ID: 923685881

View in Genome Browser
Species Human (GRCh38)
Location 1:236153310-236153332
Sequence CTGCAGAGATAGAAAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 11, 3: 74, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923685881_923685883 9 Left 923685881 1:236153310-236153332 CCATCTGCTTTCTATCTCTGCAG 0: 1
1: 0
2: 11
3: 74
4: 474
Right 923685883 1:236153342-236153364 TCCTTAATATTTCATATCAAAGG 0: 1
1: 0
2: 9
3: 129
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923685881 Original CRISPR CTGCAGAGATAGAAAGCAGA TGG (reversed) Intronic
900608088 1:3532675-3532697 CTGCAGAGACAGAAAGCTTGGGG + Intronic
902235533 1:15055000-15055022 CTGCAGAACTAGCAAGGAGATGG - Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902701187 1:18173510-18173532 CTGCAGGGACAGGAAGCAGGTGG - Intronic
902819321 1:18933957-18933979 CCACAGAGACAGAAAGTAGAAGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
903653106 1:24932897-24932919 CAGCAGGGCTAGGAAGCAGAAGG + Intronic
903801729 1:25973777-25973799 CTGCTGAAATAGGAACCAGATGG + Intronic
904293190 1:29500811-29500833 CTGCAGGGAGGGAAAGCGGAAGG - Intergenic
904943414 1:34181062-34181084 TTTCAGTGATAGAAAGCAAAAGG - Intronic
905028725 1:34867620-34867642 CTCCAGGACTAGAAAGCAGAAGG + Exonic
905047888 1:35022686-35022708 CTGCTGTGAGAGAAAGGAGATGG - Intronic
905885573 1:41489983-41490005 ATGGAGAGAAAGAAGGCAGATGG - Intergenic
906264791 1:44420386-44420408 CAGCAGAGACAGAAAGCTGTAGG + Intronic
907542878 1:55232693-55232715 CCACAGAGACAGACAGCAGAGGG - Intergenic
908366098 1:63425234-63425256 CAGCAGAGAAGGAAAGCTGATGG + Intronic
909285640 1:73813753-73813775 CTGCAGATATAATAAGGAGAGGG - Intergenic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910803299 1:91165996-91166018 GTGCAGAGAGAGAAAGGAGGGGG + Intergenic
911119003 1:94276343-94276365 CTGCAGAGATATTAATAAGATGG + Intergenic
911245249 1:95509729-95509751 CTGCAAAGATAAAAAACTGAAGG + Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912077499 1:105893541-105893563 ATACAGAGATAGAAATCTGAAGG - Intergenic
912080170 1:105926476-105926498 TTGCAAAGATAGAAAGAAAATGG - Intergenic
912095735 1:106140700-106140722 CTGGAGAGATAGATATCAGAAGG + Intergenic
912879357 1:113392460-113392482 CTGCTGAGAAAGAAATGAGAAGG - Intronic
913243673 1:116852538-116852560 CTGCAGAGATTGACAACTGAAGG + Intergenic
914699187 1:150115224-150115246 CAGCACAGACAGATAGCAGATGG - Intronic
915117457 1:153609660-153609682 ATGCAGAGATTAAAAGCAGGGGG - Intronic
915594845 1:156890841-156890863 CTACAGTGACAGAAAGCACATGG + Intergenic
915715858 1:157944138-157944160 CTGCAGAGAAGGAAAGCATGGGG - Intergenic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916179753 1:162073035-162073057 CTGCAGAGATTGAAAGGTGTGGG + Intronic
916574786 1:166057823-166057845 CTGAAAAGATAAAGAGCAGAAGG + Intronic
917984990 1:180307317-180307339 CTACATAGATAGAGAGTAGAGGG + Intronic
918073315 1:181149936-181149958 ATGCAGTGTTAGAAAGCACACGG + Intergenic
918213025 1:182368305-182368327 CTGCAGGTATAGAAAGGAAATGG + Intergenic
918610016 1:186478711-186478733 CTTCAGAGATAGAAGCCAAAGGG + Intergenic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
918791479 1:188836193-188836215 CTGTATAGATAGGAAGAAGAAGG + Intergenic
919958340 1:202440212-202440234 CTCCAGAGATATAAAGCAAGAGG - Intronic
920205873 1:204291735-204291757 CTATAGTGACAGAAAGCAGACGG + Intronic
920233090 1:204483088-204483110 CAGGAGAGAGAGAAAGCAGGAGG - Intronic
920655632 1:207872547-207872569 GGGCAGAGATAGAGAGCATAGGG - Intergenic
921393063 1:214636687-214636709 CTGCACTGTTAGAAAACAGATGG - Intronic
921888068 1:220326298-220326320 CTGCAGGGATCAAAACCAGAGGG - Intergenic
922578208 1:226677424-226677446 CTCCAGAGAGAGACAGCAGAGGG + Intronic
923075425 1:230604799-230604821 ATGCAGAGATAGGTAACAGATGG - Intergenic
923467442 1:234261951-234261973 CTGTGGAGATAGAAAGGTGAAGG - Intronic
923647801 1:235841761-235841783 TTGCAGATATAGAAAACAGGTGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923995785 1:239492686-239492708 CTGCAGACAGAGAAAAAAGACGG - Intronic
924462953 1:244275351-244275373 AGTCAGAGATAGATAGCAGATGG + Intergenic
1062945098 10:1454633-1454655 CCACAGAGACAGGAAGCAGAGGG + Intronic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1064680461 10:17806512-17806534 CAGCAGAGAAAGAGAGAAGAAGG - Intergenic
1065478382 10:26165700-26165722 CTGCAGTGGCAGGAAGCAGAAGG - Intronic
1065641727 10:27789368-27789390 CTTTAGTGATAAAAAGCAGATGG - Intergenic
1065787569 10:29230383-29230405 CTGTGGAGATAGGAGGCAGAGGG - Intergenic
1067238744 10:44472896-44472918 CTGCAGACAGACACAGCAGAGGG - Intergenic
1068228809 10:54142798-54142820 CTGCAGGGAAAAAAAGGAGAGGG + Intronic
1068263701 10:54619577-54619599 ATGCAGAGATGTTAAGCAGAGGG + Intronic
1069173043 10:65256535-65256557 TTGCTGAGAAAGAAATCAGAAGG + Intergenic
1070105586 10:73427769-73427791 CTGCAGAGACAGCATGGAGAAGG + Intronic
1071770613 10:88725769-88725791 CTGCAGATATACAAAGAAGAGGG - Intronic
1072466487 10:95667363-95667385 ATGCAAAAACAGAAAGCAGATGG + Intronic
1072709733 10:97708135-97708157 ATGCAAAGCAAGAAAGCAGATGG - Intergenic
1073273183 10:102284450-102284472 TTACAGAGACAGAATGCAGATGG - Intronic
1073798562 10:107015260-107015282 GTGGAGAGATAGAAAATAGATGG + Intronic
1074181813 10:111072037-111072059 TTGCAGAGATAGAAAACACCTGG + Intergenic
1074199919 10:111225489-111225511 CTGCTGAGACAGACAGAAGAAGG - Intergenic
1074425588 10:113348410-113348432 AAGCAGAGATAGTAAGGAGAGGG + Intergenic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1074741444 10:116488270-116488292 CTACAGAGAGAGAAAACAGTGGG + Intergenic
1075679536 10:124322517-124322539 TTGCAGAGATAGAGAGCCAAGGG - Intergenic
1076578503 10:131490425-131490447 CTGCAGAGCCAGAAAGTAGATGG + Intergenic
1077710149 11:4528241-4528263 CAGAAGAGATAGCAAGCAGGGGG - Intergenic
1077923241 11:6656325-6656347 CTGGAGAGAGATCAAGCAGAAGG - Intergenic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1078731919 11:13982824-13982846 CTGCAGAGAGAGAAAAAAGCAGG - Intronic
1081034405 11:38124264-38124286 CAGCAGAGAGAAAAAGCAGTTGG - Intergenic
1082025847 11:47571426-47571448 CAGCAGAGAAAGAAAGAAGCAGG - Intronic
1084778572 11:71394023-71394045 CTGCAGTGAGAGAAGGCAGAGGG + Intergenic
1085473180 11:76771227-76771249 TTGGACAGACAGAAAGCAGAGGG - Intergenic
1086925098 11:92631531-92631553 CAGGAGAGACAGAAAGCAAAGGG - Intronic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087243170 11:95803409-95803431 CTCCAGAAAAAGAAAGTAGAGGG + Intronic
1087512390 11:99114187-99114209 CTGCAGAGCTAGAAAGACAAAGG - Intronic
1088905309 11:114151069-114151091 CAGAATAGATAGGAAGCAGACGG - Intronic
1090359657 11:126163538-126163560 CTGCAGAGAGAGTAGGCAGAGGG + Intergenic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1093427490 12:19044816-19044838 CTCCTGAGATAGAAAGAAGATGG + Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1094401594 12:30067141-30067163 CTGCAGAGACAGCAAGCTGCTGG + Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1096179565 12:49543171-49543193 ATGCAGGGATAGAAAGGAGGTGG + Intronic
1096551884 12:52378381-52378403 CTGCGGAGAAAGAAAGCATCAGG + Intronic
1096557350 12:52411542-52411564 CTGCAGAGATCGGGAGCAGGTGG + Intergenic
1096944575 12:55390389-55390411 CTTGGGAGATAGAAAGCACAGGG - Intergenic
1097100056 12:56581376-56581398 CTGCCGAGAGAGAAGGCAGATGG - Intronic
1097530868 12:60798443-60798465 CTGAAGAGATTGAAAGTAGGGGG + Intergenic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1100235047 12:92652677-92652699 CCCCAGAGAGAGAAACCAGAGGG - Intergenic
1100443030 12:94635027-94635049 ATGCAGAGATACAAGGCAGGTGG + Intronic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1100879895 12:99004865-99004887 CTGAAGAGATAGAAGTGAGAGGG + Intronic
1101488682 12:105192223-105192245 CGGCAGAGATGAAAAGTAGATGG - Intronic
1103608342 12:122105186-122105208 CTGCAGAGATAAAAAGGATGTGG - Intronic
1103798967 12:123524725-123524747 CCATAGAGATAGGAAGCAGACGG + Intronic
1103889374 12:124227341-124227363 CTATAGAGACAGAAAGCAGATGG + Intronic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1104052910 12:125208479-125208501 CTGGAGAGACACAAAGCAGATGG - Intronic
1104943498 12:132405514-132405536 TCTCAGAGACAGAAAGCAGAAGG + Intergenic
1105438997 13:20400291-20400313 CTGCAGGGAGAGAAAACAGAAGG - Intergenic
1105900700 13:24749521-24749543 CTGCAGAGAGAAAAAGAATAAGG - Intergenic
1105964622 13:25372713-25372735 CTGCAGAGCTCAAAAGCAGAGGG + Intronic
1106118460 13:26837675-26837697 CAGGAGAGAAAGAGAGCAGAAGG + Intergenic
1106368477 13:29107075-29107097 CTGCAGAGAGAGATGGCAGGTGG - Intronic
1106573548 13:30953218-30953240 CCACGGACATAGAAAGCAGACGG - Intronic
1107063028 13:36181835-36181857 CTGCAGAGTAAGAAAGCTGAAGG - Intronic
1108753743 13:53475414-53475436 CTGCAGAGCTAGGAAGATGACGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1110730510 13:78874894-78874916 ATGCAGAGAAAGTAAGCAGCAGG + Intergenic
1111367794 13:87272369-87272391 TTGCAGAGATAGAAAGCATAAGG - Intergenic
1112161592 13:96874052-96874074 CTGCAGAAACAAAAAGGAGAGGG + Intergenic
1112269743 13:97957786-97957808 CTTCAGAGATAAAAAAGAGAAGG - Intronic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1112598354 13:100830702-100830724 GTGCAGAGATAGTAGGCAGTTGG - Intergenic
1112825941 13:103392736-103392758 TTGCAAAGAAAGAAAGCAGAAGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115022041 14:28693717-28693739 CAGCAGAGAAAGGGAGCAGAAGG - Intergenic
1115039442 14:28905258-28905280 TTACAGAGATAGACTGCAGAAGG - Intergenic
1115535435 14:34368720-34368742 CTGCAGAGAAGTAAAACAGATGG - Intronic
1115919103 14:38352945-38352967 TTACAGAGACAGAAAACAGAAGG - Intergenic
1116322712 14:43491246-43491268 AAGCAGAGATAGGAAGTAGAGGG - Intergenic
1116382724 14:44291491-44291513 CTGCTGAGAAAAACAGCAGATGG - Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1117782818 14:59252268-59252290 CTTCAGACTTAGAAAGCAAAAGG + Intronic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118160568 14:63285658-63285680 CTACAGTAATAGAAAGAAGAGGG - Intronic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1119408890 14:74416030-74416052 CTATAGCGACAGAAAGCAGATGG + Intronic
1119745273 14:77039384-77039406 CTGCAGAGTTGTAAAGCAAAGGG - Intergenic
1119927379 14:78508156-78508178 CTGAAAAGAGAGAAACCAGAAGG + Intronic
1120030617 14:79636753-79636775 CTGCAAAGGGAGAAAGGAGAAGG + Intronic
1120400426 14:84023974-84023996 AAGCAGAGAGATAAAGCAGATGG + Intergenic
1120700035 14:87689347-87689369 CTGCAAAGCAAGAAATCAGAGGG + Intergenic
1121806715 14:96833042-96833064 GTGCAGAGATTGAAAACATAAGG - Intronic
1122095038 14:99364302-99364324 CTGCAGAGAGAAAAAGTAGTGGG + Intergenic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1122865012 14:104599765-104599787 CTCCAGAGAGAGAATGGAGAAGG + Intronic
1123433288 15:20236261-20236283 ATCCAGAGACAGAAAGTAGATGG - Intergenic
1123901921 15:24885959-24885981 ATGCAGAAACAGAAACCAGACGG - Intronic
1123995504 15:25715533-25715555 CTGCAGGGATATACACCAGAAGG + Intronic
1124237374 15:28002373-28002395 CTGCAGAGAAAGGAAGCAGGCGG - Intronic
1124910130 15:33911882-33911904 TTCCAGAGAGAGAAAGAAGAAGG + Intronic
1125548875 15:40529425-40529447 ATGCAGAGAGAAAAAGCAGAGGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126932490 15:53670508-53670530 CTGGACAGATAGAAAGAACATGG - Intronic
1127360634 15:58241988-58242010 CTGCTGACCTAGAAAGAAGAGGG + Intronic
1127408357 15:58678222-58678244 CAGCAGAGATAACAAGCAGTTGG + Intronic
1128190535 15:65690451-65690473 TTGCAGAGAAAGCAAGCAAATGG - Exonic
1128327181 15:66731513-66731535 CTATAGAGACAGAAATCAGATGG - Intronic
1128647723 15:69389341-69389363 TTGTACAGATAGGAAGCAGAGGG - Intronic
1128756113 15:70185185-70185207 CTGCAGAGGTGAGAAGCAGAGGG + Intergenic
1129899059 15:79131578-79131600 CTTCAAAGATAGAATGCAGCTGG - Intergenic
1131336909 15:91557966-91557988 CAGGAGAGAGAGAAAGCAAAGGG + Intergenic
1131598120 15:93819910-93819932 TGGCAGAGAAAGAAAACAGATGG + Intergenic
1131808016 15:96143122-96143144 CCACAGAGCTAGAAAGCAGAGGG + Intergenic
1132005694 15:98224685-98224707 CTGCAGAGAGAAAAAGTAGTTGG + Intergenic
1132067655 15:98745412-98745434 GTGCAGAGACAGAAAGCCGGTGG + Intronic
1132778789 16:1611861-1611883 CTTCATAGCAAGAAAGCAGAGGG - Intronic
1132932309 16:2464897-2464919 CTACAGTGAGAGAAAACAGAGGG - Exonic
1133075251 16:3275269-3275291 CTGCCCAGATACAAGGCAGAGGG + Intronic
1133143822 16:3768860-3768882 CTGCAGAGGTAGACTACAGAAGG - Intronic
1133530719 16:6652719-6652741 CCACAGAGACAGAAAGCAGAAGG + Intronic
1133696341 16:8266621-8266643 CTGGAGAGAGAGAGAGCAAAGGG - Intergenic
1134824090 16:17270519-17270541 GTACAGAGATACACAGCAGAGGG + Intronic
1135100669 16:19602565-19602587 ATGGACAGATAGGAAGCAGAAGG - Intronic
1135466957 16:22694832-22694854 AAGCAGAGATAGAAAGTAGGTGG - Intergenic
1135503952 16:23020285-23020307 CTGTAGAGAAAGAAAGGAAATGG - Intergenic
1135575766 16:23584330-23584352 ATCCAGAGATAGAAAGTACACGG - Intronic
1136001236 16:27295405-27295427 CTATAGAGACAGAAAGTAGATGG - Intergenic
1136358627 16:29763073-29763095 CCACAGGGACAGAAAGCAGATGG - Intergenic
1137477503 16:48822296-48822318 ATCCAGAGATAGAAAACAGGTGG - Intergenic
1138670869 16:58613461-58613483 GTGCAGAGGTATAATGCAGATGG - Intronic
1139106493 16:63833015-63833037 CTGCACAAATAGAAAGCAGCAGG - Intergenic
1140309835 16:73838670-73838692 CTGTACAGAAAGGAAGCAGAAGG + Intergenic
1141469277 16:84227876-84227898 CCACAGAGACAGAAAGCAGAGGG + Intronic
1141757783 16:86004019-86004041 CTGGAGAGAGAGGAGGCAGAAGG + Intergenic
1141849235 16:86633011-86633033 CCGTAGAGACAGGAAGCAGATGG - Intergenic
1203112940 16_KI270728v1_random:1463322-1463344 ATCCAGAGACAGAAAGTAGATGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143737740 17:8925085-8925107 GTGGATAGATAGAAAGTAGATGG + Intronic
1143737759 17:8925428-8925450 ATGGAGAGATAGATAGTAGATGG + Intronic
1143889425 17:10091201-10091223 CCACAGAGACAGAAAGCAGATGG + Intronic
1144821029 17:18074692-18074714 TGGTAGTGATAGAAAGCAGATGG + Intergenic
1146335231 17:31963939-31963961 AAGCAGAGTTAGAAAGCAGAGGG - Intronic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1147563752 17:41524269-41524291 CTGCAGAGAGAGGAAGAAGAGGG + Intronic
1147586248 17:41655359-41655381 CAGCAGAGAAAGAGAGCAGAGGG - Intergenic
1148147356 17:45374129-45374151 CTGCAGGGAAAGAGAGGAGAGGG - Intergenic
1148198147 17:45729553-45729575 CTGCAGGCATAGAAAGCAACTGG - Intergenic
1148354820 17:46968806-46968828 CTGCAGTCATTGAATGCAGAAGG + Intronic
1148357478 17:46985208-46985230 CTACAGAGGTTGAAGGCAGAGGG + Intronic
1150033163 17:61763099-61763121 ATTCAGAGATAGAAAGTAGAAGG - Intronic
1150896552 17:69217677-69217699 CTGATCAGATAGAAAGTAGAAGG + Intronic
1151373580 17:73666714-73666736 AGGAAGAGAGAGAAAGCAGACGG - Intergenic
1151902874 17:77028662-77028684 CCACAGAGACAGAAAGCAGATGG + Intergenic
1154359507 18:13647598-13647620 CTACAGAGGTAAGAAGCAGAAGG - Exonic
1156358711 18:36364887-36364909 CTGAAGGGGGAGAAAGCAGAAGG + Intronic
1156515682 18:37678109-37678131 CTACAGAGATATCAAGGAGAAGG - Intergenic
1156526370 18:37771415-37771437 GGGCAGAGATAGGAGGCAGAAGG - Intergenic
1156941361 18:42770390-42770412 CTGCAGTGAGAGAAAGTTGATGG + Intronic
1157077403 18:44480404-44480426 CAGGAGAGAGAGAAAGCACAGGG - Intergenic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157682137 18:49615458-49615480 CCACAGACACAGAAAGCAGAGGG - Intergenic
1157910806 18:51615750-51615772 CTGTAGAGATAGGAAGTGGAGGG - Intergenic
1158585715 18:58732214-58732236 CTCCAGATATTGCAAGCAGAGGG + Intronic
1158769524 18:60498353-60498375 CTGCTGAAATAGAAGGCAGGAGG + Intergenic
1158997414 18:62936929-62936951 CTTCGGAGACAGAAATCAGAGGG + Intronic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1160349968 18:78169656-78169678 CTGCTGAAACAAAAAGCAGAAGG - Intergenic
1160751551 19:736747-736769 CAGCACAGAAAGAAGGCAGAGGG + Intronic
1161079424 19:2303159-2303181 TCGCAGAGACAGGAAGCAGATGG - Intronic
1161886072 19:6996650-6996672 CTGCAGAGATTGAAAGTGGTTGG - Intergenic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162813506 19:13179253-13179275 CCACAGAGACAGAAAGTAGATGG - Intergenic
1163593775 19:18208974-18208996 CTGCGGACAGAGAAAGCAGGGGG + Exonic
1163677823 19:18664092-18664114 CCGCAGAGACAGGAAGCAGATGG - Intronic
1163729672 19:18941542-18941564 GCGGAGAGATAGGAAGCAGATGG + Intergenic
1164508690 19:28880076-28880098 TCACAGAGATAGAGAGCAGAAGG - Intergenic
1164729686 19:30493943-30493965 CTGCACAGATACAAGGCAGCAGG + Intronic
1164897143 19:31886754-31886776 CTGAAGAGTTTGCAAGCAGATGG - Intergenic
1165128075 19:33614826-33614848 CCCCAGAGCTAGAAAGCAAAAGG - Intergenic
1165214365 19:34259292-34259314 GTGTAGGGATAGAAAGCAAATGG - Intronic
1166917555 19:46205910-46205932 CTGCCAAGACAGAAAGCACATGG + Intergenic
1166917888 19:46208224-46208246 CTGCCAAGACAGAAAGCACATGG - Intergenic
1167350130 19:48969226-48969248 CTCCAGAGAGAGGATGCAGAGGG - Exonic
1168310443 19:55457235-55457257 ATCCACAGACAGAAAGCAGATGG + Intronic
925554167 2:5110961-5110983 TTGCAGAGCTAGGAAGTAGAGGG + Intergenic
925594904 2:5545241-5545263 CAGCAGAGAGAGCAAGCACAGGG - Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
926356881 2:12048675-12048697 ATGCAGAGATACAAAGCTGTAGG + Intergenic
926377858 2:12251835-12251857 TTGCCAAGTTAGAAAGCAGATGG + Intergenic
926459945 2:13116530-13116552 CAACAGAGAGATAAAGCAGAAGG - Intergenic
926794314 2:16606373-16606395 CTGGAGAGAGAGAAAGGAGGAGG - Intronic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927333326 2:21891589-21891611 CAGCAAAAATAGAAAGCAAATGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928337343 2:30408947-30408969 CTCCAGAGGTAGAAAACAGGAGG - Intergenic
928693928 2:33829576-33829598 GTGCAGAGATAGATAACACATGG + Intergenic
929832022 2:45354844-45354866 CTTAAGAGATAGAAGGCAGGTGG + Intergenic
929996322 2:46828347-46828369 AGCCAGAGATAGAAAACAGAGGG - Intronic
931550979 2:63446112-63446134 CTGGAGAGAGAAAAATCAGATGG - Intronic
932436453 2:71704969-71704991 CTGCAGTGATTGGGAGCAGATGG + Intergenic
932947520 2:76253746-76253768 TTACAGAAATAGAAAGTAGAAGG + Intergenic
933150793 2:78912381-78912403 CTGCTCAGAGAAAAAGCAGAAGG - Intergenic
933971009 2:87469603-87469625 CTGAAGGGAAAGAAAGCAAATGG + Intergenic
935244897 2:101210161-101210183 CTGCAGAGAAAGAACATAGAGGG + Intronic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936322719 2:111480586-111480608 CTGAAGGGAAAGAAAGCAAATGG - Intergenic
936989741 2:118349978-118350000 ATGCAGGGATAGAATGAAGAAGG + Intergenic
937109350 2:119350835-119350857 CTGCAGAGTTATAAACCAGCAGG + Intronic
937874229 2:126809263-126809285 ATGCAGAGGGAGAAAACAGAGGG - Intergenic
938386368 2:130870096-130870118 CTGCAGGGGTTGACAGCAGAGGG - Intronic
938420168 2:131139273-131139295 CTGAAGAGAGAGAAGACAGACGG - Intronic
938589640 2:132723993-132724015 CTGCAGAGAGAGCAACCTGATGG - Intronic
938620747 2:133050132-133050154 CTACAGATATAGAAAGAACATGG - Intronic
939280973 2:140064425-140064447 TTACAGAGTGAGAAAGCAGATGG + Intergenic
939450478 2:142367192-142367214 CAGCAGAGAAAGAAAGGAGGAGG - Intergenic
939668031 2:144974615-144974637 CTTAAGAGATAAAATGCAGAAGG - Intergenic
940239648 2:151549234-151549256 CTGCAGTGAAACATAGCAGAAGG + Intronic
940328338 2:152449184-152449206 CTAAAGAGAGAGAAACCAGAGGG - Intronic
940555434 2:155221099-155221121 CTATAGAGATAAAGAGCAGAAGG + Intergenic
940721812 2:157290758-157290780 ATGCAGAAATAGAAGTCAGATGG + Intronic
941198298 2:162477474-162477496 CTTCAGAGATAGAATAGAGAAGG + Intronic
942018327 2:171840623-171840645 CAGCAGAAATAGAAAATAGAAGG + Intronic
942208419 2:173646818-173646840 CTGCAGAGAGAGATACCTGAAGG + Intergenic
942496864 2:176549179-176549201 ATGAAGAGATAGGAAGGAGATGG - Intergenic
943079762 2:183244632-183244654 CTGCTGATAGAGAAAGCAGATGG + Intergenic
943294835 2:186124551-186124573 CAGCAAAGATAGAAACCTGAAGG - Intergenic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
944543409 2:200775901-200775923 CTGCAGACATAGTAAGGAAATGG - Intergenic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945104162 2:206293106-206293128 CTGCAGAGTTAGAAAGACCATGG + Intronic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946620685 2:221559608-221559630 CTTTAGAAATAGTAAGCAGAAGG - Intronic
946636262 2:221730865-221730887 CAGCAAAGATGAAAAGCAGAAGG + Intergenic
947875494 2:233464873-233464895 CTTCAGAGATAGAACACAGAGGG + Intronic
947909529 2:233792006-233792028 CAGCAGAGAAAAAGAGCAGACGG - Intronic
948493399 2:238328961-238328983 AAGCAGAGATCGAAAACAGAAGG + Exonic
1169907963 20:10622745-10622767 TTGCAGAGATAGCAAGGAGGAGG + Exonic
1170674691 20:18467873-18467895 CTACAGGGAAAGAAAGCCGAGGG - Intronic
1172278911 20:33696884-33696906 CTGCCCAGATAGAAGACAGAGGG - Intergenic
1172595127 20:36145861-36145883 CTGAGGAGATAGAAAGGAGCTGG - Intronic
1173152470 20:40579346-40579368 CTGCAGAGATATATTTCAGAGGG + Intergenic
1173239517 20:41281897-41281919 CAGCTGAGAGAGAAGGCAGAAGG + Intronic
1173361957 20:42352538-42352560 TTACAGAGATAGAGAGTAGAAGG + Intronic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1175025131 20:55893915-55893937 GAGCAGAGAGAGAAAGCAGGAGG - Intergenic
1175344637 20:58263910-58263932 CTGCAGAGAGTGAATTCAGAAGG + Intergenic
1175486934 20:59353500-59353522 CGGCAGAGATAGGAAAAAGATGG + Intergenic
1175840773 20:62025812-62025834 CTGCAGTGACAGAAAGCAGATGG + Intronic
1176288216 21:5030326-5030348 CTGCCCAGAAAGACAGCAGACGG + Intronic
1177221733 21:18202502-18202524 CTTCAGACATAGAAAGAAGGTGG + Intronic
1178079751 21:29051425-29051447 CTGAAGAGAGAAAAAGGAGATGG + Intronic
1179167536 21:38946603-38946625 CTGCAGACATAGTCGGCAGATGG - Intergenic
1179868965 21:44233149-44233171 CTGCCCAGAAAGACAGCAGACGG - Intronic
1181080501 22:20411629-20411651 TTGCATAGCTAGAAAGCGGATGG + Intergenic
1181363875 22:22358664-22358686 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181366688 22:22381750-22381772 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181373052 22:22432873-22432895 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181922888 22:26334314-26334336 CCACAGAGAAAGAAGGCAGATGG - Intronic
1182785299 22:32902481-32902503 TTGCAGAGATTGAATGGAGAAGG - Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183336994 22:37255071-37255093 CTGCAGACAAAGAATACAGACGG + Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183854016 22:40617320-40617342 CTACAGAGAGAGAAAACAAAAGG + Intronic
1184033297 22:41907078-41907100 CAGGAGAGAAAGAAAGCAGGTGG - Exonic
1184486385 22:44782528-44782550 CCACAGAGACAGAAAGCAGATGG - Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1185184088 22:49382222-49382244 CTGCAGAGACAAAAAGCAGGTGG + Intergenic
949112241 3:275576-275598 TTGCAGAGAAAGCTAGCAGATGG + Intronic
950395993 3:12734543-12734565 CTGCAAGGATGGAAGGCAGAGGG - Exonic
950722964 3:14897933-14897955 CTGCAGGGAGAGCCAGCAGAAGG + Exonic
951069856 3:18314636-18314658 TCACAGAGATAGAAAGTAGAGGG - Intronic
952079796 3:29744221-29744243 CTGGACAGATATAAAGAAGAAGG - Intronic
952691512 3:36211793-36211815 CCACAGAGAGAGAAACCAGAAGG - Intergenic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
955063321 3:55513290-55513312 CTGCAGAGAGAGAGGCCAGATGG - Intronic
955238257 3:57158951-57158973 CTGCAAATAGAGAAAGCAGCAGG + Intronic
955527381 3:59835448-59835470 CTGCAAAGACACAAAGAAGAAGG + Intronic
955796226 3:62639924-62639946 CTGCTGTGATAGAAAGTAGTGGG - Intronic
956019173 3:64915258-64915280 CTCCAAAGATAGAAAACAGAAGG + Intergenic
958740098 3:98058704-98058726 CAGGAGAGAGAGAAAGCAAAGGG + Intergenic
958836479 3:99150641-99150663 CATCAGAGTTTGAAAGCAGATGG + Intergenic
959428737 3:106224958-106224980 CTACAGAGACAGAAAGTAGATGG - Intergenic
959908145 3:111732880-111732902 CAGAAGAGATAGAAGACAGAAGG - Intronic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
960567616 3:119151204-119151226 CTGCTGAGAAAGAGAGCATAAGG - Exonic
960964771 3:123097051-123097073 CTCCAGAGAAATCAAGCAGATGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961201086 3:125046088-125046110 CCACAGAGGCAGAAAGCAGAAGG + Intronic
961342819 3:126240193-126240215 CTATAGAGACAGAAAGCAAATGG + Intergenic
962215526 3:133517661-133517683 CTGCAGAGTTACACAGCAGAGGG - Intergenic
962672635 3:137724895-137724917 CTATAGAGATAGAAAATAGATGG - Intergenic
962732826 3:138299256-138299278 CTGCAGAGATAGAGAAAAGGTGG - Intronic
963016085 3:140825341-140825363 CTGCAGAGGTACAAAGGATAAGG - Intergenic
965050887 3:163645979-163646001 CTACAGATAAACAAAGCAGAGGG + Intergenic
966274108 3:178143604-178143626 CTGCAGAAAGAGAAAGAAGTGGG - Intergenic
967680766 3:192360937-192360959 CTGCAGAGATAGAAGTCTTATGG - Intronic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969629308 4:8326334-8326356 CTGCAGATATAAAACACAGAGGG + Intergenic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970513662 4:16805771-16805793 CTGCAGAGAGAAAAGGCAGGTGG + Intronic
971028680 4:22613269-22613291 CTGGAGAGAAAAAAAACAGATGG - Intergenic
971328597 4:25664196-25664218 CTGCAGAGAGAGACACCAAAGGG + Exonic
972769162 4:42180040-42180062 CTGCCCAGATTGAAAGGAGATGG - Intergenic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
974652199 4:64768507-64768529 CAGGAGAGAGAGAAAGCACAGGG + Intergenic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975910513 4:79260587-79260609 CAGCAGAGATGGAAATCAGCTGG - Intronic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
976004455 4:80412565-80412587 CCTCAGAGAGAGAAAGCTGAAGG + Intronic
976114484 4:81712361-81712383 GTGCAGAGATACAAAGCAACAGG + Intronic
976264167 4:83174483-83174505 GGGAAGAGATAAAAAGCAGAGGG + Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
977841219 4:101708369-101708391 CTATAGAGACAGAAAGTAGATGG + Intronic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
978742457 4:112152605-112152627 CAACAGAGACAGAAAGGAGATGG - Intronic
979611753 4:122696877-122696899 CTTAAGTAATAGAAAGCAGAAGG + Intergenic
979627099 4:122857349-122857371 CTTCAGAGATAGAGAGAAAAGGG - Intronic
980978703 4:139635554-139635576 CTGGTGAGATAGAAAGTATAAGG - Intergenic
981715109 4:147744916-147744938 CTGCCGAGAGAGAATGTAGAGGG + Intronic
982131438 4:152232421-152232443 CTGCATAGATTGGCAGCAGAAGG - Intergenic
985848091 5:2368678-2368700 CCTGAGAGATAGAAAGCAGCAGG + Intergenic
986353373 5:6901200-6901222 CTGAAGAAATAAAAAACAGATGG - Intergenic
986639621 5:9859322-9859344 CTGCAGAAAGAAAAAGCTGAAGG + Intergenic
987244020 5:16029944-16029966 CTGCTAAAATAGAAAACAGATGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
990044897 5:51417142-51417164 CTATAGAGAGAGGAAGCAGATGG - Intergenic
991309198 5:65216388-65216410 CCACAGAGACAGAAAGCAGATGG + Intronic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
993592953 5:89818145-89818167 GAGAACAGATAGAAAGCAGATGG + Intergenic
994213238 5:97109003-97109025 GTGCAGAGATAGTCAACAGAGGG - Intronic
994509170 5:100682228-100682250 TTACAGAGATAAAAAGTAGAAGG - Intergenic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
997104138 5:130999088-130999110 CAACAGAGAAAGAAGGCAGAGGG - Intergenic
997803351 5:136888981-136889003 TGGCAGAGGGAGAAAGCAGATGG - Intergenic
998577234 5:143329212-143329234 CAGGAGAGAGAGAAAGCACAGGG + Intronic
999255976 5:150210231-150210253 TTGCAGAGAGAGGAAGAAGAGGG + Exonic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
1000137546 5:158367470-158367492 CTGCACAGATAGAAATTAAATGG - Intergenic
1000538491 5:162509531-162509553 TTGCAGACAAAGGAAGCAGAAGG - Intergenic
1000542583 5:162558677-162558699 ATGGAAAGAAAGAAAGCAGATGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1001113309 5:168917036-168917058 CTTCAGAGGTACAAAGGAGACGG + Intronic
1001908634 5:175495255-175495277 ATTCAGAGACAGAAAGTAGAGGG + Intronic
1002097994 5:176843417-176843439 CGCCAGTGACAGAAAGCAGAAGG + Intronic
1002661698 5:180795576-180795598 CTGCACACATAGAGAGCAAATGG + Intronic
1002721279 5:181262553-181262575 CTGCAGAGACAGAAGACAGAAGG - Intergenic
1003003134 6:2355903-2355925 CTGCTGAGTGAGAAAGAAGAGGG + Intergenic
1003265153 6:4559226-4559248 CAGCAGAGCCAGAAAACAGAGGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003683621 6:8279675-8279697 AGGAAGAGATAGAAAGGAGAGGG - Intergenic
1004169294 6:13283552-13283574 CTGCAGACAAAGTAAGCAGAGGG + Exonic
1004945787 6:20611074-20611096 CTGCAGAGAAAGAAAACAGATGG - Intronic
1005806592 6:29479011-29479033 GCGCAGAGACAGAAAGCAGATGG - Intergenic
1006437300 6:34032742-34032764 CTGCAGAGATTGAAAGGGTAGGG + Intronic
1006983115 6:38161540-38161562 CGGCAGAGACAGACAGCAGGTGG + Intergenic
1007081959 6:39113721-39113743 CTGCAGAGAGAAAAAGAATAAGG + Intronic
1008472896 6:51903616-51903638 CTGCAGATATAGATGCCAGATGG + Exonic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008627113 6:53327488-53327510 CTACAGAGACAGAAAGCAGATGG + Intronic
1008652640 6:53578627-53578649 CTATAGTGATAGAAAGAAGATGG - Intronic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010510012 6:76706779-76706801 CTGGAGAGAAAGAAAGCTCATGG - Intergenic
1010908205 6:81519595-81519617 CTGAACAGCTGGAAAGCAGATGG - Intronic
1011191815 6:84737519-84737541 CTACAGAGATGAAAAGGAGATGG + Intronic
1011610718 6:89147464-89147486 CTCCAGAGACAGAAAAAAGAAGG - Intronic
1011674234 6:89715770-89715792 CTGCAGAGACAGAATTCAGATGG + Intronic
1011765351 6:90613829-90613851 CAGGAGACAAAGAAAGCAGAAGG - Intergenic
1013092428 6:106912357-106912379 CTCCAGCCAAAGAAAGCAGATGG - Intergenic
1013697536 6:112721612-112721634 CTCCAGAGATAGAAAGCACATGG - Intergenic
1014010803 6:116473593-116473615 TTGGAGAGCTAGAAAGTAGATGG + Intergenic
1015648667 6:135427509-135427531 TTGAAGAGGTAGAAAGTAGAAGG - Intronic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016275973 6:142352958-142352980 GTGGAGAGAGAGAAAGGAGAGGG - Intronic
1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG + Intergenic
1016683143 6:146853412-146853434 TTACAGAAACAGAAAGCAGAAGG - Intergenic
1016890386 6:149000481-149000503 CAGCAGAGAGAGGAAGAAGACGG + Intronic
1016974982 6:149798671-149798693 GTGTGAAGATAGAAAGCAGATGG + Intronic
1017986189 6:159445091-159445113 CTATAGCCATAGAAAGCAGATGG - Intergenic
1020844000 7:13259483-13259505 TGGAAGAGTTAGAAAGCAGATGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022438281 7:30410870-30410892 TTGGATAGATAGAAAGTAGATGG + Intronic
1024100962 7:46032507-46032529 CTGCAAATATAGAAAGGAAACGG - Intergenic
1024553228 7:50581136-50581158 CTGGTGAGATAGAAAGTATAAGG - Intergenic
1026213962 7:68331807-68331829 ATGCAGAAAGAGAAAGCTGAGGG + Intergenic
1026297793 7:69070448-69070470 CAGCAGAGAGAGAGAGCAGCAGG + Intergenic
1027969758 7:85063893-85063915 CTGCATAGATAGATAGGGGAGGG - Intronic
1028026262 7:85844326-85844348 TTACGGAGATAGAGAGCAGAAGG + Intergenic
1028060155 7:86302696-86302718 CTGAAGTCATAGAAATCAGAAGG + Intergenic
1028109328 7:86920421-86920443 CAGTAGGGATAAAAAGCAGAAGG + Intronic
1028608776 7:92684614-92684636 TTGCAGAGATAGAATACAAAAGG - Intronic
1028621964 7:92835603-92835625 GAGCAGAGACAGAAAGCAGAAGG - Intronic
1029032309 7:97481453-97481475 TTCCAGTGTTAGAAAGCAGAGGG + Intergenic
1029290464 7:99498740-99498762 CTGCAGAGAGAGTGCGCAGAAGG - Exonic
1029568155 7:101353039-101353061 CTACAGAGATAAAAAGTAGAAGG - Intergenic
1029683942 7:102132491-102132513 GGGCAGAGGAAGAAAGCAGAAGG - Intronic
1029969751 7:104777529-104777551 CTGCAGACATAGCAACCAAAAGG - Intronic
1030205392 7:106947490-106947512 CTCCAGAGAAAGACAGCTGAGGG - Intergenic
1030289528 7:107858481-107858503 TTCAAGAGATAGAAAGCTGAAGG - Intergenic
1030301840 7:107982087-107982109 CTGCAGACCTAGGAAGAAGAGGG - Intronic
1030957739 7:115876360-115876382 ATGCAGAGATTAAAAGAAGAAGG - Intergenic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1032984923 7:137327404-137327426 CCTCAGAGACAGAAAACAGAGGG - Intronic
1033947741 7:146742591-146742613 CAGCAGAGAGAGAAATCAGAAGG + Intronic
1034329119 7:150267809-150267831 CTACAGTGACAGGAAGCAGATGG + Intronic
1034490515 7:151390843-151390865 ATTCAGAGACACAAAGCAGAAGG + Intronic
1034668937 7:152842051-152842073 CTACAGTGATAGGAAGCAGATGG - Intronic
1034970911 7:155418555-155418577 CAGCAGGGAGAGAAAGCAGCTGG - Intergenic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035244430 7:157553059-157553081 CTCCTGAGACAGAAAGCTGAGGG - Intronic
1037321968 8:17652447-17652469 CCATAGAGATAGAAAGTAGACGG + Intronic
1037596190 8:20356251-20356273 CTAGAGAGACAGAAAGCAGGTGG - Intergenic
1037668130 8:20989494-20989516 TTACAGAGATAGAGAGCAGAAGG - Intergenic
1037715584 8:21394704-21394726 CTGCAGAGAGGGAACGCAGCGGG - Intergenic
1037929443 8:22869117-22869139 AGGCAGAGAAAGAAGGCAGAGGG - Intronic
1039178064 8:34832017-34832039 CTGCTGAGACAGAAAGAAGTGGG - Intergenic
1041917343 8:63150621-63150643 CTGCTGAGATAGGTAACAGATGG + Intergenic
1041939228 8:63368413-63368435 TGGCAGAGATAGAAAGCAAAAGG - Intergenic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1042428975 8:68681979-68682001 ATGAAGAGATAGAAAGTAGAAGG + Intronic
1042432628 8:68726416-68726438 CTACTGAGAAAGAAAGCAAAAGG + Intronic
1044399290 8:91751613-91751635 TTTCAGAGATAGAAACCACATGG + Intergenic
1045357381 8:101401912-101401934 CCTCAGAGACAGAATGCAGAGGG - Intergenic
1045480088 8:102584831-102584853 CTGCAGAGTCTGAAAGAAGAGGG - Intergenic
1045508476 8:102795169-102795191 CTGCACAGGGAGGAAGCAGAGGG - Intergenic
1045758449 8:105573316-105573338 GTGCAGAGCTTGAAACCAGAAGG + Intronic
1049749420 8:144276305-144276327 CTGCAGAGAGAGAGAGAAAATGG + Intronic
1050520974 9:6499464-6499486 CACAACAGATAGAAAGCAGATGG - Intronic
1050860166 9:10418812-10418834 CAACAGAGATAAACAGCAGAGGG + Intronic
1051163951 9:14241059-14241081 CAGCTGAGAAAGAAAGCACATGG + Intronic
1051810996 9:21049319-21049341 CTGCTGAAAGAGAAAGCAGATGG - Intergenic
1051854847 9:21552398-21552420 CATCAGGGATAGAAAGCAGTGGG + Intergenic
1051897303 9:22001050-22001072 GTGCATAGATAGACGGCAGATGG + Intronic
1052659248 9:31407067-31407089 CTACTGAGATAGAAAGGAGGTGG - Intergenic
1053224063 9:36336318-36336340 ATGGAGAGATAGATAGCAGCAGG - Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1055017555 9:71634832-71634854 CAGCGGACATAGAAACCAGACGG - Intergenic
1055209490 9:73772769-73772791 TTTCAGCGATAGCAAGCAGATGG - Intergenic
1055259463 9:74415901-74415923 CAGGAGAGAGAGAAAGCAAAGGG - Intergenic
1055387629 9:75780457-75780479 TTACAGAGATAGAGAGTAGAAGG + Intergenic
1056921533 9:90794378-90794400 CTACAGAGACAAAAAGTAGATGG + Intergenic
1057030322 9:91770094-91770116 CTGCAAAGAGAGAAAGTACAGGG - Intronic
1057456041 9:95212067-95212089 AAGCAGAGAGAGAAAACAGATGG + Intronic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1058017393 9:100050118-100050140 CTCCAGTGATGGAAAGTAGATGG + Intronic
1058459654 9:105171117-105171139 CAGCATAGAGAGAAAGAAGATGG + Intergenic
1058859671 9:109103693-109103715 ACTCAGAGATAGAGAGCAGAAGG + Intronic
1058971053 9:110083215-110083237 CCGTAGAGACAGAAAGTAGAAGG - Intronic
1059579232 9:115525681-115525703 GTCCAGAGCCAGAAAGCAGAAGG - Intergenic
1059591978 9:115671714-115671736 CTGGAGACAGAGAAAGCAGTTGG + Intergenic
1059703683 9:116800180-116800202 GTACAGAGACAGACAGCAGAAGG - Intronic
1059882848 9:118710848-118710870 CTGCATACATAGAAGGCAGATGG + Intergenic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1185652324 X:1657427-1657449 TTGCAGAGTCAGAGAGCAGATGG + Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188372742 X:29388733-29388755 CCATAGAGACAGAAAGCAGATGG + Intronic
1188402786 X:29768404-29768426 TTGCATAGCTAGAAAGGAGAGGG - Intronic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1188761450 X:34036315-34036337 CTGGAGTGTTAGAAAGCAAATGG + Intergenic
1189048650 X:37620310-37620332 CTCCAGAGAAAGAAAGCCCAAGG + Intronic
1189537600 X:41952323-41952345 CTGCAGAGATAGAAGTGTGATGG - Intergenic
1189795015 X:44637122-44637144 CTGTAGTGACAGAAAGCAGATGG - Intergenic
1190450395 X:50573703-50573725 CTGTAGAGACTGAAAACAGATGG - Intergenic
1191125245 X:56947333-56947355 CTGGTGAGACAGAAAGCATAAGG - Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1191979867 X:66913833-66913855 CTGAAGAGAAAGCAGGCAGAGGG - Intergenic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1195177830 X:102327838-102327860 ATGTAGAGAGAGGAAGCAGAGGG - Intergenic
1195181034 X:102359255-102359277 ATGTAGAGAGAGGAAGCAGAGGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195928722 X:110052004-110052026 ATGCAGAGATAAAAATCAGAAGG - Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1197253851 X:124242044-124242066 CTCCAGAGACACAAATCAGAGGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199062712 X:143377484-143377506 CAGGAGAGAGAGAGAGCAGAAGG + Intergenic
1199146328 X:144372471-144372493 CAGCAGAGAGAGAGAGCAGAAGG - Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1201610655 Y:15839704-15839726 CTGGAGTGATTGAAAGCAGTGGG - Intergenic
1201693837 Y:16800944-16800966 ATTCAGAGAGAGAAAGAAGAGGG - Intergenic
1201946070 Y:19511703-19511725 CTACACAGATAGAGAGTAGAAGG + Intergenic
1202013638 Y:20375986-20376008 CTGCATAGATAAAAAGAAGATGG + Intergenic