ID: 923655230

View in Genome Browser
Species Human (GRCh38)
Location 1:235910045-235910067
Sequence CCGTGAGTCCCTTCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923655230_923655237 26 Left 923655230 1:235910045-235910067 CCTGGAGATGAAGGGACTCACGG No data
Right 923655237 1:235910094-235910116 TTTCTTTATTCTCAGAAGCTGGG No data
923655230_923655235 -9 Left 923655230 1:235910045-235910067 CCTGGAGATGAAGGGACTCACGG No data
Right 923655235 1:235910059-235910081 GACTCACGGGTTTTAAGCAGGGG No data
923655230_923655234 -10 Left 923655230 1:235910045-235910067 CCTGGAGATGAAGGGACTCACGG No data
Right 923655234 1:235910058-235910080 GGACTCACGGGTTTTAAGCAGGG No data
923655230_923655236 25 Left 923655230 1:235910045-235910067 CCTGGAGATGAAGGGACTCACGG No data
Right 923655236 1:235910093-235910115 TTTTCTTTATTCTCAGAAGCTGG No data
923655230_923655238 27 Left 923655230 1:235910045-235910067 CCTGGAGATGAAGGGACTCACGG No data
Right 923655238 1:235910095-235910117 TTCTTTATTCTCAGAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923655230 Original CRISPR CCGTGAGTCCCTTCATCTCC AGG (reversed) Intergenic
No off target data available for this crispr