ID: 923688805

View in Genome Browser
Species Human (GRCh38)
Location 1:236173573-236173595
Sequence TGCTGCTGGTCAGCAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923688805_923688809 7 Left 923688805 1:236173573-236173595 CCTGCATTTGCTGACCAGCAGCA 0: 1
1: 1
2: 2
3: 19
4: 192
Right 923688809 1:236173603-236173625 TTCTGGTCCCACAAGCAATGTGG 0: 1
1: 0
2: 1
3: 9
4: 102
923688805_923688812 23 Left 923688805 1:236173573-236173595 CCTGCATTTGCTGACCAGCAGCA 0: 1
1: 1
2: 2
3: 19
4: 192
Right 923688812 1:236173619-236173641 AATGTGGTCTTCCCAGATGCTGG 0: 1
1: 0
2: 2
3: 20
4: 250
923688805_923688813 24 Left 923688805 1:236173573-236173595 CCTGCATTTGCTGACCAGCAGCA 0: 1
1: 1
2: 2
3: 19
4: 192
Right 923688813 1:236173620-236173642 ATGTGGTCTTCCCAGATGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 212
923688805_923688806 -10 Left 923688805 1:236173573-236173595 CCTGCATTTGCTGACCAGCAGCA 0: 1
1: 1
2: 2
3: 19
4: 192
Right 923688806 1:236173586-236173608 ACCAGCAGCACTGATCCTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923688805 Original CRISPR TGCTGCTGGTCAGCAAATGC AGG (reversed) Intronic
900427856 1:2588608-2588630 TGCTGGTGGTCAGCAAAGGTGGG + Exonic
901542829 1:9931932-9931954 GCCTTCTTGTCAGCAAATGCAGG - Exonic
901756796 1:11446300-11446322 TGCAGGTGCTCAGCACATGCCGG - Intergenic
906252210 1:44319363-44319385 TGCTCCTGGTCTCCAAGTGCCGG + Intronic
906794692 1:48687620-48687642 AGCTGCTGGTCAGCAGATCTGGG - Intronic
907424998 1:54373986-54374008 TCCTGCTGGACAGGAAAGGCAGG + Intronic
907853433 1:58278698-58278720 TGCTGCTGATCAGGAAAATCTGG - Intronic
909663503 1:78109108-78109130 AGATGGTGGTCAGCAACTGCTGG + Intronic
910371813 1:86524135-86524157 TGGCGCTGGCCTGCAAATGCTGG + Intergenic
911014516 1:93317947-93317969 TCCTGCTGTTCCTCAAATGCTGG + Intergenic
911698242 1:100918831-100918853 TGATGCTGGGCAGCAACAGCAGG - Intronic
917515303 1:175702220-175702242 TGCTGCTCCTCACCAAGTGCAGG - Intronic
920076552 1:203341507-203341529 TGCTGATGGTAAGCAAAGTCTGG + Exonic
920585797 1:207159001-207159023 TTCTCATGTTCAGCAAATGCAGG - Intergenic
920844107 1:209579121-209579143 TGCTCCTGATCAGCGAATGAGGG - Intergenic
921363436 1:214351640-214351662 TGCTTTTGATCAGCAAATCCAGG + Exonic
922337279 1:224627964-224627986 TGTTGCTGGTCAGCAAATGGAGG + Intronic
923688805 1:236173573-236173595 TGCTGCTGGTCAGCAAATGCAGG - Intronic
924755731 1:246939295-246939317 AGCTTCTAGTCAGCAATTGCAGG - Intergenic
1065719704 10:28614621-28614643 TGCTGCTTGTCAGCAGTTACAGG - Exonic
1066102604 10:32131323-32131345 TGCTGCTGGTTCACAAATACTGG - Intergenic
1069228743 10:65978864-65978886 AGCTGCTGTTTAGCAAATTCAGG + Intronic
1069684295 10:70307945-70307967 GGCTGCTGCTCAGCGGATGCAGG - Intronic
1070479484 10:76868450-76868472 TTCCAGTGGTCAGCAAATGCAGG - Intergenic
1070759613 10:79015901-79015923 TGCTGGTGCTCAGCAAACACAGG - Intergenic
1071086362 10:81872869-81872891 TGCTGCAGCTGGGCAAATGCAGG - Intergenic
1072543174 10:96413756-96413778 AGGGGCTGGTCAGCAAGTGCAGG + Intronic
1075014642 10:118901504-118901526 GGATGCTGGACAGCAAATGACGG - Intergenic
1076203947 10:128580160-128580182 TGCTGCTGGTGAGGAATTGAAGG - Intergenic
1076424883 10:130360876-130360898 TCCTGCTGGGCAGCAGCTGCGGG - Intergenic
1077382587 11:2251221-2251243 TGGTGCTTGTCAGCAGGTGCTGG - Intergenic
1077504499 11:2923825-2923847 TGCTGCTGGGAACCAGATGCTGG - Intronic
1080471617 11:32551452-32551474 TGCTGCTCATCAGTGAATGCTGG - Intergenic
1081106654 11:39078706-39078728 TGCAGCTGGCCAGCACCTGCTGG + Intergenic
1084910008 11:72381009-72381031 TTCTGCTGGGGAGCAAGTGCTGG - Intronic
1085393213 11:76193159-76193181 TTCTGCTGCTCAGCATAAGCTGG + Intronic
1088970479 11:114770574-114770596 TGCTGTTTATCACCAAATGCAGG + Intergenic
1089014724 11:115156663-115156685 TGCTGCTGGTCAGCAAATGAAGG - Intergenic
1090201463 11:124860827-124860849 TGCTGGTAATCAGCAGATGCTGG + Intergenic
1090656826 11:128852623-128852645 AGCTGCCCTTCAGCAAATGCTGG + Intronic
1091172024 11:133527981-133528003 AGCTGCTAGACAACAAATGCAGG + Intronic
1091293318 11:134454614-134454636 TGGAGCTGCTCAGCAAGTGCTGG + Intergenic
1091830295 12:3544496-3544518 TGCAGCTCGACAGCAAATACAGG + Intronic
1091916155 12:4272887-4272909 GGCGGCTTGTCAGCAGATGCAGG + Intergenic
1094785271 12:33841433-33841455 TGCTGCTGGGGACCAGATGCTGG + Intergenic
1096465888 12:51847705-51847727 TGTAGGTGATCAGCAAATGCTGG - Intergenic
1099671234 12:85695711-85695733 TGCTGCAGGCCAGCAAATGGAGG + Intergenic
1099917602 12:88915058-88915080 GGCTCCAGGGCAGCAAATGCTGG + Intergenic
1100411344 12:94322591-94322613 TGCTGCTGGCCAGAAAACACTGG + Intronic
1104109076 12:125688843-125688865 TGCTGCTGGTCCTCACATGCAGG - Intergenic
1106714951 13:32378032-32378054 TGCTGCAGGTCTGAAAATGAAGG + Intronic
1107457231 13:40566134-40566156 TGCTGCTGCTCTGCACATGCTGG - Intronic
1110315303 13:74099936-74099958 TGCTGCTGGGCACAAAATACAGG - Intronic
1110575396 13:77049161-77049183 TGCTGGAGGTCAGCAAGTGAAGG - Intronic
1113850943 13:113417586-113417608 GGCTGCTGGTCAGCAAACAAGGG - Intergenic
1114051345 14:18921406-18921428 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1114111217 14:19480519-19480541 TGCAGCTGGCCAGAAATTGCTGG + Intergenic
1114631975 14:24164894-24164916 CGTTGCTGGGCAGCAGATGCGGG - Exonic
1118623734 14:67637878-67637900 TGGCACTGGCCAGCAAATGCAGG - Intronic
1121936529 14:98024500-98024522 AGTAGCTGCTCAGCAAATGCTGG - Intergenic
1123012343 14:105355577-105355599 TGCTCCTGCTCAGCCAATCCTGG - Intronic
1123017825 14:105383988-105384010 TGCTGCTGGTCAACAGATTAAGG - Intronic
1124914845 15:33959701-33959723 TGGTCCTTCTCAGCAAATGCTGG + Intronic
1126890153 15:53196446-53196468 TGCTTATGGTCAGCAGAGGCCGG - Intergenic
1128311670 15:66634794-66634816 CGCTGCTGGTGTGCAAATGCTGG + Intronic
1128549909 15:68591382-68591404 TGCTGCTGGGCTGGAAATGGAGG + Intronic
1131400036 15:92117281-92117303 AGTTGCTAATCAGCAAATGCTGG + Intronic
1132116214 15:99138189-99138211 ACCTGCTGGGCAGCAAAGGCTGG - Intronic
1132874636 16:2130891-2130913 TGCTGCTGTCTCGCAAATGCTGG - Intronic
1134553578 16:15149724-15149746 TGCTGCTGTCTCGCAAATGCTGG - Intergenic
1135331707 16:21565835-21565857 TTCTGCTGCTAAGCAAATGCTGG + Intergenic
1137396399 16:48118436-48118458 TGGTGCTGCTCAGCAGCTGCTGG - Intronic
1138097788 16:54226053-54226075 AGCTGCTGGCAGGCAAATGCAGG - Intergenic
1138237725 16:55399137-55399159 TGCTGCCGGTCAGCAGATCCCGG - Intronic
1138412000 16:56847946-56847968 TTTTTTTGGTCAGCAAATGCTGG - Intronic
1138415975 16:56871512-56871534 AGCTGCAGGTCAGAAAATGCGGG - Intronic
1140454681 16:75098169-75098191 TGCAGCCGGTCAGCAACAGCTGG - Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1144060173 17:11576164-11576186 GGGTGCTGGTCAACACATGCAGG + Intergenic
1145254964 17:21317334-21317356 TGCTGCCTGACAGGAAATGCGGG - Intergenic
1145321639 17:21770630-21770652 TGCTGCCTGACAGGAAATGCGGG + Intergenic
1150918194 17:69457497-69457519 GGCTGCTGGTCTGCAAGTCCAGG - Intronic
1151364184 17:73606408-73606430 TGGGGCTGGTGAGTAAATGCTGG + Intronic
1151497295 17:74466537-74466559 TGGAGCCGGTCAGAAAATGCAGG - Exonic
1155060473 18:22223838-22223860 TGCTGGCGGTGAGCAACTGCGGG + Intergenic
1155250580 18:23949666-23949688 TGCAGCTTGTCAGCAAAAGGGGG - Intronic
1156352937 18:36316394-36316416 TTTTGCTGGTGAACAAATGCTGG - Intronic
1156397151 18:36708733-36708755 TGCTGCTTGACAGGGAATGCAGG - Intronic
1156823010 18:41395281-41395303 TGATGATGATCAACAAATGCTGG + Intergenic
1157829590 18:50844971-50844993 AGCTGCTGGTAAGAAAAAGCAGG + Intergenic
1158267105 18:55671694-55671716 TGCTGCTGGTCATGCAAGGCTGG - Intergenic
1159176595 18:64844004-64844026 TGATGCTAATTAGCAAATGCTGG - Intergenic
1160421804 18:78753197-78753219 ATCCACTGGTCAGCAAATGCAGG + Intergenic
1160421812 18:78753246-78753268 GTCCACTGGTCAGCAAATGCAGG + Intergenic
1160421821 18:78753295-78753317 GTCCACTGGTCAGCAAATGCGGG + Intergenic
1161700874 19:5794415-5794437 GGCTGCTGGTCTGGAACTGCTGG - Intergenic
1164863948 19:31588295-31588317 AGCTGCTGATCAGCAATTACAGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
925482079 2:4286259-4286281 TGCTTCTGGGCATCAAAAGCTGG - Intergenic
929095909 2:38263101-38263123 TGCTGCTGGTCTGGCACTGCTGG - Intergenic
929124674 2:38512403-38512425 GGCTGTTGGGCAGCAAAGGCTGG - Intergenic
931799776 2:65747455-65747477 TGCTGCTGGCTAGCACAGGCAGG + Intergenic
934300853 2:91775382-91775404 TGCTGCTGGACAGTAAGTCCTGG + Intergenic
935863756 2:107362819-107362841 TGCAGCAGGTCGGCAGATGCTGG + Intergenic
936227954 2:110674922-110674944 TGCTCCTGGGAAGCAAAGGCAGG - Intronic
936574499 2:113641978-113642000 AGCTGCGGTTGAGCAAATGCAGG + Intronic
937423559 2:121778430-121778452 GGCAGCTCGACAGCAAATGCAGG - Intergenic
938312529 2:130302305-130302327 TCCTGCTGGACAGAAATTGCTGG - Intergenic
944377041 2:199057697-199057719 GGATGCTGGACAGCAAATGAAGG - Intergenic
947599810 2:231439833-231439855 AGCTGCTGGTCACCAATTTCAGG - Intergenic
948251405 2:236532966-236532988 TGTATCTGGTAAGCAAATGCAGG + Intergenic
1169209982 20:3760415-3760437 AGCTGCAGCTCAGCACATGCTGG - Intronic
1170640728 20:18150393-18150415 TGCCGTTGGTCAGAAAATGCTGG + Intronic
1172650216 20:36497256-36497278 TGCTGCTGGTCAGCAGCTGTGGG + Intronic
1174203516 20:48823526-48823548 TGCTGCTGGTGTTCAAATCCAGG - Intronic
1174563945 20:51451347-51451369 TGCCACTGGTCAACAACTGCTGG - Intronic
1177703192 21:24664926-24664948 TCCTGCTTTTAAGCAAATGCGGG + Intergenic
1178899642 21:36588814-36588836 TGGGGATGGTCAGCAAATGCAGG - Intergenic
1178948568 21:36967155-36967177 TGCTGCTGGTTAGTAAAGGTTGG - Intronic
1179142843 21:38741869-38741891 AGATGCTGGGCAGCAAATGTGGG + Intergenic
1179343337 21:40533086-40533108 TGCAGTTAGTCAGCAAAAGCAGG + Intronic
1180469818 22:15643781-15643803 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1180898420 22:19353855-19353877 AGGTGCTGGTCAGCACAGGCAGG - Intronic
1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG + Intronic
1182266241 22:29117945-29117967 TTCTGCGGGTCAGGAAATGTGGG + Intronic
1185242611 22:49754762-49754784 TGCTGCCTGGCAGCAGATGCTGG - Intergenic
1185425671 22:50768905-50768927 AGCTGCGGTTGAGCAAATGCAGG - Intronic
949499400 3:4664782-4664804 TTTTGCTGGTAAGGAAATGCGGG + Intronic
950560068 3:13716000-13716022 TTCTGTTAGTCAGCAAATACAGG - Intergenic
951316681 3:21195830-21195852 TGCTGCTGGTCAGAATCTGCAGG - Intergenic
952549533 3:34460819-34460841 TGCTGCTGGTGATGAAATGAAGG + Intergenic
957160127 3:76600404-76600426 TGCTGCTGATAAGGACATGCAGG + Intronic
957877336 3:86164767-86164789 TTTTACAGGTCAGCAAATGCAGG + Intergenic
960092672 3:113657390-113657412 TGCTGCTGTTCAGCAACTGAAGG + Exonic
960342101 3:116486589-116486611 TGCTGCTGGCCAGAAAACACTGG - Intronic
960434287 3:117606678-117606700 TGCTGCAGGTCACCAAAAGCTGG - Intergenic
961413381 3:126739923-126739945 TGGTGCTGGTCATCATATGCAGG + Intronic
962498667 3:135966655-135966677 TCTTGGTGGTCAGCAAATGTAGG + Intronic
965139244 3:164814343-164814365 TGTGGCTGGTCAGCACCTGCTGG + Intergenic
967328303 3:188264672-188264694 TGCTGCTGGTCAGCTTTGGCAGG - Intronic
968002859 3:195219665-195219687 TGCTGCTGGGTGGCAAAGGCTGG - Intronic
968787415 4:2632964-2632986 TGCTGCTCTCCAGAAAATGCTGG + Intronic
969035381 4:4249195-4249217 TGCAGCTGCTCAGAAAATGTTGG - Intergenic
969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG + Intronic
969697737 4:8744634-8744656 TGTTGCTGGTGAGCAGGTGCAGG - Intergenic
970504827 4:16717302-16717324 TTCTGCAGGTCAGAAAAAGCAGG + Intronic
971170917 4:24231594-24231616 TGCAGCTGGGCAGCTAATTCGGG - Intergenic
972274269 4:37542268-37542290 TGCTGCTGGTGACCAAAAGTCGG - Intronic
974530849 4:63106313-63106335 GGTGGCTGGACAGCAAATGCAGG - Intergenic
974701411 4:65453486-65453508 TGCTGCTGATCACCAATTTCAGG - Intronic
975823295 4:78293444-78293466 TGCTCCTTGTCAGCAATTTCTGG + Intronic
976791067 4:88879523-88879545 TACTGCTGTTCACCAAATACTGG + Intronic
977785809 4:101033892-101033914 TGCTGGTGGTGAGCAAAAGAAGG - Intronic
983374979 4:166915010-166915032 TGATGCTGGTCAGGATTTGCTGG + Intronic
985023201 4:185713092-185713114 TGCTGCCGGCCAGCAAAGGAGGG - Intronic
985910322 5:2874461-2874483 GTCTGCTTGTGAGCAAATGCAGG + Intergenic
988882490 5:35518277-35518299 TGGTGATGGGCAGCAAAAGCTGG + Intergenic
991301595 5:65133940-65133962 TGCTGCTGCCCACAAAATGCAGG - Intergenic
991307004 5:65187854-65187876 TGCTGCTTGTCAGGAAATAAGGG - Intronic
993788693 5:92178158-92178180 TGCTGCTGGTTGGGAAATGGAGG - Intergenic
996125643 5:119722669-119722691 TGCTGCTGGCATGCAAATGGAGG + Intergenic
996850703 5:127948629-127948651 AGCTGATGGTTAGTAAATGCAGG - Intergenic
997382077 5:133445317-133445339 TGCTGCGGGGCAGCACAGGCCGG + Intronic
997382087 5:133445360-133445382 TGCTGCGGGGCAGCACAGGCCGG + Intronic
998989949 5:147804558-147804580 TGCAGCTGAGCAGGAAATGCAGG + Intergenic
1000025670 5:157356913-157356935 AGCTGATGTTCAGCAAATCCTGG - Intronic
1000648810 5:163790200-163790222 TGCAGCTGCACAGCAAATGCTGG + Intergenic
1002549679 5:179978015-179978037 TGGTGCTGTTCAGCAGGTGCGGG - Intronic
1002648328 5:180673447-180673469 TCCTGGTGGTCAGCGCATGCTGG - Intergenic
1004890438 6:20095939-20095961 TAGTGCTGGTCACTAAATGCAGG + Intergenic
1005176211 6:23047457-23047479 TGCTTCTAGTCAGCAAAAGCAGG - Intergenic
1006381827 6:33703097-33703119 TGCTGCTGGTCAGCTTGTCCAGG + Intronic
1011388295 6:86821573-86821595 TGCTGATGGTGAGAAAATGGTGG - Intergenic
1015300241 6:131644748-131644770 TGGTGCTTGTCAGCATATGTGGG + Intronic
1015634000 6:135258165-135258187 TGTTGGGGGTCAGCAAATGATGG - Intergenic
1017880268 6:158558061-158558083 TGACGCTGGACAGCAAATCCAGG + Intronic
1018921969 6:168181635-168181657 TGCAGGTGCTCAGTAAATGCTGG - Intergenic
1019100583 6:169626185-169626207 AGCTGCTGGGGAGCAACTGCAGG + Intronic
1021962954 7:25890905-25890927 TTCTGCAGATGAGCAAATGCAGG + Intergenic
1024408396 7:49009747-49009769 TGCTGATGGTCACCAGAAGCAGG + Intergenic
1024552961 7:50578745-50578767 TGCTGCCAGTCAGCACATGATGG + Intergenic
1026782077 7:73275012-73275034 TGCTGTTGGTCATCACAGGCAGG + Intergenic
1027065084 7:75117448-75117470 TGCTGTTGGTCATCACAGGCAGG - Intronic
1031335069 7:120518995-120519017 TGTTGCTGGTTTGCAAATGGAGG + Intronic
1031387273 7:121167094-121167116 TGCTGATTAACAGCAAATGCTGG + Intronic
1032155722 7:129466030-129466052 TGCTGCTGCTCAGCAAACACTGG - Intronic
1032188218 7:129745909-129745931 TCCTGGTGGTCTGCAAAAGCAGG + Intronic
1032954196 7:136951446-136951468 TACAGCTGGTCAGCAAAGCCAGG - Intronic
1033666353 7:143444336-143444358 TTCTGCTCTTCAGCAACTGCAGG + Exonic
1039444887 8:37623111-37623133 TGCTGCTGGACACCCCATGCTGG + Intergenic
1042180181 8:66079900-66079922 TCCTGCTGGTCACCAAGTCCTGG - Intronic
1043208267 8:77475567-77475589 TGCTGAAGCCCAGCAAATGCTGG - Intergenic
1044365667 8:91342348-91342370 TGGTGGTGGAAAGCAAATGCTGG - Intronic
1046019201 8:108643664-108643686 TGTTGCTGGTCTCCAAATCCTGG - Intronic
1047606736 8:126482019-126482041 TGCTGGAGGTCAATAAATGCCGG - Intergenic
1048576246 8:135692248-135692270 TGCTGGTTGTCAGGAAATGTAGG + Intergenic
1050869167 9:10544573-10544595 GGTTGCTGGTTAGCAAATGATGG - Intronic
1054916932 9:70503317-70503339 GACTGCTGGTAAGTAAATGCAGG + Intergenic
1058943019 9:109831696-109831718 TACTGATGGTCAAGAAATGCTGG - Intronic
1059605144 9:115826129-115826151 TGCTGATGGTCAGCCATGGCAGG - Intergenic
1059737020 9:117111041-117111063 AGCTGCTGCTCACCAAAGGCAGG + Intronic
1060917354 9:127398940-127398962 TGCTGCCGGTTAGCAAACGTTGG - Intronic
1061565775 9:131438843-131438865 TGCTGCTGCTCAGAAAGTGGTGG + Intronic
1186224131 X:7379065-7379087 TGTTGCTGGTTTGGAAATGCAGG - Intergenic
1187789474 X:22934033-22934055 TGCTGCTGTTCAGAAAATAGCGG - Intergenic
1188451026 X:30308491-30308513 TGGTGCTGGTGCGCAACTGCTGG - Exonic
1188506929 X:30892987-30893009 TGCTGTGGGTCAGCAAATTGGGG + Intronic
1190844074 X:54174894-54174916 TGCTTCTGGTATGCAAATCCTGG + Intronic
1191223486 X:58016001-58016023 TGCTGCTGGCCAGAAAACACTGG - Intergenic
1192548286 X:72031655-72031677 AGCTGGTTCTCAGCAAATGCTGG + Intergenic
1192764987 X:74130881-74130903 TGATATTGGTCAGCAAATTCAGG + Intergenic
1196155339 X:112422488-112422510 TGATGCTAGTCAGCAAAGGGGGG + Intergenic
1197073115 X:122323975-122323997 TTCTCATGTTCAGCAAATGCTGG + Intergenic
1199544725 X:148995865-148995887 TGCTGCTCACCAGCAACTGCTGG - Exonic
1200315442 X:155127734-155127756 TCCTGCTGGTCAGTCAAGGCAGG + Intronic