ID: 923660520

View in Genome Browser
Species Human (GRCh38)
Location 1:235953090-235953112
Sequence GGGTTTAGACAAATGTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923660516_923660520 -1 Left 923660516 1:235953068-235953090 CCCTTGGTGTTACACAGTCTATG No data
Right 923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG No data
923660517_923660520 -2 Left 923660517 1:235953069-235953091 CCTTGGTGTTACACAGTCTATGG No data
Right 923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG No data
923660513_923660520 21 Left 923660513 1:235953046-235953068 CCAAAGTTTACATTAGGGCTTCC No data
Right 923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG No data
923660515_923660520 0 Left 923660515 1:235953067-235953089 CCCCTTGGTGTTACACAGTCTAT No data
Right 923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923660520 Original CRISPR GGGTTTAGACAAATGTATCA TGG Intergenic
No off target data available for this crispr