCTTTAGATGAAAAGG + Intronic
1197610356 X:128631446-128631468 ATCTGGCCCTTTACAGAAAAAGG - Intergenic
1197666339 X:129228025-129228047 ATATGGCTCTTTAGAAAAAATGG - Intergenic
1197882933 X:131188227-131188249 ATTTGGGAATTTATATAAAAAGG - Intergenic
1199116853 X:144002551-144002573 AGTTGGTTCTTTATGTCAAAAGG + Intergenic
1199446815 X:147933723-147933745 ATGTATTACTTTATATAAAATGG - Intronic
1200570472 Y:4822681-4822703 CTCTGGTTCTGTATATCAAGCGG + Intergenic
1200592403 Y:5091919-5091941 ATGTGGTTCTTTTTTTTAAATGG - Intronic
1201268980 Y:12236146-12236168 ATTTGGTTCTTTATGTGAAGAGG - Intergenic