ID: 923680295

View in Genome Browser
Species Human (GRCh38)
Location 1:236113338-236113360
Sequence GGTCCTGAACACTCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923680295_923680299 -8 Left 923680295 1:236113338-236113360 CCCACAGTGGAGTGTTCAGGACC No data
Right 923680299 1:236113353-236113375 TCAGGACCACGAGTGGATGGCGG No data
923680295_923680302 18 Left 923680295 1:236113338-236113360 CCCACAGTGGAGTGTTCAGGACC No data
Right 923680302 1:236113379-236113401 CAGACTCTGAAATTCTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923680295 Original CRISPR GGTCCTGAACACTCCACTGT GGG (reversed) Intergenic