ID: 923698162

View in Genome Browser
Species Human (GRCh38)
Location 1:236275280-236275302
Sequence GAGCCACTTGTTCTTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923698157_923698162 5 Left 923698157 1:236275252-236275274 CCCACTCCTGACACAAATCTCAG 0: 1
1: 0
2: 0
3: 13
4: 189
Right 923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 241
923698158_923698162 4 Left 923698158 1:236275253-236275275 CCACTCCTGACACAAATCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 162
Right 923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 241
923698154_923698162 18 Left 923698154 1:236275239-236275261 CCCACAAGATGGCCCCACTCCTG 0: 1
1: 0
2: 2
3: 31
4: 382
Right 923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 241
923698160_923698162 -1 Left 923698160 1:236275258-236275280 CCTGACACAAATCTCAGGTCCTG 0: 1
1: 0
2: 1
3: 20
4: 302
Right 923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 241
923698156_923698162 6 Left 923698156 1:236275251-236275273 CCCCACTCCTGACACAAATCTCA 0: 1
1: 1
2: 2
3: 23
4: 291
Right 923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 241
923698155_923698162 17 Left 923698155 1:236275240-236275262 CCACAAGATGGCCCCACTCCTGA 0: 1
1: 0
2: 2
3: 20
4: 211
Right 923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923698162 Original CRISPR GAGCCACTTGTTCTTCTGAC TGG Intronic
900878366 1:5362590-5362612 GAGCCACTTGCTATTGTGACTGG + Intergenic
902167086 1:14581347-14581369 GAGCCACAGGTTTTGCTGACAGG - Intergenic
904702741 1:32367673-32367695 GAGCCACTTTTGATTCTGAGAGG + Intronic
906766946 1:48442211-48442233 GTGCCACTAGTTCTGCTAACTGG - Intronic
910397052 1:86804011-86804033 GTGCCACTAGTTCTGCTAACTGG + Intergenic
910684339 1:89901077-89901099 AAGCCATTTGGTCTTCTGATAGG - Intronic
911751778 1:101504040-101504062 GTGCCACTAGTTCTGCTAACTGG - Intergenic
912021684 1:105114167-105114189 GTGCCACTAGTTCTGCTAACTGG - Intergenic
915260975 1:154676630-154676652 GTGCCACTAGTTCTGCTAACTGG - Intergenic
916084061 1:161255550-161255572 GTGCCACTAGTTCTGCTAACTGG - Intergenic
916939933 1:169667166-169667188 GTGCCACTAGTTCTGCTAACTGG - Intronic
917280281 1:173373016-173373038 GTGCCACTAGTTCTGCTAACTGG - Intergenic
918749923 1:188259515-188259537 GTGCCACTAGTTCTGCTAACTGG + Intergenic
919257175 1:195139923-195139945 GTGCCACTAGTTCTGCTAACTGG - Intergenic
919559092 1:199095679-199095701 GTGCCACTGGTTCTGCTAACTGG - Intergenic
921020100 1:211227344-211227366 GTGCCACTAGTTCTGCTAACTGG - Intergenic
922606492 1:226892808-226892830 ATGCCACTTGTGCTTCTGACCGG + Intronic
923341566 1:233011946-233011968 GGGCCACCTGAACTTCTGACTGG - Intronic
923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG + Intronic
924182028 1:241448497-241448519 GAGCCTCTGTTTCTTCTCACTGG + Intergenic
924384846 1:243490935-243490957 GAGCCACTAGGTCTCCTGGCAGG + Intronic
1063101052 10:2950642-2950664 GAGCCACTTGGTCTTCCTGCTGG - Intergenic
1063321309 10:5055096-5055118 GTGCCACTAGTTCTGCTAACTGG + Intronic
1063415074 10:5866452-5866474 GTGCCACTAGTTCTGCTAACTGG - Intronic
1066614184 10:37279496-37279518 GTGCCACTAGTTCTTCTAACTGG + Intronic
1069364822 10:67686225-67686247 GTGCCACTAGTTCTGCTAACTGG + Intronic
1071835129 10:89410579-89410601 GTGCCACTAGTTCTCCTAACTGG - Intronic
1073971150 10:109046418-109046440 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1075772222 10:124948992-124949014 GAGCCAGTTTTACTTCTCACTGG + Intronic
1076738886 10:132471348-132471370 AAACCACTGGTTCTTCTGAGGGG + Intergenic
1078392703 11:10950622-10950644 GATCCACTTGTTAGTCTGATGGG + Intergenic
1079237706 11:18701626-18701648 CAGCCACTGGCTCTTCGGACAGG + Exonic
1081421844 11:42880117-42880139 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1082742604 11:56927221-56927243 TTGCCACTTTTTCTTCTGCCTGG + Intergenic
1084029724 11:66474085-66474107 GAGCCACTTGTCCCACAGACAGG + Intronic
1085129086 11:74022278-74022300 GAGATACTTGTGCTTCTGGCAGG + Intronic
1085153465 11:74271255-74271277 GAGCCAATTGTTGTTCTCATCGG - Intronic
1086053952 11:82626485-82626507 GCACCACTTGTTCTGCTAACTGG - Intergenic
1086317800 11:85611615-85611637 GTGCCACTAGTTCTGCTAACTGG - Intronic
1088042424 11:105403581-105403603 CAGCCAGTCGTACTTCTGACAGG + Intergenic
1088438766 11:109844791-109844813 AAACCACTTGTTCTACTGAAAGG - Intergenic
1088492944 11:110404524-110404546 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1090464133 11:126918443-126918465 AAGCTGCTTGTTCCTCTGACAGG + Intronic
1090773035 11:129938563-129938585 TGGCCACTTGGCCTTCTGACTGG + Intronic
1091296184 11:134475491-134475513 GAGCCATTTCTTCTGCTGATAGG + Intergenic
1091328793 11:134714193-134714215 GAGCCACTTATTCCCATGACAGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092061958 12:5558215-5558237 GTGCCAGTTGCTCTTCTGAGTGG - Intronic
1092123779 12:6062196-6062218 GAACCACTTTTTGTTCTGATGGG + Intronic
1092472731 12:8793417-8793439 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1093580343 12:20779159-20779181 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1096993917 12:55827371-55827393 GAGCCACTTCCTCTTCAGGCTGG + Exonic
1098082320 12:66800999-66801021 GAGGGAATTGTTTTTCTGACAGG - Intronic
1099014377 12:77326366-77326388 GACCCACTCGTTCCACTGACTGG - Intergenic
1099149755 12:79095749-79095771 GAGTGACTTGTTCTCCTGCCTGG + Intronic
1100210203 12:92391729-92391751 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1100529811 12:95452872-95452894 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1104122350 12:125811521-125811543 GAGCCAAAGGTTATTCTGACAGG - Intergenic
1104767507 12:131339984-131340006 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1105762892 13:23529973-23529995 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1106538943 13:30672953-30672975 GAGCTACTTGTTCTGTTGCCTGG + Intergenic
1106647230 13:31649586-31649608 GAGTCTATTTTTCTTCTGACAGG - Intergenic
1106972395 13:35157542-35157564 GAGCCACTTGCTCTTTCAACTGG + Intronic
1108849003 13:54705375-54705397 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1109069685 13:57748530-57748552 GAGCCACTTGTCATTCTGCAAGG - Intergenic
1109621313 13:64910332-64910354 ATGCCACTTGCTCTTCTGCCAGG - Intergenic
1110906592 13:80897664-80897686 GTGCCACTAGTTCTGCTAACCGG - Intergenic
1112007854 13:95269285-95269307 GAGCTGCTTGTGCTGCTGACAGG - Intronic
1113203521 13:107892166-107892188 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1113551082 13:111193637-111193659 GTGCCACTAGTTCTTCTAACTGG + Intronic
1113858592 13:113465561-113465583 GGGCCACCTGTGCTCCTGACAGG - Intronic
1116697760 14:48199621-48199643 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1117063492 14:51985980-51986002 GAGCAACTTTTACCTCTGACTGG + Intergenic
1117380374 14:55156142-55156164 GAGCCACCAGTTCTTTTGAGGGG - Intronic
1121154155 14:91667060-91667082 GTGCCACTAGTTCTGCTAACTGG - Intronic
1122867213 14:104611908-104611930 GAGCCCCGTGGTCTTCTGGCGGG + Intergenic
1129182803 15:73887611-73887633 GACCCACAGGTTCTGCTGACGGG + Exonic
1133772801 16:8877356-8877378 GATCCACTTGCTGTTCTGACAGG - Intergenic
1140130616 16:72157521-72157543 CAGCCACTTTTTTTTCTGGCTGG + Intronic
1141077140 16:81016957-81016979 GAGCCAGCTGTTCCTCTGCCTGG - Intronic
1142186129 16:88695526-88695548 GAGCCACGTGGGCCTCTGACTGG - Intergenic
1143707298 17:8707793-8707815 GAGTCACTTGATTTTCTAACTGG - Intergenic
1146726711 17:35162207-35162229 TTGCCACCTGTGCTTCTGACTGG - Intronic
1149118465 17:53130125-53130147 AATTCACTTGTTCTTCTGACAGG - Intergenic
1151568437 17:74913485-74913507 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1152163814 17:78687714-78687736 CAGCCACTTGATCTGCCGACTGG + Intronic
1155475722 18:26234510-26234532 GTGCCACTAGTTCTGCTAACTGG + Intronic
1160940919 19:1620102-1620124 GAGCCACTTTATCCTCTGAGTGG - Intronic
1162108304 19:8384594-8384616 GTGCCACTAGTTCTGCTAACTGG - Intronic
1162237036 19:9317553-9317575 GCGCCACTAGTTCTGCTAACTGG + Intergenic
1163661829 19:18582812-18582834 GCGCCACTAGTTCTGCTAACTGG - Intronic
1164465988 19:28488126-28488148 CAGCCACATCTTCTGCTGACTGG + Intergenic
1164778956 19:30877195-30877217 GAGCCATCTGTACTTCTGTCTGG - Intergenic
1164992685 19:32695884-32695906 GTGCCACTAGTTCTGCTAACTGG + Intronic
930038944 2:47105732-47105754 GTGCCACTAGTTCTGCTAACTGG - Intronic
931134606 2:59383625-59383647 GAGCCTCTTTTTCTGCTGCCTGG + Intergenic
931274446 2:60732382-60732404 AGGCCACTGGTACTTCTGACTGG + Intergenic
931540742 2:63326447-63326469 GTGCCACTAGTTCTGCTAACTGG - Intronic
932334713 2:70923552-70923574 GAGCCACCTGTGCTTCTGAATGG + Intronic
934867511 2:97826237-97826259 GTGCCACTAGTTCTGCTAACTGG - Intronic
935359418 2:102234991-102235013 CCGCGATTTGTTCTTCTGACAGG - Exonic
936641465 2:114316557-114316579 GAGCCACTTGTAGTCCTGCCTGG - Intergenic
938805792 2:134806273-134806295 GTGCCACTAGTTCTACTAACTGG + Intergenic
939852245 2:147316515-147316537 GTGCCACTAGTTCTGCTAACTGG - Intergenic
940245888 2:151615470-151615492 TTGCCACTTGTTCTTGTGTCCGG + Intronic
940602935 2:155883812-155883834 GTGCCTCTTTTTCTACTGACTGG - Intergenic
943134151 2:183890576-183890598 GTGCCACTAGTTCTGCTAACTGG - Intergenic
943712719 2:191115461-191115483 CACCCACTTGTCCTTCTGTCTGG + Intronic
943902156 2:193454494-193454516 GTGCCACTAGTTCTGCTAACTGG - Intergenic
945456750 2:210059308-210059330 GACTCACTTGCTCTTCTGGCAGG - Intronic
946206402 2:218112043-218112065 GTGCCACTAGTTCTGCTAACTGG + Intergenic
946343371 2:219087091-219087113 GAGCTGCTTGTTCTTCTTAGAGG - Intronic
946479918 2:220045280-220045302 TAGTCACTTGTTCTCCTGAAAGG - Intergenic
1170627090 20:18038102-18038124 GTGCCACTTTTTCTTCTGTCTGG + Intronic
1170872606 20:20220474-20220496 TTGCCACCTGTACTTCTGACCGG - Intronic
1171270891 20:23815996-23816018 ATGCCACTAGTTCTGCTGACTGG - Intergenic
1172185759 20:33030142-33030164 AAGCCACTTATTATTCTGAAAGG + Intergenic
1175421407 20:58836589-58836611 GAGCCCCTTGTTCCTCAGCCCGG + Intergenic
1175654430 20:60756266-60756288 GAGCCACATGTTACTGTGACAGG + Intergenic
1178109612 21:29357181-29357203 GTGCCACTAGTTCTGCTAACGGG + Intronic
1178129596 21:29556554-29556576 GTGCCATTTCTTCTTCTGAGGGG + Intronic
1178720138 21:35000877-35000899 GAGCCACTTCTTCTGGTGCCAGG + Intronic
1179174454 21:38997485-38997507 AAGCCACTTGTTCCTGTAACTGG - Intergenic
1185171525 22:49297365-49297387 GAGCAACGTGAGCTTCTGACGGG + Intergenic
949210316 3:1491253-1491275 GAGCCAGCTGTTCTCATGACTGG + Intergenic
951020877 3:17779581-17779603 GTGCCACTAGTTCTGCTAACTGG - Intronic
951239728 3:20273873-20273895 GTGCCACTAGTTCTGCTAACTGG - Intergenic
952453439 3:33451782-33451804 GTGCCACTAGTTCTGCTAACTGG - Intergenic
953622551 3:44545793-44545815 GTGCCACTAGTTCTGCTAACTGG + Intergenic
953662520 3:44901468-44901490 CAGCACCTTGTTCTTCTGAGGGG + Intronic
954231954 3:49224581-49224603 GTGCCACTAGTTCTGCTAACTGG + Intronic
954587372 3:51747454-51747476 GTGCCACTAGTTCTGCTAACTGG - Intergenic
954599179 3:51854365-51854387 GTGCCACTAGTTCTCCTAACTGG - Intergenic
955547989 3:60052090-60052112 GAGCCACTTGTTTTTAGGAGTGG + Intronic
955635889 3:61029100-61029122 GATACCCTTTTTCTTCTGACAGG + Intronic
955775790 3:62431588-62431610 GTGCCAATTGTTCTGCAGACTGG - Intronic
958548838 3:95590325-95590347 GTGCCACTAGTTCTGCTAACTGG + Intergenic
960941713 3:122939292-122939314 GAGCCACTTGTTCTTTTCACTGG - Intronic
963021511 3:140876550-140876572 GTGCCACTAGTTCTCCTAACTGG - Intergenic
963991906 3:151665834-151665856 GTGCCACTAGTTCTGCTAACTGG + Intergenic
966774031 3:183528438-183528460 GAGCCACTTGCACTTCTGGCAGG - Intronic
967889643 3:194356122-194356144 GAGGCACTTGCTCTTCTGCATGG - Intronic
971280800 4:25241238-25241260 GTGCCACTAGTTCTGCTAACTGG + Intronic
971578840 4:28308166-28308188 GTGCCACTAGTTCTGCTAACTGG - Intergenic
972132906 4:35860022-35860044 GTGCCACTAGTTCTGCTAACTGG + Intergenic
974174900 4:58309497-58309519 GTGCCACTAGTTCTGCTAACTGG - Intergenic
974187717 4:58463234-58463256 GTGCCACTAGTTCTGCTAACTGG - Intergenic
974537506 4:63189774-63189796 GTGCCACTAGTTCTGCTAACTGG - Intergenic
974838475 4:67277159-67277181 GTGCCACTAGTTCTGCTAACTGG + Intergenic
975595433 4:76045048-76045070 GTGCCACTAGTTCTGCTAACTGG + Intronic
975836883 4:78432499-78432521 GAGGCCCTCGGTCTTCTGACAGG - Exonic
977834552 4:101633136-101633158 GTGCCACTGGTTCTGCTAACTGG + Intronic
977884556 4:102241232-102241254 GTGCCACTAGTTCTGCTAACTGG - Intergenic
978747424 4:112209656-112209678 GTGCCACTAGTTCTACTAACTGG - Intergenic
980290518 4:130844082-130844104 GTGCCACTAGTTCTGCTAACTGG + Intergenic
980574373 4:134666340-134666362 GAGCTGCTATTTCTTCTGACTGG - Intergenic
980747085 4:137032405-137032427 GAGCCAGTTGGACATCTGACAGG + Intergenic
982351916 4:154425234-154425256 GAGCTACCTGTTCTTCGGATGGG - Intronic
982803923 4:159738983-159739005 CAGGCAGTGGTTCTTCTGACAGG + Intergenic
983779760 4:171653329-171653351 TAGCCACTTGTTCCTGTGAAAGG - Intergenic
983834555 4:172372038-172372060 GTGCCACTAGTTCTGCTAACTGG + Intronic
984917841 4:184739579-184739601 GGGCCACTAGTTCTACTAACTGG - Intergenic
984939554 4:184919185-184919207 GTGCCACTAGTTCTGCTAACTGG + Intergenic
985165934 4:187094113-187094135 GAGGCACTTTCTCTTCTGCCAGG - Intergenic
986842495 5:11714243-11714265 GAGGCATTTGTTTTTCTGTCTGG - Intronic
986933549 5:12855617-12855639 GTGCCACTAGTTCTGCTAACTGG - Intergenic
986960086 5:13201038-13201060 GGGCCATTTGTTGTTCTGCCTGG - Intergenic
987757076 5:22110290-22110312 GAACCTCTTCTTCATCTGACAGG + Intronic
987818253 5:22931240-22931262 GTGCCACTAGTTCTGCTAACTGG - Intergenic
988358159 5:30202757-30202779 GTGCCACTAGTTCTGCTAACTGG - Intergenic
988591621 5:32554715-32554737 GTGCCACTAGTTCTGCTAACTGG + Intronic
989496566 5:42116008-42116030 GTGCCACTAGTTCTGCTAACTGG - Intergenic
989957717 5:50375480-50375502 GTGCCACTAGTTCTGCTAACTGG - Intergenic
990116975 5:52401507-52401529 GTGCCACTAGTTCTGCTAACTGG - Intergenic
990516340 5:56534332-56534354 ATGGCACTTGTTTTTCTGACAGG + Intronic
993102349 5:83556313-83556335 AAGCCACAGTTTCTTCTGACCGG + Intronic
994454389 5:99985766-99985788 GTGCCACTAGTTCTGCTAACTGG - Intergenic
994917195 5:105995335-105995357 GAGCCATTTGTACTCCTGCCTGG - Intergenic
995583042 5:113620659-113620681 GTGCCACTAGTTCTGCTAACTGG + Intergenic
995706804 5:114995531-114995553 GTGCCACTAGTTCTGCTAACTGG - Intergenic
996098983 5:119428665-119428687 GTGCCACTAGTTCTGCTAACTGG + Intergenic
996680601 5:126225319-126225341 GTGCCACTAGTTCTGCTAACTGG - Intergenic
997072641 5:130637798-130637820 GTGCCACTAGTTCTGCTAACTGG - Intergenic
997178089 5:131798738-131798760 GTGCCACTTGTACTTCAGCCTGG + Intergenic
997698274 5:135878501-135878523 GAGCCACTTGTTCATCTCTAGGG + Intronic
998111844 5:139508470-139508492 GTGCCACTAGTTCTGCTAACTGG - Intergenic
998672268 5:144367210-144367232 TAGCCACTTGAACTTCAGACAGG + Intronic
998915312 5:147005347-147005369 GTGCCACTAGTTCTGCTAACTGG - Intronic
999549108 5:152664658-152664680 CAGCCACTTGGTCTTTTGATTGG - Intergenic
1001886375 5:175293976-175293998 GAGCCCCTGGTTCTTTTGTCTGG - Intergenic
1002100572 5:176855660-176855682 GTGCCACTTGTGCCTCTGGCTGG - Intronic
1004812624 6:19276368-19276390 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1005294213 6:24408654-24408676 GAGCCACTTTTTGCTCTAACAGG + Intronic
1006043974 6:31278131-31278153 GAGCCGCTTGTGTTTCTGCCAGG - Intronic
1009407335 6:63328104-63328126 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1009471186 6:64029774-64029796 GTGCCACTAGTTCTGCTAACTGG - Intronic
1010075190 6:71789769-71789791 GTGCCACTAGTTCTCCTAACTGG - Intergenic
1010341064 6:74753417-74753439 GAGCCTCTCTTTCCTCTGACTGG + Intergenic
1012441165 6:99263694-99263716 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1013284561 6:108670038-108670060 GGGCCACCTGTGCTTCTCACAGG + Intronic
1016130709 6:140465752-140465774 AAGCCACTTGTTAATCTTACTGG + Intergenic
1016996696 6:149966055-149966077 GACCCGCCTGTTCTTCCGACTGG + Intronic
1021356229 7:19655883-19655905 GTGCCACTCGTTCTGCTAACTGG + Intergenic
1023380760 7:39605566-39605588 GAGCCAGCTGTTTTTCAGACTGG + Intronic
1027686054 7:81279812-81279834 GGGCCATTTGTAGTTCTGACTGG - Intergenic
1027791349 7:82641300-82641322 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1028494862 7:91451183-91451205 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1028593922 7:92528268-92528290 GAGCCACCTGATCTTCAGCCTGG - Intronic
1033563144 7:142553251-142553273 GAGGCACTTGTTCCTCTGCATGG - Intergenic
1033758856 7:144419773-144419795 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1034579595 7:152031126-152031148 GTGCCACTAGTTCTCCTGACTGG + Intronic
1038639168 8:29310119-29310141 GCGCCACTAGTTCTGCTAACTGG - Intergenic
1039276334 8:35936984-35937006 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1039692810 8:39880347-39880369 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1039863418 8:41479351-41479373 GAGCCCCTTCTTCCTCTGCCTGG + Intergenic
1039999314 8:42563005-42563027 GTGCCACTAGTTCTGCTGACTGG + Intergenic
1040527987 8:48241092-48241114 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1040667501 8:49651866-49651888 GTGCCACTAGTTCTGCTCACTGG + Intergenic
1041092783 8:54318382-54318404 AATCCCCTCGTTCTTCTGACAGG + Intergenic
1042350367 8:67771339-67771361 GAGTGTCTTGTCCTTCTGACTGG + Intergenic
1044456269 8:92395740-92395762 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1046321964 8:112590620-112590642 GAGCTGCTTGTTCTTGTGATGGG + Intronic
1047495898 8:125408475-125408497 GAGCAACTTGTCCTACAGACTGG + Intergenic
1050204605 9:3183313-3183335 GAGTCACTTGTGCTTTTGAGAGG - Intergenic
1052057420 9:23920724-23920746 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1053508447 9:38666870-38666892 AAGTCTCTTATTCTTCTGACTGG - Intergenic
1055288961 9:74762505-74762527 GAGGTTCTTGTTCATCTGACTGG - Exonic
1055458050 9:76491543-76491565 GTGCCACTGGTTCTGCTAACTGG + Intronic
1057484658 9:95473042-95473064 GAACCCCTTGTTGTTCTGTCTGG - Intronic
1059298228 9:113291611-113291633 TAGCCACTTGCTCATATGACAGG + Exonic
1059532435 9:115048221-115048243 GAGCCATTTGTTCCTCTTCCTGG - Intronic
1062250350 9:135590839-135590861 GAGCTACGTGTTCTTCTGCATGG + Intergenic
1186192049 X:7075913-7075935 GGGCCACCTGTACTTCTGATTGG - Intronic
1188136875 X:26502615-26502637 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1189566604 X:42247958-42247980 GTACCACTTGTTTTTCTGCCAGG - Intergenic
1189904170 X:45741070-45741092 GAACCACTTGTATTTCTGACTGG + Intergenic
1190978849 X:55436353-55436375 GAGCCACTCTTTCTTTTGACTGG - Intergenic
1192482394 X:71497060-71497082 GTGCCACTAGTTCTGCTAACTGG + Intronic
1192738110 X:73867996-73868018 CAGCCACTCTTTCTTTTGACTGG - Intergenic
1194665321 X:96671303-96671325 GAGCGGCTTGTTCTTCTCTCTGG + Intergenic
1195439934 X:104887900-104887922 GTGCCACTAGTTCTGCTAACTGG - Intronic
1195850792 X:109279803-109279825 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1196127003 X:112111650-112111672 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1197115852 X:122832852-122832874 GAGCCATTAGTTCTTTTGAAAGG + Intergenic
1198715089 X:139549898-139549920 TGCCCACTTGTTCTTCTGCCTGG + Intronic
1200959632 Y:8985012-8985034 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1201311718 Y:12603574-12603596 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1201430044 Y:13894072-13894094 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1201487925 Y:14511467-14511489 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1201648665 Y:16262696-16262718 GTGCCACTAGTTCTGCTAACTGG + Intergenic
1201654144 Y:16322604-16322626 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1201911366 Y:19136592-19136614 GTGCCACTAGTTCTGCTAACTGG - Intergenic
1201919635 Y:19220523-19220545 GTGCCACTAGTTCTGCTAACTGG - Intergenic