ID: 923654287

View in Genome Browser
Species Human (GRCh38)
Location 1:235901757-235901779
Sequence TTGGGCAATTGGGAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923654278_923654287 0 Left 923654278 1:235901734-235901756 CCCCACCGAAGACACAGGAGAAA No data
Right 923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG No data
923654280_923654287 -2 Left 923654280 1:235901736-235901758 CCACCGAAGACACAGGAGAAATT No data
Right 923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG No data
923654279_923654287 -1 Left 923654279 1:235901735-235901757 CCCACCGAAGACACAGGAGAAAT No data
Right 923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG No data
923654275_923654287 17 Left 923654275 1:235901717-235901739 CCTCCTGTTCTTGGGAACCCCAC No data
Right 923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG No data
923654282_923654287 -5 Left 923654282 1:235901739-235901761 CCGAAGACACAGGAGAAATTGGG No data
Right 923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG No data
923654276_923654287 14 Left 923654276 1:235901720-235901742 CCTGTTCTTGGGAACCCCACCGA No data
Right 923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923654287 Original CRISPR TTGGGCAATTGGGAGTTGGT TGG Intergenic
No off target data available for this crispr