ID: 923647266

View in Genome Browser
Species Human (GRCh38)
Location 1:235836561-235836583
Sequence TACGGGATATTGAGTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923647261_923647266 8 Left 923647261 1:235836530-235836552 CCAAGCCACTGAGATAAATGTAT 0: 1
1: 0
2: 1
3: 22
4: 216
Right 923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 39
923647262_923647266 3 Left 923647262 1:235836535-235836557 CCACTGAGATAAATGTATGCTGG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923647266 Original CRISPR TACGGGATATTGAGTGCAAG AGG Intronic
904815475 1:33193578-33193600 GACGGGATTAGGAGTGCAAGGGG + Intergenic
905566245 1:38967393-38967415 TACTGTATATTAAGTGGAAGTGG + Intergenic
906390930 1:45415416-45415438 TATGGGATATTGCGAGCAAATGG - Intronic
911722425 1:101205881-101205903 TAAGGGATATGGAGTGAAAACGG - Intergenic
923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG + Intronic
923751764 1:236753384-236753406 TACGTGATATTTGTTGCAAGAGG + Intronic
1065661066 10:28004612-28004634 CACTGGATACTGAGTGCATGGGG + Intergenic
1066035648 10:31480601-31480623 TACAGTATATTTAGTGCAAATGG - Intronic
1081173570 11:39897838-39897860 TACTGGATATTCAGTGTAAGTGG - Intergenic
1101568734 12:105934017-105934039 GACTGGATATTGAGTGCTAGTGG - Intergenic
1102415800 12:112761615-112761637 AATGGGAAATTGAATGCAAGAGG - Intronic
1119380388 14:74224566-74224588 TATGGGATATTAAGTGGAATTGG + Intergenic
1133208646 16:4249816-4249838 GAAGGGCTATTGAGTGGAAGAGG - Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1149457179 17:56797420-56797442 TGCAGGATATTGAGGGGAAGAGG - Intronic
1158042307 18:53110124-53110146 TCAGGGATAGTGAGAGCAAGTGG - Intronic
1163207327 19:15813179-15813201 TAGGGGAAATTGTGTGCAGGCGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942892951 2:181014278-181014300 TAAGGGATATTCAGTGGAAATGG + Intronic
1170955525 20:20975846-20975868 TTCTGGATATTGAATGCAAATGG + Intergenic
950746962 3:15098427-15098449 TACGTGATTTAGAGTGCGAGGGG - Intronic
951253121 3:20417359-20417381 TAGGGGATATGGAGTTCAAAAGG - Intergenic
953518482 3:43619890-43619912 TACGGAATTTTGGGTGGAAGAGG - Intronic
956574856 3:70741033-70741055 CAGGGAATATTGTGTGCAAGAGG - Intergenic
957163796 3:76644578-76644600 TACGGGAAGGTCAGTGCAAGTGG - Intronic
963544551 3:146639579-146639601 TTTGGGATCTTGAGTACAAGTGG + Intergenic
964796683 3:160506033-160506055 TGTGGGATATTGAGGGAAAGGGG - Intronic
964804944 3:160598569-160598591 TACGGGATATTAAGGCCAATCGG + Intergenic
978312247 4:107397274-107397296 TATTGAATATTGAGTACAAGTGG - Intergenic
978922867 4:114205763-114205785 TACGGGATTTTTATTTCAAGAGG + Intergenic
984541610 4:181044405-181044427 TACAGGATATTGAATAGAAGTGG + Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
1008736363 6:54549394-54549416 TGCAGGATATTGAGTAGAAGAGG - Intergenic
1010657231 6:78525917-78525939 TAGGGGATATTGTATGCAGGGGG - Intergenic
1044052669 8:87527717-87527739 TACGGGATTTTAAGAGCAAGGGG - Intronic
1045002149 8:97887947-97887969 AACGGCATTTTGAGTGCAAGTGG + Intronic
1045017606 8:98012550-98012572 TACGGGGTACTGAATGCGAGAGG + Intronic
1048096422 8:131300324-131300346 CACAGGTTATTGAGTGCATGAGG + Intergenic
1058208367 9:102135972-102135994 TAGGGCATGTTGAGTACAAGGGG - Intergenic
1058456532 9:105143041-105143063 TATGTGATATTGAGTGAAGGAGG + Intergenic
1059276165 9:113099152-113099174 GATGGGATCTTGGGTGCAAGAGG - Intergenic
1199045887 X:143171290-143171312 TACAGTATATTAAGTGCTAGAGG - Intergenic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic
1200078065 X:153561668-153561690 TCCTGGGTAATGAGTGCAAGGGG + Intronic