ID: 923694972

View in Genome Browser
Species Human (GRCh38)
Location 1:236239565-236239587
Sequence TCAGTGTCACAGATGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923694972 Original CRISPR TCAGTGTCACAGATGGCCCA GGG (reversed) Intronic
900970450 1:5989794-5989816 TCAGTGCCACACTTGGCCCAAGG + Intronic
901428204 1:9196968-9196990 TCCGTGTCCCACATGTCCCAGGG + Intergenic
902270968 1:15304764-15304786 CCAGTGTCTCAGATGCCCCAGGG + Intronic
903306089 1:22414305-22414327 TCAGTGTCAGAAATGGGCCGAGG - Intergenic
905662791 1:39740131-39740153 TCAGTGGCTCAGAAGGCCCTTGG + Intronic
913183619 1:116346207-116346229 TTTGTATCACAGATGGCCCTGGG + Intergenic
914394579 1:147252829-147252851 TCAGTTTCACAAATGTCCCTGGG + Intronic
915621679 1:157090014-157090036 TCACAGTCACAGATGGCCAGAGG + Intergenic
919748345 1:201022252-201022274 TCTGGGTCACATATGACCCAAGG + Intronic
919798154 1:201333765-201333787 TGACTGGCACTGATGGCCCACGG - Intergenic
923694972 1:236239565-236239587 TCAGTGTCACAGATGGCCCAGGG - Intronic
923889521 1:238196971-238196993 TCAGAGTCTCAGATGGAGCATGG + Intergenic
924260260 1:242222500-242222522 TCAGTGTCACAGAGGGTTCGAGG - Intronic
1064031786 10:11887376-11887398 ACAGGGTCACAGATGGCCCCAGG + Intergenic
1066015689 10:31241262-31241284 TAGGTCTTACAGATGGCCCAGGG + Intergenic
1066671297 10:37843113-37843135 TCAGTGTCACATATAGAACAAGG + Intronic
1067251451 10:44590157-44590179 TCAGTCTCACTGATTGCTCAAGG - Intergenic
1067808478 10:49409397-49409419 TCTGTGTCACAGATGACAAATGG - Intergenic
1068813745 10:61286168-61286190 GCAGTCTCTGAGATGGCCCAAGG - Intergenic
1069100604 10:64315844-64315866 TCACTGTGACATATGGCACATGG - Intergenic
1069100717 10:64317062-64317084 TCATTGTGACATATGGCACATGG - Intergenic
1070814547 10:79314418-79314440 TCACTGTCCCAGACGGCACAAGG + Exonic
1075013541 10:118894454-118894476 TCGGTGTCTGAGATGGTCCAAGG - Intergenic
1075408462 10:122210415-122210437 TCCCTGTCCCTGATGGCCCACGG + Exonic
1075435392 10:122436690-122436712 TCAGAGACTGAGATGGCCCATGG + Exonic
1077045070 11:541079-541101 TCAGTGACACAGACGTCCCCAGG + Intronic
1077119561 11:900562-900584 ACAGGGGCACAGATGGGCCAGGG + Intronic
1078107298 11:8366345-8366367 TCAGTCTCACTGAAGGCCCCAGG + Intergenic
1081159751 11:39736904-39736926 TCAGTGTCTGTGATGGTCCAGGG - Intergenic
1084549351 11:69831582-69831604 TTCGTCTCACAGATGGCCTAAGG - Intergenic
1086344913 11:85886535-85886557 TCAGTTTCACAGGTGGTCCTGGG - Intronic
1086660570 11:89411240-89411262 TCAGTCTCACCCAAGGCCCATGG - Intronic
1089853822 11:121523067-121523089 TCAGGGACACAAATGGTCCATGG + Intronic
1089935060 11:122356125-122356147 TCAGTGTCACAGCTGGTAAATGG + Intergenic
1090940203 11:131380693-131380715 TGAGTGTCACATTTGTCCCAGGG - Intronic
1091603813 12:1934044-1934066 TCACTGTCAGAGGTGGCCCCTGG - Intergenic
1091904005 12:4168211-4168233 TCAGCGTCACAGAGGCCCTAGGG + Intergenic
1094644245 12:32305984-32306006 TCAGTTTCACAAGAGGCCCATGG - Exonic
1095975538 12:47938669-47938691 TCAATGTCACACATGTCACAGGG + Intronic
1096937050 12:55292276-55292298 CCTGTGCCACATATGGCCCATGG - Intergenic
1098428263 12:70390789-70390811 TTAGTGTCACAATAGGCCCAGGG - Intronic
1098468162 12:70812642-70812664 TCACTGTGACAGATTGCCAAGGG - Intronic
1101867873 12:108535573-108535595 TTAGTGTTACAGATGTCCCTGGG + Intronic
1102024132 12:109703892-109703914 TCATGGTCCCAGATGACCCAGGG + Intergenic
1102640137 12:114360242-114360264 TCATTCTGACAGATGGCCCCAGG + Intronic
1104960365 12:132485793-132485815 GCATTGTCACTGAGGGCCCAGGG + Intergenic
1111255660 13:85664145-85664167 TCAATGTCACAGATGTCTAAAGG - Intergenic
1111718693 13:91913696-91913718 TCAGAGTCACAGATGGAAAAGGG - Intronic
1113964777 13:114146705-114146727 TCAGTCTCAGCCATGGCCCATGG + Intergenic
1119544084 14:75459358-75459380 TCAGTTTCAAAGAAGGCCAAGGG + Intronic
1119718655 14:76876349-76876371 TCAGTGACACAGATTGCACCAGG + Intergenic
1120652671 14:87152977-87152999 TCACTGTCACTGAAGGCACACGG + Intergenic
1121277746 14:92679302-92679324 GCAGTGTCACACCTTGCCCATGG + Intronic
1121774621 14:96582609-96582631 TGGGTGTAACAGAGGGCCCAGGG - Intergenic
1121878195 14:97474285-97474307 TCAGGGTTACTGGTGGCCCAAGG - Intergenic
1122387558 14:101359380-101359402 TCAGTGTCACAGCTGACCACAGG - Intergenic
1123739376 15:23220939-23220961 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1124290595 15:28449891-28449913 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1128714198 15:69895147-69895169 ACTGTGTCACAGATTTCCCAAGG - Intergenic
1129868925 15:78928763-78928785 TCAGCGACACAGATGGGCCAAGG + Intronic
1130032546 15:80328838-80328860 TCAATGTCACAGTGGCCCCAAGG + Intergenic
1132343191 15:101090917-101090939 TAACTGGAACAGATGGCCCAGGG + Intergenic
1133199285 16:4192714-4192736 TCAATGTCACAGAGCCCCCAAGG - Exonic
1133321838 16:4918958-4918980 TCAGTGGGGCTGATGGCCCAGGG - Intronic
1134406923 16:13969262-13969284 TCAGTTTCACCCAAGGCCCATGG + Intergenic
1136708153 16:32207750-32207772 TCAGAGTCACAGATGGAAAAGGG + Intergenic
1136759755 16:32721660-32721682 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1136808349 16:33148726-33148748 TCAGAGTCACAGATGGAAAAGGG + Intergenic
1138516321 16:57536970-57536992 TCGGTGGCAGAGCTGGCCCAGGG - Intergenic
1140003981 16:71056602-71056624 TGAGTGTGACAGATGGCTGACGG + Intronic
1141026916 16:80557364-80557386 AAAGTTTCACAGATTGCCCAAGG + Intergenic
1141513146 16:84525407-84525429 TCAGTGTCAGACACGTCCCACGG + Intronic
1141818772 16:86431043-86431065 TCAGTATCACAGAGGGCTCTTGG - Intergenic
1142212167 16:88813428-88813450 TCTGTCTCCCAGATGGCCCGAGG + Intergenic
1203061909 16_KI270728v1_random:981967-981989 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1143265580 17:5634637-5634659 TCAGTGTTACACTTGGCACAGGG + Intergenic
1146686780 17:34846429-34846451 GCAGCTTCCCAGATGGCCCAGGG + Intergenic
1148159753 17:45443266-45443288 TCTGGGCCACAGATGGCCCTGGG - Intronic
1150391039 17:64790138-64790160 TCTGGGCCACAGATGGCCCTGGG - Intergenic
1152126291 17:78449359-78449381 TCAGTGACACCGCTGGTCCACGG + Intronic
1152192744 17:78898457-78898479 TCAGGGTCACAGGAGGGCCAGGG - Intronic
1152646195 17:81469577-81469599 TGAGGCTCACAGGTGGCCCAAGG + Intergenic
1153152017 18:2106406-2106428 TCAGGGTCTCAAATGGCCAATGG - Intergenic
1154141998 18:11832428-11832450 TCAGTGCCAAAGAGGGCCAATGG - Intronic
1154165673 18:12012459-12012481 GCAGTGTCACAAATAGACCACGG - Intronic
1156818354 18:41340001-41340023 TGATTCTCACAGATGCCCCATGG + Intergenic
1157147532 18:45179596-45179618 TCAGTGTCACTGAATGCCGAAGG + Intergenic
1157170830 18:45403579-45403601 GCAGTGGCACAGATGGAGCATGG + Intronic
1157789241 18:50516690-50516712 TCAGTCTCATATATGGCCCCAGG - Intergenic
1158729780 18:60010587-60010609 TCAGTGTCACTCAACGCCCACGG + Intergenic
1159038280 18:63298330-63298352 TTGGTTTCCCAGATGGCCCATGG - Intronic
1162119779 19:8456597-8456619 TCAGTGACAGAGATGCCCCGTGG + Intronic
1165894069 19:39131161-39131183 TCAGTGACACTGAAGCCCCAAGG - Intronic
926313014 2:11688059-11688081 TGAGTGTCAGTGGTGGCCCAGGG + Intronic
926393797 2:12421209-12421231 TCAGTGTGTCACATGACCCAAGG + Intergenic
928694628 2:33836804-33836826 TCCGTGCCACAGGTGGTCCAGGG - Intergenic
929494005 2:42423554-42423576 TAAGTGTCACAGATCGTCAAGGG + Intronic
929794311 2:45047335-45047357 TCCCTGGCACAGATGGCCCGTGG + Intergenic
930384617 2:50678523-50678545 TCAGTGATACAGATGGCTGAAGG - Intronic
931720468 2:65063685-65063707 GCAGTGTTACAGATGGCCACCGG + Intronic
934098001 2:88625520-88625542 CCAGTGTCAGGGATGTCCCAAGG - Intronic
934126090 2:88892336-88892358 TCTGTGTCAGTGATGGCTCAGGG - Intergenic
937278040 2:120698635-120698657 CAAGTGTCACAGGTGGCCCATGG + Intergenic
938406209 2:131034733-131034755 CCAGTGGCACAGATGGCCACGGG - Intronic
938597211 2:132800420-132800442 ACAGTGTGACAGATGACACAAGG - Intronic
944168363 2:196747889-196747911 TCAGTTTCAGAGATGGAACATGG - Intronic
947212849 2:227723680-227723702 TCAGTGACACTGATGACCAAAGG + Intergenic
947912350 2:233809575-233809597 TCAGTGTCAGAGAGGGCCAGAGG - Intronic
948029573 2:234806018-234806040 TCAGAAACACTGATGGCCCATGG - Intergenic
948258893 2:236588740-236588762 AAAATGTCACAGATGGCCGAGGG + Intergenic
1169388414 20:5170156-5170178 TGAGTGTCAGAGCTGGCCCTGGG + Intronic
1170131242 20:13022572-13022594 TCAGTGTCACACCTGGCACCTGG + Intronic
1171282151 20:23910075-23910097 GAAGTGTCTCAGGTGGCCCAGGG - Intergenic
1172327454 20:34047529-34047551 TGAATGGCAGAGATGGCCCATGG - Intronic
1173310569 20:41892891-41892913 TCAGTACCACAGATGGCTTATGG - Intergenic
1173474803 20:43351516-43351538 TCAGTGGCACAGACGACCCCAGG - Intergenic
1174543027 20:51304531-51304553 CCACTGTCACAGATAGCACAAGG + Intergenic
1174561515 20:51433904-51433926 TCAGTCTCCCAGTTGGGCCAGGG - Intronic
1174571957 20:51508420-51508442 GCAGTGCCACAACTGGCCCACGG + Intronic
1176219066 20:63961487-63961509 TCAGAGTCAGCGGTGGCCCAAGG + Intronic
1178861507 21:36293489-36293511 TTCCTGTCACAGATAGCCCAAGG + Exonic
1181430999 22:22881723-22881745 TTAGTGTCTCAGAAGGCACAGGG + Intronic
1182278857 22:29206618-29206640 TCAGTGTCGGAGATACCCCAGGG + Intronic
1184147405 22:42619580-42619602 GCTGTGTCCCAGATGGGCCACGG - Exonic
1184477803 22:44730805-44730827 TCAGTGGCCCAGAGGACCCAGGG - Intronic
1184913405 22:47550808-47550830 ACAGTGTCAGAGACAGCCCAGGG - Intergenic
950203400 3:11060626-11060648 TCAGTTTCACAGATGAGGCATGG + Intergenic
950363149 3:12463999-12464021 TCAGTGCCAGGCATGGCCCATGG - Intergenic
950547963 3:13650010-13650032 TCAGTGTCACCCACAGCCCATGG - Intergenic
950647122 3:14383771-14383793 TCAGGGCCACAGCTGGGCCAGGG - Intergenic
952219218 3:31307532-31307554 TCAGAGTCACTTTTGGCCCAGGG - Intergenic
952750397 3:36820398-36820420 TCTGTTTCACAGATGGACCAAGG - Intergenic
953116806 3:40000761-40000783 TCATTCTGACAGATGGCCCTGGG + Intronic
953207320 3:40842825-40842847 TGAGTGTCAGAGATGGCTCAAGG - Intergenic
953420993 3:42753080-42753102 CCAGAGTCATAGAAGGCCCAAGG - Intronic
953923841 3:46970448-46970470 TGAAAGTCACAGGTGGCCCATGG + Intronic
954431587 3:50473563-50473585 GCAGTATCACAGCTGGGCCAGGG + Intronic
956548940 3:70438072-70438094 TCAGTGTCTGAGATGGTCTACGG + Intergenic
960860267 3:122145403-122145425 TCAGTGTTACTGAGGGCCTAAGG - Intergenic
961111849 3:124291029-124291051 TCAGTACCCAAGATGGCCCATGG - Intronic
961427681 3:126860890-126860912 TTCTTTTCACAGATGGCCCAAGG + Intronic
962845228 3:139267989-139268011 TCAGTGACACAGATCAGCCATGG - Intronic
963020482 3:140868793-140868815 TGAGTGTCACCCAAGGCCCATGG + Intergenic
963982886 3:151559923-151559945 TCCGTGACTCAGATGACCCAAGG - Intergenic
964353823 3:155830437-155830459 TCAATGTCACAGAAGGACCAAGG - Intronic
964689478 3:159434276-159434298 TCAGTGTCCCAGAGGGACCCAGG - Intronic
964882706 3:161442043-161442065 TCAGACTCAGAGATGCCCCAAGG - Intergenic
965805133 3:172534106-172534128 TGAGTGTCCCTGATGGCCGAGGG + Intergenic
968578032 4:1376964-1376986 TCCGTGTCACACCTGGCCCTGGG - Intronic
969509277 4:7608427-7608449 TAAGTGACAGAGATGGCCCCTGG - Intronic
969596435 4:8151814-8151836 TCAGTGGAACAGATGGGCCCTGG + Intronic
969938727 4:10708829-10708851 ACAGTGTCACAGAAGGAGCACGG + Intergenic
970846068 4:20538953-20538975 TCAATGTCAAACATGGTCCAGGG - Intronic
973206017 4:47560943-47560965 TCAGTGTCACTCATGACCTACGG - Exonic
973531539 4:51841880-51841902 TGAGGCTCCCAGATGGCCCAGGG + Intergenic
974269459 4:59632218-59632240 TTATTGTCACATATGACCCATGG + Intergenic
974794964 4:66736833-66736855 TCAGTGTGAAAGGTGGCCCTTGG + Intergenic
975857368 4:78639051-78639073 TCAGTGTCACAGAGGTCACCTGG - Intergenic
976871048 4:89793998-89794020 TCAGTGTCTCAGTGGGCCCTTGG - Intronic
978257322 4:106708398-106708420 TCAGTGTGCCCGAGGGCCCAGGG - Intergenic
981482678 4:145254755-145254777 TCAGCGTCCGTGATGGCCCAGGG + Intergenic
985028386 4:185762567-185762589 CCAGTGTCACAGAAGGCAAAGGG + Intronic
985673273 5:1217251-1217273 ACCGTGTTACAGATGGCCCCAGG - Intronic
986103167 5:4632408-4632430 TTAGTGTAACACATGGCACAGGG - Intergenic
992213143 5:74500618-74500640 TGAGGGTTACAAATGGCCCAGGG - Intergenic
992551053 5:77860500-77860522 TCACTGTCACTGATGGGGCATGG + Intronic
994000349 5:94772283-94772305 ACAGTGTGACAGGTGGCACAGGG - Intronic
994517589 5:100790458-100790480 TCAGTGCTACAGGTGGCCCCTGG - Intergenic
996081434 5:119262270-119262292 GCAATCTCACAGGTGGCCCAAGG - Intergenic
997466669 5:134092706-134092728 TCAGTGTCAGAGGTCACCCAAGG - Intergenic
999486805 5:152004897-152004919 CCCTGGTCACAGATGGCCCAGGG - Intergenic
999793980 5:154970461-154970483 TTATTTTCACATATGGCCCAAGG + Intergenic
1001970263 5:175949671-175949693 GCAGTGTCACAGGTGGCCTCCGG - Intronic
1002185420 5:177452550-177452572 GCAGTGCCACAGCAGGCCCACGG - Intronic
1002247175 5:177894093-177894115 GCAGTGTCACAGGTGGCCTCCGG + Intergenic
1002526248 5:179817415-179817437 TCAGTGCCCCTGAGGGCCCAGGG + Intronic
1004168961 6:13280973-13280995 TCAGAGTCACAGTTGGTGCACGG - Intronic
1008227307 6:48936455-48936477 TCAGTCTCACCCAAGGCCCATGG + Intergenic
1009027630 6:58018812-58018834 TCAGTGCCTCTGATGACCCATGG + Intergenic
1009203163 6:60770289-60770311 TCAGTGCCTCTGATGACCCATGG + Intergenic
1009827072 6:68880295-68880317 GCAGTGTTACAGATGGCCTATGG + Intronic
1014594358 6:123314690-123314712 GCAGTGACACAGATGGAACAAGG + Intronic
1015298908 6:131630733-131630755 TCAGTGTCACAGTGCTCCCACGG - Intronic
1016054476 6:139565349-139565371 TGAGTCTCACCCATGGCCCATGG + Intergenic
1017864491 6:158431398-158431420 TGAGCCTCACAGATGGCTCATGG - Intronic
1017945745 6:159095011-159095033 GCAGTGCCAAATATGGCCCATGG + Intergenic
1023758707 7:43444368-43444390 GCAGTGTCCCCGATGGTCCAGGG + Exonic
1024557818 7:50618574-50618596 TCAGAGTCAGAAATGGCCCTGGG + Intronic
1027893014 7:84001363-84001385 CCTGAATCACAGATGGCCCAGGG - Intronic
1028112735 7:86962048-86962070 TCAGAGTCACATATACCCCAGGG + Intronic
1029067023 7:97860400-97860422 TCAGGCTCAAAGAAGGCCCAGGG + Intronic
1034498766 7:151436963-151436985 TCTGCGTCACAGCTGGCCCCAGG + Intronic
1034948389 7:155279494-155279516 GCAGTGTCACAGATGGGCGAGGG + Intergenic
1035312043 7:157975592-157975614 TGAGTGTCACAGATGTCACATGG + Intronic
1035579054 8:728473-728495 CCAGTGTCACAGATCTCCCAGGG - Intronic
1037507554 8:19546864-19546886 TCAGTGTCACATAAGGTTCAGGG + Intronic
1038679062 8:29650048-29650070 TCAGAGTCACTGAGGACCCAAGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1041442860 8:57916996-57917018 TGGGTGTCAGACATGGCCCACGG - Intergenic
1041556750 8:59165707-59165729 TCACTGTGCCAGATGGCGCATGG + Intergenic
1043072414 8:75655577-75655599 TCAGTAATACAGATGGCCAACGG - Intergenic
1045436341 8:102168632-102168654 TCAGTGACACACTGGGCCCATGG + Intergenic
1046013930 8:108583452-108583474 TCAGTGTCACATGTTGCCCTAGG - Intergenic
1047422193 8:124716477-124716499 TCAGTGGCTCAGGTGACCCAGGG + Intronic
1047622648 8:126623562-126623584 TCAGATTCACACATGGCCCCAGG + Intergenic
1047794569 8:128241306-128241328 TCAGAGTGACATTTGGCCCATGG + Intergenic
1048005894 8:130419148-130419170 TCAGTCAAACAGATGGTCCAAGG + Intronic
1048330080 8:133465283-133465305 TCAGTGTACCAGGTGTCCCATGG - Intronic
1048706232 8:137156344-137156366 TGAGTGTCACCCAGGGCCCACGG + Intergenic
1049574945 8:143385640-143385662 ACTGTGTCACAGATGGGCCGAGG + Intergenic
1050553641 9:6770519-6770541 TCAGTGTCACAGATTGCATATGG + Intronic
1050930199 9:11312766-11312788 TGAGTCTCACACAAGGCCCATGG + Intergenic
1051100653 9:13517266-13517288 TCAATGTGACAGATGAACCAAGG - Intergenic
1052863796 9:33453025-33453047 TCTGAGTCACAGCTTGCCCAGGG + Intergenic
1055549292 9:77415775-77415797 TCAATGGCCCAGATGGCTCAGGG - Intronic
1055712652 9:79081072-79081094 TAATTGTTACAGATGGTCCAAGG - Intergenic
1057053900 9:91947293-91947315 TGAGTGTCACATAGGGTCCACGG + Intronic
1060184263 9:121554263-121554285 TCAGTGTCTCAGATGCCCCTAGG - Intergenic
1060432324 9:123561135-123561157 TCTGCGGCACAGGTGGCCCAAGG - Intronic
1061435361 9:130557900-130557922 TCAATGTCACAGAAGTGCCATGG - Intergenic
1061930390 9:133829563-133829585 TCAGTGTCACAGATCATCCTTGG - Intronic
1061957900 9:133973116-133973138 CCAGTGCCACGGAGGGCCCAAGG + Intronic
1062179589 9:135184113-135184135 TCAGTGACAAAGCTGTCCCATGG - Intergenic
1062234594 9:135501736-135501758 TCGGTGTCACAGAAGGCACTTGG + Intronic
1186602793 X:11056350-11056372 GCAGAGTCACAGCTGGCTCATGG - Intergenic
1188968558 X:36584144-36584166 TAAACGTCACAGATGGCCCAGGG + Intergenic
1189456175 X:41192620-41192642 TCAGTTTGACAGAAGGCCTATGG + Intronic
1190633383 X:52411143-52411165 TGAGTGTCCCACAAGGCCCATGG + Intergenic
1191991240 X:67039083-67039105 TGAGTATCACACATGGCCCATGG + Intergenic
1192372708 X:70528182-70528204 CCTGTGTCACAGATGCCCCTTGG - Intergenic
1192773684 X:74219885-74219907 TCACTGTCACATATCTCCCACGG - Intergenic
1193563384 X:83047678-83047700 TCAGTCTCACCCAAGGCCCATGG + Intergenic
1197429410 X:126342280-126342302 GCAGGTTCACTGATGGCCCAGGG - Intergenic
1201407024 Y:13659857-13659879 TCAGTCTCACAGATTCCTCAGGG + Intergenic
1201620846 Y:15955961-15955983 TCAGTGTGACACATTGCACATGG + Intergenic