ID: 923663488 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:235979028-235979050 |
Sequence | CATACAGCCGGGTCTGCTTG TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 171 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 160} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923663482_923663488 | 11 | Left | 923663482 | 1:235978994-235979016 | CCTTGCGGACACTGAGACAGGGC | 0: 1 1: 0 2: 1 3: 8 4: 128 |
||
Right | 923663488 | 1:235979028-235979050 | CATACAGCCGGGTCTGCTTGTGG | 0: 1 1: 0 2: 0 3: 10 4: 160 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923663488 | Original CRISPR | CATACAGCCGGGTCTGCTTG TGG | Exonic | ||