ID: 923647101

View in Genome Browser
Species Human (GRCh38)
Location 1:235834863-235834885
Sequence ACAGGTATGGAAGGTGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923647101 Original CRISPR ACAGGTATGGAAGGTGTGTT AGG (reversed) Intronic
900693507 1:3995827-3995849 ACAGGTATGGAAGGAGACTGAGG + Intergenic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
903588865 1:24438846-24438868 ATATGGATGGAGGGTGTGTTGGG + Intronic
904281212 1:29419853-29419875 ACGAGAATGGAAGGTGTGTGTGG - Intergenic
905791157 1:40790371-40790393 AGAGGTGTGGTAGGTGTGCTGGG + Intronic
906343953 1:45003760-45003782 ATAGGTCAGGAAGATGTGTTGGG + Intronic
907451494 1:54548339-54548361 ACGGGTATGGAGGGTGGGCTGGG + Exonic
907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG + Intergenic
909179833 1:72409116-72409138 ACAGTCATGGAAAATGTGTTAGG + Intergenic
910349667 1:86281107-86281129 GCAGGGATGGAGGTTGTGTTTGG + Intergenic
913637651 1:120779682-120779704 ATAGATATGTAAGGGGTGTTGGG + Intergenic
914095096 1:144538596-144538618 ACATGTATAGAAAGTTTGTTAGG + Intergenic
914303428 1:146395307-146395329 ACATGTATAGAAAGTTTGTTAGG - Intergenic
914514036 1:148358461-148358483 ACAGATTTGGAAGGGGTGTGGGG - Intergenic
914516320 1:148377872-148377894 ACATGTATAGAAAGTTTGTTAGG + Intergenic
915349096 1:155213454-155213476 TCAAGGAAGGAAGGTGTGTTAGG - Intronic
915352283 1:155234081-155234103 TCAAGGAAGGAAGGTGTGTTAGG - Intergenic
916222626 1:162460128-162460150 ACAGATATGTAAGGTGTATGTGG + Intergenic
917750915 1:178052615-178052637 CCAGGTGTGGAAGGATTGTTTGG + Intergenic
918573573 1:186027580-186027602 ACAGTTATGGAGGCTGTGTGAGG + Intronic
922919527 1:229290338-229290360 AGAGGTAGGGGAGGTGGGTTGGG - Intronic
923025739 1:230202504-230202526 ACAGGTATGATGTGTGTGTTAGG + Intronic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923647101 1:235834863-235834885 ACAGGTATGGAAGGTGTGTTAGG - Intronic
1065133201 10:22643464-22643486 ACAGGGATGGAAGGCCTGGTGGG - Intronic
1065410543 10:25422461-25422483 AGAGGTGTGGAGGGTGTGTGTGG - Intronic
1066243435 10:33559773-33559795 TCAGGTCTGGAAAGTGTGTTAGG + Intergenic
1066384725 10:34932483-34932505 ACAGGTAGGCCAGGTGTGGTGGG - Intergenic
1067161018 10:43825425-43825447 TCAGGTAGGAAAGGGGTGTTTGG - Intergenic
1067726114 10:48772338-48772360 ACAGGCATGTATGGTGTGTGTGG + Intronic
1070782128 10:79143763-79143785 GCAGGTGTGCAAGGTGTGATAGG + Intronic
1074228998 10:111515177-111515199 ACAGGTTTGGAAGGAATTTTTGG - Intergenic
1074752324 10:116598679-116598701 ACAGTTAAGGAAGGTGAGATGGG + Intronic
1075171638 10:120121022-120121044 AGAGGGAAGGAAGGTGGGTTTGG + Intergenic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1080349829 11:31370515-31370537 ACAAGTATGGAAAACGTGTTAGG - Intronic
1080360857 11:31511771-31511793 ACACGTATAGAAGGTGCTTTGGG - Intronic
1083397994 11:62404485-62404507 GCAGGTATGGACAGTGGGTTTGG + Intergenic
1083619554 11:64042205-64042227 ACAGGAGAGGAAGGTGGGTTAGG - Intronic
1084322835 11:68383223-68383245 ACAGGCTTGGAATGTGTTTTGGG + Intronic
1088487151 11:110351828-110351850 ACTGGAATGGAAGGTGGGCTAGG - Intergenic
1089376936 11:118000958-118000980 ACAGGCATGGAAGCTGTGAGGGG + Exonic
1091087088 11:132731906-132731928 AGAGGTATGAAAGGTGAGGTTGG + Intronic
1091311644 11:134579262-134579284 GCAGGTAGGGAGGGTGTGGTAGG + Intergenic
1091636679 12:2202536-2202558 ACAGGTATGGAAGTTGTTTTGGG + Intronic
1096846120 12:54407992-54408014 ACAAGTATGGCAGGGGTGCTGGG + Intronic
1099389429 12:82061087-82061109 ACAGGTATGGTAGATGTGGAAGG - Intergenic
1099462719 12:82944026-82944048 ACAGGTAAGTAAGGTGGTTTGGG + Intronic
1102582018 12:113895387-113895409 ACAGATAAGGAAAGTGGGTTTGG - Intronic
1105916479 13:24921835-24921857 GAAGGTATAGAAGGTGTGTTTGG - Intronic
1106312309 13:28564580-28564602 ACAGGAATGGAAGGTGATTAGGG + Intergenic
1111618976 13:90699223-90699245 AAATGTATGGAAGATGTGTGTGG + Intergenic
1116581742 14:46651378-46651400 ACAGGTATGCGAGGTGCCTTTGG - Exonic
1120868845 14:89319182-89319204 ACAGCTTTGGAAGGTATGTGAGG + Intronic
1127281562 15:57497663-57497685 ACAGGAATGGAGGGTGTGGGTGG + Intronic
1127839796 15:62821273-62821295 ACAGCTATGGAAGGTGGGGTAGG - Intronic
1129050422 15:72777109-72777131 ACCAGTTTGCAAGGTGTGTTTGG - Intronic
1129671044 15:77607791-77607813 ACAGGGATGCCAGGTGGGTTGGG + Intergenic
1131952413 15:97694890-97694912 ACAGGCCTGGAGCGTGTGTTTGG - Intergenic
1134009212 16:10838845-10838867 ACAGGGAGGGAAGGTGTGTCTGG - Intergenic
1136077496 16:27827021-27827043 ACAGTGATGGAAGGGGAGTTGGG - Intronic
1136923542 16:34350902-34350924 ACAGGTTTGGGAGGAGTCTTTGG - Intergenic
1136981031 16:35060904-35060926 ACAGGTTTGGGAGGAGTCTTTGG + Intergenic
1138626212 16:58254028-58254050 ACAGGTATGGACCGTGGGGTAGG + Exonic
1139129184 16:64119511-64119533 AAAGGTATGGACAGGGTGTTGGG - Intergenic
1140075898 16:71698488-71698510 ACAGGTATGCGAGGTGCCTTTGG - Intronic
1140890979 16:79285070-79285092 ATAGGTATGGAAGGTTTTCTGGG - Intergenic
1142420175 16:89965244-89965266 CCAGGTCTGGAAGATGTGTGAGG - Intronic
1145786012 17:27594394-27594416 ACAGGCATGGGGGGTGTGCTTGG - Intronic
1149436109 17:56634789-56634811 AAAGTTTTGGAAGGAGTGTTGGG - Intergenic
1203171985 17_GL000205v2_random:157025-157047 GCAGGTGTGGAAAGTGTGTCAGG - Intergenic
1153503216 18:5769564-5769586 ACAGGTAAAGAAGCAGTGTTGGG - Intergenic
1156905173 18:42343992-42344014 ACAGGCAGGAAAGTTGTGTTTGG + Intergenic
1159813635 18:73046762-73046784 ACAGGTAAAAGAGGTGTGTTGGG - Intergenic
1159928567 18:74290878-74290900 ACAGCTTTGGAAGGTGTAATAGG - Intronic
1162994529 19:14325790-14325812 ATATGTATGGATGGGGTGTTTGG + Intergenic
1163577092 19:18117460-18117482 ACTGGCATAGAGGGTGTGTTTGG - Intronic
1163825961 19:19525175-19525197 ACAGGTAATGAGGGTGTGCTGGG - Intronic
1166918564 19:46212932-46212954 ACAGGTTTGGAAGGTGGGAGTGG - Intergenic
1166921007 19:46229214-46229236 ACAGGTTTGGAAGGTGGGAGTGG - Intergenic
927066495 2:19476627-19476649 AAAGGAATAGAATGTGTGTTTGG - Intergenic
929168858 2:38911000-38911022 AAATGAATGGAACGTGTGTTTGG + Intronic
933398984 2:81767024-81767046 CAAGGTCTGGAAGATGTGTTAGG - Intergenic
934919463 2:98331311-98331333 ACAGGTAAGGATGGAGTTTTGGG - Intergenic
937942903 2:127301877-127301899 ACAGCTCTGGAAGGTGAGTATGG + Exonic
939718314 2:145614212-145614234 AGGAGTATGGAAGGTGTGTTGGG + Intergenic
939794292 2:146622547-146622569 ACAGATATTGTAGGTGTGTTTGG - Intergenic
940280932 2:151988882-151988904 ATAGATATGGAAGGGGTGCTGGG - Intronic
941559072 2:167022228-167022250 ACAGGTATAGACGTTGTCTTAGG - Intronic
942672347 2:178389800-178389822 ACAGGTATGGTAGCTGGGTGGGG - Intronic
945474354 2:210263931-210263953 ACAGGTCTGGTAAGTGGGTTGGG + Intergenic
947704658 2:232264558-232264580 ACAAGCAAGGAAGGAGTGTTTGG - Intronic
947791850 2:232873202-232873224 ACAGGTCAGGAAGGTGGATTGGG + Intronic
947955550 2:234187324-234187346 ACAGGAGTGGCAGGTGTCTTTGG + Intergenic
948336590 2:237212835-237212857 ACATGTGTGTAAGGTGTGTATGG + Intergenic
948561856 2:238859422-238859444 ACAGGTGTGGAATTTCTGTTTGG + Intronic
948777892 2:240299346-240299368 ACAGGTCTGGAAGGCATGTCTGG - Intergenic
1169141381 20:3229076-3229098 ACAGGTGTGGAGGGTGGGTGAGG - Exonic
1169637735 20:7711741-7711763 ACAGATATGGAAGTCGTATTAGG - Intergenic
1171391551 20:24804674-24804696 ACAGGTCTGGCAGGTGTGCCAGG - Intergenic
1173388641 20:42611679-42611701 TCAGGGAAGGAAGGTGAGTTTGG - Intronic
1174211108 20:48878674-48878696 ACATGGAAGGAAGGTGTGGTAGG - Intergenic
1175372241 20:58499761-58499783 ACAGGGATGGGTGGGGTGTTTGG - Intronic
1176327967 21:5518862-5518884 GCAGGTGTGGAAAGTGTGTCAGG - Intergenic
1176399790 21:6302089-6302111 GCAGGTGTGGAAAGTGTGTCAGG + Intergenic
1176437367 21:6687015-6687037 GCAGGTGTGGAAAGTGTGTCAGG - Intergenic
1176461629 21:7014085-7014107 GCAGGTGTGGAAAGTGTGTCAGG - Intergenic
1176485190 21:7395863-7395885 GCAGGTGTGGAAAGTGTGTCAGG - Intergenic
1182164779 22:28162084-28162106 TAATGAATGGAAGGTGTGTTTGG - Intronic
1183563678 22:38597185-38597207 CCAGGTATGGAAGGGGCTTTGGG - Exonic
1185117834 22:48948090-48948112 GCAGCCATGGAAGGTGTGATTGG + Intergenic
951673182 3:25207784-25207806 AGAGGGATAGAATGTGTGTTAGG + Intronic
954969697 3:54640928-54640950 TCAGGTATGGACTGTGTTTTAGG - Intronic
955871165 3:63440251-63440273 AAAGGCATGGAAGGTGAGTGTGG + Intronic
960030974 3:113054511-113054533 ACAGGAGTGAAAGGTGTGTGTGG - Intergenic
960885860 3:122393881-122393903 GCACGAATGGAAGGTGTGTTAGG + Intronic
961617023 3:128190722-128190744 ACAGGACTGGAAGGTGTTCTGGG - Intronic
962121916 3:132570425-132570447 ACAGGTATGGAAGGTTAATATGG - Intronic
964484401 3:157173313-157173335 ACAGTTAAGGCAGGTGTGATTGG + Intergenic
966749290 3:183306607-183306629 ACAGGGATGGAGTGTGTGTATGG + Intronic
967039233 3:185674234-185674256 ACAGGTATGGAAAGTGGATGTGG + Intronic
969170405 4:5357827-5357849 ACAGTGATGGGAGGTGTGGTGGG - Intronic
969505858 4:7587395-7587417 ACAGGGGTGGCAGGTGTGTGAGG - Intronic
970795650 4:19909473-19909495 CCCGGTATGGAAGGAGTGCTAGG - Intergenic
971795357 4:31220045-31220067 ACAGCCATGGAAGATGAGTTAGG - Intergenic
972324376 4:38001285-38001307 CAAGGTATGGAAGGGGTTTTGGG + Intronic
975292900 4:72697595-72697617 GCAGGTGTGGTAGGTTTGTTGGG - Intergenic
976164645 4:82241416-82241438 ACAGGGATGGAAATTTTGTTAGG + Intergenic
976523753 4:86061196-86061218 ATAGGTATGAAAGATGAGTTAGG - Intronic
976910707 4:90302361-90302383 TCAGGTAGGGAAGGAGTGTCAGG + Intronic
981128724 4:141134175-141134197 ACAGGCAAGGGAGGTTTGTTTGG + Intronic
982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG + Intronic
987121879 5:14775730-14775752 AGAGGTGTAGAAGGTGGGTTTGG + Intronic
988074991 5:26340944-26340966 AAAGGTAAGGAAGGAGAGTTTGG - Intergenic
989217468 5:38920159-38920181 ACGGGGATGGAGGGTGTGGTAGG - Intronic
993295175 5:86128947-86128969 ACAGGTATAGAAGTTTTATTTGG - Intergenic
996617926 5:125463829-125463851 ACAGCCATGGTAGGTGTCTTGGG - Intergenic
997156546 5:131566399-131566421 CCAGGAATGGAAGGTTGGTTTGG - Intronic
1003164466 6:3664045-3664067 CAGGGTCTGGAAGGTGTGTTTGG - Intergenic
1004282279 6:14290886-14290908 ACTGGTATGGAAATTGAGTTAGG - Intergenic
1004627631 6:17391871-17391893 CCAGGTATGGAAGGAAGGTTAGG - Intergenic
1004918795 6:20357079-20357101 ACGGGGGTGGGAGGTGTGTTGGG + Intergenic
1005578463 6:27211576-27211598 ACAGGTATGGGAGGTGCCTTTGG + Intergenic
1007413173 6:41676806-41676828 ACACATATGCAAGGTGTGCTTGG - Intergenic
1007573231 6:42908260-42908282 ACAGGGATGGAAGCTATGTCTGG + Intergenic
1011398870 6:86938141-86938163 ATAGGTATGGAACGGGTGCTGGG + Intronic
1014031979 6:116716502-116716524 ACAGGAATTTAAGGTGTGTGAGG - Intronic
1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG + Intergenic
1016857362 6:148684483-148684505 CCAGGTCTGGAGGGTGTGGTGGG + Intergenic
1023344793 7:39260363-39260385 CAAGGTATGGAATGTGTGTGTGG - Intronic
1026653003 7:72231994-72232016 ACAGGTGTGAAATGTGTGTTGGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028870702 7:95768710-95768732 ACAGGCATGCAGTGTGTGTTTGG - Intergenic
1031088539 7:117325433-117325455 ACAGGTCAGGAAGGGGTGTTTGG - Intergenic
1031618810 7:123911342-123911364 ACAGAGATGGAAGTGGTGTTGGG - Intergenic
1032493160 7:132340233-132340255 AGAGGGATGGGAGGAGTGTTTGG - Intronic
1032576903 7:133064021-133064043 AGAGGTATGGAAAGTGCTTTAGG - Intronic
1034398918 7:150848477-150848499 GCAGGTAAAGAAGGTGTGCTGGG + Intronic
1035945172 8:3954273-3954295 ACAGGAAAGGAAGGTGCGCTTGG + Intronic
1036012847 8:4747093-4747115 ACAGGAATGGCAGGTGCTTTCGG + Intronic
1036696763 8:10979938-10979960 ACAGGCAGGGAAGGTTTCTTCGG + Intronic
1037538575 8:19850896-19850918 ACATGTGTGGAAGGGGTGGTGGG - Intronic
1039504390 8:38041443-38041465 ACAGGAATGGGAGGAGTGGTAGG + Intronic
1041958677 8:63586072-63586094 AGAGGTATGAAAGGTGAGTCAGG + Intergenic
1042061099 8:64818898-64818920 ACAGGTATGGAAGGTGCTTGTGG - Intergenic
1044598340 8:93979903-93979925 AGAGGTATGGAAGGTGGCTCTGG - Intergenic
1045506305 8:102781232-102781254 ACAGGCCAGGAAGGTGTGTAGGG - Intergenic
1045762792 8:105630057-105630079 ACAGATATAAAAGGTGTGGTAGG - Intronic
1047456609 8:125019019-125019041 ACTGTGATGGAAGGTGTTTTTGG + Intronic
1047715025 8:127587554-127587576 CCTGCTATGGAATGTGTGTTGGG - Intergenic
1048581231 8:135731367-135731389 AGAGGTATGGCAGGTGTGGCTGG + Intergenic
1051280083 9:15434257-15434279 ACAGGTATGGAATTTCTGTTTGG - Intronic
1056832571 9:89928903-89928925 ACAGGTATGGAGGGGCTGGTGGG - Intergenic
1058677450 9:107412623-107412645 ACAGGGATGGAAGGCCAGTTGGG + Intergenic
1059421557 9:114195582-114195604 CCAGCAATGGAAGGTGTCTTAGG + Intronic
1060858784 9:126936812-126936834 ACAGGTAAGGAAGGAGTGCAGGG + Intronic
1061465642 9:130777267-130777289 ATGGGAATGGAAGGGGTGTTGGG + Intronic
1061721658 9:132555740-132555762 ACAGGGCTGGGGGGTGTGTTAGG - Intronic
1203434141 Un_GL000195v1:121596-121618 GCAGGTGTGGAAAGTGTGTCAGG + Intergenic
1186478281 X:9876233-9876255 ACGGTTATTGAAAGTGTGTTGGG - Intronic
1197310017 X:124893433-124893455 AAAGATATGAAAAGTGTGTTTGG + Intronic
1197899892 X:131359192-131359214 AGAGTTATGGAAGGAGTGTTAGG - Intronic
1197916009 X:131536186-131536208 ACAACTAAGGAAGTTGTGTTAGG - Intergenic
1199338758 X:146650799-146650821 TCAGGTAGAGAAAGTGTGTTGGG + Intergenic
1201236828 Y:11920131-11920153 ACAGGTATGGAAACTGTGGGTGG + Intergenic
1201954042 Y:19601371-19601393 AGAGGTCTGGAAGATCTGTTAGG - Intergenic