ID: 923663488

View in Genome Browser
Species Human (GRCh38)
Location 1:235979028-235979050
Sequence CATACAGCCGGGTCTGCTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923663482_923663488 11 Left 923663482 1:235978994-235979016 CCTTGCGGACACTGAGACAGGGC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 923663488 1:235979028-235979050 CATACAGCCGGGTCTGCTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923663488 Original CRISPR CATACAGCCGGGTCTGCTTG TGG Exonic