ID: 923673716

View in Genome Browser
Species Human (GRCh38)
Location 1:236063593-236063615
Sequence TAAAATCCACAAGATGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923673716_923673717 13 Left 923673716 1:236063593-236063615 CCTTGGTCATCTTGTGGATTTTA 0: 1
1: 0
2: 1
3: 21
4: 218
Right 923673717 1:236063629-236063651 AAACTTTATACTGCCCAGCATGG 0: 1
1: 0
2: 1
3: 10
4: 132
923673716_923673720 29 Left 923673716 1:236063593-236063615 CCTTGGTCATCTTGTGGATTTTA 0: 1
1: 0
2: 1
3: 21
4: 218
Right 923673720 1:236063645-236063667 AGCATGGTGACACTCGCCTGTGG 0: 1
1: 0
2: 48
3: 478
4: 2560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923673716 Original CRISPR TAAAATCCACAAGATGACCA AGG (reversed) Intronic
901562964 1:10087675-10087697 TAATATCCACATGATGTCCCTGG + Intronic
903573823 1:24325505-24325527 TAAAACCCCCAATAAGACCAAGG - Intronic
905606464 1:39304722-39304744 TAAAATCCAAAAAATTAGCAGGG - Intronic
906549075 1:46646784-46646806 CAAAATCAACAAAATGAACATGG + Intronic
908890164 1:68837343-68837365 CAAAATCTTCAAGATGATCATGG - Intergenic
909166227 1:72228695-72228717 TATAGACCAAAAGATGACCAGGG + Intronic
909330964 1:74410150-74410172 TAAAATATACAAGAGGACCCAGG + Intronic
911212064 1:95152290-95152312 CAAAATGCACAAAATGACCTGGG - Intronic
911989027 1:104667752-104667774 TAATATCCACAATCTGCCCAAGG + Intergenic
913159230 1:116130272-116130294 TAAAATCCACCAGGTGACTTAGG - Intronic
913255203 1:116946751-116946773 TACAGTACACAAGATGACAAAGG + Intronic
913705207 1:121414424-121414446 AAAACACCACAAGATGACCAGGG + Intergenic
916273353 1:162967834-162967856 TCAAATAGAAAAGATGACCAAGG + Intergenic
917647468 1:177043432-177043454 TAGAACCCAAAAGATGACAACGG + Intronic
918590800 1:186238806-186238828 TGACATCCTCTAGATGACCATGG + Intergenic
918991376 1:191700984-191701006 TTAAACCAACAAGGTGACCATGG - Intergenic
921584708 1:216933395-216933417 TAAAATTTACCAGATGAGCATGG - Intronic
922592970 1:226792386-226792408 TAAAATACATAAGATTACAAAGG + Intergenic
923121751 1:230998608-230998630 TAAAATTCACAAGGAGAGCAGGG + Intronic
923673716 1:236063593-236063615 TAAAATCCACAAGATGACCAAGG - Intronic
1063206785 10:3839442-3839464 TATAATAAACAAGAAGACCAAGG - Intergenic
1065806433 10:29397491-29397513 CCAAATCCACAAGATGTGCAGGG - Intergenic
1070415599 10:76186486-76186508 CAAAATGCTCAAGAGGACCAGGG - Intronic
1071141070 10:82510035-82510057 TAGAATCCACTAGATCACAAAGG - Intronic
1071595570 10:86921013-86921035 TAAAATACAAAAGTTAACCAGGG - Intronic
1072955133 10:99881402-99881424 TAAATTGCCCAAGATGACCAAGG + Intronic
1073489547 10:103843874-103843896 TAAAACACAGATGATGACCAGGG + Intronic
1073559022 10:104481351-104481373 TAAAATCCTCAAGGTGACAAAGG - Intergenic
1076136786 10:128050560-128050582 TAAAATTCAAAACACGACCAAGG - Intronic
1077661567 11:4073233-4073255 TAAAAACCACCAGGTTACCAGGG - Intronic
1079809910 11:24984562-24984584 TAAAAGCCACAAGTTCACGAAGG + Intronic
1079829429 11:25244052-25244074 GCAATTTCACAAGATGACCATGG + Intergenic
1080497528 11:32834360-32834382 TAAAATCTACAAGAAGACAAAGG + Intronic
1082889140 11:58119603-58119625 TAAAATGCAAGAGATGCCCAAGG - Intronic
1084688067 11:70708913-70708935 TAAAATACACAAGAAGGGCAGGG + Intronic
1088394635 11:109352892-109352914 TAGAATCCACATTATGTCCAAGG + Intergenic
1088614216 11:111607284-111607306 TAAAATCCCCAAAATGCACATGG - Intronic
1088992232 11:114963671-114963693 GAGAATCCACAAGGTGACCATGG - Intergenic
1090561477 11:127937452-127937474 TAAAATACACAGGATTACAAAGG + Intergenic
1095795732 12:46216697-46216719 TAAAATACAAAAAATGACCTGGG + Intronic
1095977463 12:47949564-47949586 TAAAACCCACAAGAGGATCCAGG - Intergenic
1097088530 12:56487581-56487603 TAAAATACACACGAGGACTAGGG + Intronic
1097590158 12:61564551-61564573 CAAAATTCACTAGAAGACCAAGG + Intergenic
1099306872 12:80968408-80968430 GAAAATACACAAGATGAGCCTGG - Intronic
1099324833 12:81201679-81201701 TAAAATCCACATGTTTTCCATGG - Intronic
1099378466 12:81923924-81923946 AAAAATCTACAAAATGAACAGGG - Intergenic
1101342294 12:103853626-103853648 TAAATTCCATAAGATGGACAGGG + Intergenic
1105675857 13:22671139-22671161 GGAAATCCACAAGATGATCAAGG - Intergenic
1106830205 13:33572967-33572989 TTTAATGCACAAGATGACCCAGG + Intergenic
1107864262 13:44687759-44687781 TAAAATTCATAAGATGACAAAGG + Intergenic
1108355072 13:49622669-49622691 TAGAATCCACATGAGCACCATGG + Intergenic
1109487623 13:63048041-63048063 TACAAACCACAAGATGATAAAGG - Intergenic
1110101500 13:71611851-71611873 TAAAATTCCCAAGATGTGCATGG + Intronic
1111376314 13:87383291-87383313 AAAAATTTACAAGATGACCCTGG + Intergenic
1113227203 13:108172326-108172348 TAAATTCCACCAGATGTACAAGG + Intergenic
1113700197 13:112379399-112379421 TAAAATGCATAAAATGGCCATGG + Intronic
1113869997 13:113553577-113553599 TAAACTCCAGAAGATTAGCAGGG - Intronic
1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG + Intergenic
1114805581 14:25832599-25832621 TAATAGCCACATGATGACAATGG - Intergenic
1115380668 14:32735093-32735115 TAAAATCAACAACATCACCAAGG + Intronic
1115644557 14:35359383-35359405 GAAAATACACAAGATGAGCCTGG + Intergenic
1117842315 14:59871838-59871860 TGAAATCCTCAAGATGCGCATGG - Intergenic
1120225047 14:81781381-81781403 AGAAATACACAAGATGACCCTGG - Intergenic
1120492710 14:85196759-85196781 TGAAATCCACATGAACACCAAGG + Intergenic
1121687983 14:95853663-95853685 AAGGATCCACAAGATGCCCATGG - Intergenic
1123454297 15:20404989-20405011 TAAAGACCACAAGATTACAAAGG - Intergenic
1124113563 15:26817112-26817134 TAAAATAAACAAAATGAACAGGG + Intronic
1124814044 15:32970407-32970429 TAAACTCCACAAGATGAAACTGG + Intronic
1129786816 15:78315216-78315238 TAAGATCCCCAAGAGGGCCAGGG + Intergenic
1129945543 15:79536455-79536477 TTAAATGCACAAGACGACCATGG + Intergenic
1130938675 15:88490351-88490373 AAAAAAACCCAAGATGACCAAGG - Intergenic
1131404201 15:92150480-92150502 TGAAATCCACCAGATTAGCATGG - Intronic
1132034736 15:98472891-98472913 TAAAGTCCAGAAGATGGCAAGGG + Intronic
1137763683 16:50961018-50961040 TAAAATGGACAAGATGAGGATGG - Intergenic
1137903277 16:52292260-52292282 TAACATCGACATTATGACCAGGG + Intergenic
1137958189 16:52853856-52853878 TAAATTCCAGAAGATCAACATGG + Intergenic
1139069644 16:63364464-63364486 CTAAATCTACAAGCTGACCAGGG - Intergenic
1139101945 16:63778209-63778231 TACAACCCACAAGATCACCTGGG - Intergenic
1144410473 17:14995693-14995715 TAAAATATACCACATGACCAAGG - Intergenic
1145846637 17:28043652-28043674 TCAAACACACGAGATGACCAAGG - Intronic
1147361289 17:39932237-39932259 TAATATCCACAACATGAGGAGGG - Intergenic
1150594126 17:66589457-66589479 TAAAATCTTCAAGATAACAATGG - Intronic
1151417745 17:73977509-73977531 TTTAATCCCCAAGATGGCCAAGG - Intergenic
1152328191 17:79654803-79654825 TAAAATCCACAAGGAGAAAATGG + Intergenic
1152769714 17:82159830-82159852 TAAAATACAAAAGATGAGCCGGG - Intronic
1153130511 18:1850954-1850976 GAAAATCCCCAACATGACAAAGG + Intergenic
1155497957 18:26461115-26461137 TGAGAAGCACAAGATGACCATGG + Intronic
1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG + Intergenic
1156808730 18:41221608-41221630 TAAAATCCACAAGACATCTAAGG - Intergenic
1159088430 18:63820188-63820210 TAAAATCTGCAGGATGAACAAGG + Intergenic
1160005968 18:75069268-75069290 GAAAATCGCCAAGGTGACCATGG - Intergenic
1160907860 19:1460221-1460243 TGAGATGCACAAGATGACCCGGG + Exonic
1161817865 19:6510879-6510901 CAGAATCTCCAAGATGACCATGG - Intergenic
1162244140 19:9384915-9384937 TAAAATCAGGAAGATGACAATGG + Intergenic
1162491439 19:10994893-10994915 CAAAATCCAGAAGCTGACCAAGG + Exonic
1165194277 19:34089334-34089356 TCAAATCCAGAACCTGACCAAGG - Intergenic
1167779167 19:51585715-51585737 TAAAGTGCACAGGATGATCAGGG + Intronic
925358327 2:3259211-3259233 TGAAATACACAAGATGACAAAGG + Intronic
929278555 2:40052310-40052332 TGAAATCCACAAGACCACCTAGG + Intergenic
932740406 2:74286706-74286728 TAAAATAAACAAAATGACCAGGG + Intronic
935846594 2:107172469-107172491 CAAAATTCACAAGATGAGCCTGG - Intergenic
939893093 2:147760582-147760604 TAAAATCCACATTCTTACCAAGG - Intergenic
941050019 2:160722246-160722268 TAAAATGCACAAGTTGTGCATGG + Intergenic
945261808 2:207850750-207850772 ATAAATCCACAAAATGACCCAGG - Intronic
945337101 2:208605386-208605408 TAAAATCCACCATTTGTCCAAGG - Intronic
945502296 2:210590877-210590899 CAAAACCTACAAGATGTCCATGG + Exonic
948371382 2:237491625-237491647 TAAAAACCACAGGATGATCAGGG + Intronic
1169250035 20:4053107-4053129 TAAAATACACCAGATAACAAAGG + Intergenic
1169425417 20:5493069-5493091 TAAAGTCCCCAAGAAGCCCACGG + Intergenic
1171261769 20:23740263-23740285 TAAATACCACAAGAAAACCATGG + Intergenic
1174526692 20:51177717-51177739 TAAAAGCCACATGATGGCCTGGG - Intergenic
1174860731 20:54088690-54088712 AAAATTCCAGAAGATGAGCAAGG - Intergenic
1177306870 21:19329782-19329804 GAAAATATACAAGATGACCCTGG - Intergenic
1177949320 21:27514219-27514241 TATAACCCACAAAATGACCTAGG + Intergenic
1178118125 21:29438049-29438071 TAACATACACAAAATTACCATGG - Intronic
1179158337 21:38871296-38871318 TAAAATTCAGAAGATGACAAAGG + Intergenic
1179217730 21:39381624-39381646 TAAAAACAAGAAGATGAGCATGG - Intronic
950272818 3:11632576-11632598 TAAAATCCTTCAGAAGACCATGG + Intronic
951880576 3:27477773-27477795 TAAAATACAAAAAATTACCAGGG - Intronic
952168748 3:30781085-30781107 TAAAATCCACAAAATTAGGAAGG + Intronic
953050082 3:39333015-39333037 TCAAAACCACAACAAGACCAAGG + Exonic
953464712 3:43109463-43109485 TAAAATCTGCATGATGAACATGG + Intergenic
954932279 3:54294648-54294670 GAAAATCGATAAAATGACCAAGG - Intronic
957794072 3:84980280-84980302 TAAAATCCACAGGCTTAGCAAGG - Intronic
958065106 3:88534824-88534846 TAACATACACATGATGACGAAGG + Intergenic
961117900 3:124347506-124347528 TAGAATCCAAAAGAAGACAAAGG - Intronic
962508109 3:136069159-136069181 TAAAAACCAGAAAATGAACATGG - Intronic
963011311 3:140773082-140773104 CAAAATCAACACGAAGACCATGG - Intergenic
963292557 3:143507055-143507077 TAATATGCACAAGATGAATAAGG - Intronic
963963647 3:151340003-151340025 TAAATTCCCCAAAATGTCCATGG + Intronic
964984316 3:162720160-162720182 TCAAATCAAAAAGATGAACAGGG - Intergenic
966741074 3:183234421-183234443 TGTAATCCAGAATATGACCAAGG - Intronic
969450490 4:7270169-7270191 TAAAATCCACATCATGGGCACGG - Intronic
970130873 4:12869270-12869292 GAAAATGTACAAGATGACCATGG - Intergenic
970422863 4:15921332-15921354 TAACTTGCACAAGATGGCCAAGG - Intergenic
971167724 4:24201622-24201644 TATAATCTAAAAGATGAACAAGG - Intergenic
971218378 4:24682819-24682841 TAAAAACCAAGAGATGGCCATGG + Intergenic
971780497 4:31028021-31028043 TAAAAGGTACAAAATGACCATGG - Intronic
973828725 4:54736755-54736777 TAAGTTCTACAAGATGATCAAGG + Exonic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974060730 4:57032632-57032654 TAAATTTCCTAAGATGACCAGGG + Intronic
975737910 4:77399683-77399705 TGAAATTGACAAGATGAACACGG - Intronic
976069355 4:81223432-81223454 TAAATTCAGCAAGATTACCAGGG - Intergenic
976613109 4:87049893-87049915 TCAAATCCAAAACCTGACCAGGG - Intronic
977659666 4:99568647-99568669 AAAAATGCACAAGATGACCTGGG + Intronic
978950126 4:114548114-114548136 CAAAAACCTCAAGAAGACCAAGG - Intergenic
981089543 4:140718607-140718629 TAATTTCCAGAAGATCACCAGGG + Intronic
982003398 4:151042182-151042204 TAAAATCCAAAGCATAACCATGG - Intergenic
982024531 4:151238142-151238164 TAAAACCCACATGATGAACTAGG - Intronic
983160936 4:164413367-164413389 AAAAATGACCAAGATGACCAAGG - Intergenic
984476157 4:180237608-180237630 TAAAATTTACAAGCTGACAAAGG - Intergenic
984757003 4:183333613-183333635 TTAAATACACAGGATGACAAAGG + Intergenic
985294284 4:188418085-188418107 GATGATCCACAAGCTGACCAAGG + Intergenic
986078027 5:4358057-4358079 TCAGGTCCACAAGATGATCATGG + Intergenic
987699764 5:21382133-21382155 GAAAATACACAAGATGAGCCTGG - Intergenic
988120398 5:26953992-26954014 TAAAAAACAGAAGATTACCATGG + Intronic
988276663 5:29089723-29089745 GGAAATACACAAGATGAGCATGG - Intergenic
988752639 5:34205921-34205943 GAAAATACACAAGATGAGCCTGG + Intergenic
989505533 5:42223004-42223026 TAAATTCCACCTGATGACCTGGG - Intergenic
990443232 5:55867353-55867375 TAGACTTCACTAGATGACCAAGG - Intronic
991019365 5:61963988-61964010 TATATTCCACAAGAAGGCCAAGG + Intergenic
991740407 5:69666735-69666757 GAAAATACACAAGATGAGCCTGG + Intergenic
991757091 5:69886432-69886454 GAAAATACACAAGATGAGCCTGG - Intergenic
991791982 5:70246476-70246498 GAAAATACACAAGATGAGCCTGG + Intergenic
991819870 5:70542840-70542862 GAAAATACACAAGATGAGCCTGG + Intergenic
991836494 5:70762314-70762336 GAAAATACACAAGATGAGCCTGG - Intergenic
991884431 5:71246802-71246824 GAAAATACACAAGATGAGCCTGG + Intergenic
992908582 5:81372907-81372929 TAAAGCCCAAAAGATTACCAAGG + Intronic
995233486 5:109798594-109798616 TAAAAAAGACAAGATGATCAGGG - Intronic
995744661 5:115391254-115391276 TAAAATGACCAAGAAGACCAGGG - Intergenic
996434620 5:123421245-123421267 AAAGATCAGCAAGATGACCAGGG - Intronic
997632712 5:135380916-135380938 TAAAATCCACATGCTGTCAAAGG - Intronic
998032769 5:138886256-138886278 TAAAATGACCAAGAAGACCAGGG + Exonic
999763318 5:154719446-154719468 TAAAATACATAGGATGACAAAGG + Intronic
1000699382 5:164429399-164429421 TGAAATCCACAAGTACACCAGGG - Intergenic
1001876025 5:175201920-175201942 TCAAATCCACAATATCTCCAAGG + Intergenic
1001882476 5:175256514-175256536 AAAAATCCACAAGATGTGCTAGG - Intergenic
1002620146 5:180482324-180482346 TAAAATACACAGGATGGCAAAGG + Intergenic
1004862993 6:19824697-19824719 TAAAAACCCCAAGATGAGCAGGG - Intergenic
1005550801 6:26912641-26912663 GAAAATACACAAGATGAGCCTGG + Intergenic
1006308401 6:33239386-33239408 TAAAATCCACAGGATGGGCCGGG - Intergenic
1006760622 6:36457314-36457336 TAAAATCCACAATATGACCGAGG - Intronic
1010671114 6:78687731-78687753 TAACATGAACAAGATGGCCAAGG - Intergenic
1011632791 6:89343646-89343668 TAAAATCCATATGAAGAACATGG + Intronic
1013006937 6:106082591-106082613 TAAAACCCACAGGATGTCCAAGG - Intergenic
1014770245 6:125451897-125451919 TAATTTCCCCAAGATGAGCAAGG - Intergenic
1015243406 6:131051301-131051323 AAAATTCCACAAGATTGCCACGG - Intronic
1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG + Intergenic
1018758651 6:166871570-166871592 AAAATTCTACAAGATGAACATGG + Intronic
1019221195 6:170474284-170474306 TAAAATACACAAGATCAAAAAGG + Intergenic
1020404123 7:7812729-7812751 TAAAAACCACAAAATCAGCAGGG + Intronic
1020866915 7:13576279-13576301 TAAAATACACTAGAGAACCATGG + Intergenic
1021284902 7:18769286-18769308 TAAACTCTTCAAAATGACCAAGG + Intronic
1022571029 7:31454495-31454517 GAAAAACCACAGGATGAACAGGG + Intergenic
1022971549 7:35522159-35522181 TAAAACTCACAAGATGACTTTGG + Intergenic
1023255041 7:38304874-38304896 TGAAATCCCCAAGATCAGCAGGG - Intergenic
1026028207 7:66764940-66764962 TAAAATGCAGAAGATAACAAGGG - Intronic
1027456210 7:78394872-78394894 TAAAACCTACAAGATTTCCATGG + Intronic
1028135249 7:87218283-87218305 ACAAAGCCACAAGATGAACAAGG + Intronic
1029502635 7:100942434-100942456 AAAAATCCTCAAGCTGACCTGGG + Intergenic
1029928825 7:104348720-104348742 TAAAATCCGAAAGTTGAGCAAGG + Intronic
1030206814 7:106959399-106959421 CAAAATCCAAAAGCTGCCCAGGG + Intergenic
1032707130 7:134431086-134431108 TTAAACACACAAGATTACCAAGG + Intergenic
1033269658 7:139919307-139919329 TAATATCAAAAAGAGGACCACGG - Intronic
1035852720 8:2937144-2937166 TAAAATCTATAAGATCCCCAGGG - Intronic
1035870391 8:3131104-3131126 TAAAATACATAAGATTACAAAGG + Intronic
1037181778 8:16015602-16015624 AAAAATACACAAGATCCCCAGGG + Intergenic
1038580411 8:28743735-28743757 TACAATACACAGGATGACAAAGG - Intronic
1039594372 8:38778024-38778046 GAATTTCCACAAGATCACCATGG - Intronic
1040453252 8:47570061-47570083 TAGAATTAACAAGATGATCATGG + Intronic
1042527670 8:69781305-69781327 TAAAATCCAATGGATGGCCATGG - Intronic
1043111711 8:76192235-76192257 TAAAATCCACAAGATCTTAACGG + Intergenic
1043298468 8:78696776-78696798 TAAAAACCGTAAGATGACCTAGG - Intronic
1046743185 8:117849815-117849837 TAAAATGCAGAAGATGTCAAAGG + Intronic
1047446456 8:124924537-124924559 TAAAATGGACAAGATGATCTTGG + Intergenic
1047610951 8:126520459-126520481 TAAAATACATCAGATGACAAAGG - Intergenic
1048272336 8:133039514-133039536 TAAAATTCACAGGCTGACAATGG + Intronic
1048454130 8:134562642-134562664 TAAAATCCACAGGGAGTCCAAGG + Intronic
1051813758 9:21080231-21080253 TAAAATGCATGAGATGGCCAAGG - Intergenic
1052084504 9:24247953-24247975 TAAAACACACAAGACCACCATGG - Intergenic
1052873838 9:33536977-33536999 TAAAATCAGTAAGATCACCAAGG - Intronic
1053502207 9:38607372-38607394 TAAAATCAGTAAGATCACCAAGG + Intergenic
1053557768 9:39155625-39155647 TAAAAACCACAAAATGAAAAGGG - Intronic
1053821879 9:41975910-41975932 TAAAAACCACAAAATGAAAAGGG - Intronic
1054139346 9:61463326-61463348 TAAAAACCACAAAATGAAAAGGG + Intergenic
1054608693 9:67211498-67211520 TAAAAACCACAAAATGAAAAGGG + Intergenic
1055740498 9:79383070-79383092 TAAACCCCACAATATGACCCAGG + Intergenic
1057681571 9:97191677-97191699 TAAAATCAGTAAGATCACCAAGG + Intergenic
1059945482 9:119404726-119404748 TAAAATCCCCACCATGCCCATGG - Intergenic
1061375775 9:130223469-130223491 TAAAATCCATAAGATCAAAAAGG + Intronic
1186154657 X:6712619-6712641 CAGAATCCCCAAGATGAACATGG - Intergenic
1186725027 X:12348476-12348498 TAAAATACACAGGAGGACCCAGG + Intronic
1187562354 X:20414743-20414765 CAGAATCCACAGGATGAGCATGG - Intergenic
1187876694 X:23809923-23809945 TAAAAACCAAAAGATGAAAACGG + Intergenic
1193453463 X:81700087-81700109 TAAAATTCACAAGATAACTAGGG - Intergenic
1194214904 X:91118174-91118196 TAAAATACAAAAAATTACCAGGG - Intergenic
1194727981 X:97420759-97420781 TAGAATCCACAGGATGAGCTAGG - Intronic
1195704483 X:107729138-107729160 TAACATCCCCAATATGCCCAAGG - Intronic
1197309495 X:124886864-124886886 TAACATTAAAAAGATGACCAAGG + Intronic
1199482383 X:148311769-148311791 TTAAAGCCACAAGATCATCAGGG - Intergenic
1202578415 Y:26352289-26352311 TAAAAACGACAAGATGATCACGG + Intergenic