ID: 923699314

View in Genome Browser
Species Human (GRCh38)
Location 1:236284583-236284605
Sequence CAGCATTGTGAGAGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923699309_923699314 0 Left 923699309 1:236284560-236284582 CCTAAAATCAGCTACACTGAAAC No data
Right 923699314 1:236284583-236284605 CAGCATTGTGAGAGGCCCTGGGG No data
923699307_923699314 11 Left 923699307 1:236284549-236284571 CCTCTGCTTTCCCTAAAATCAGC No data
Right 923699314 1:236284583-236284605 CAGCATTGTGAGAGGCCCTGGGG No data
923699308_923699314 1 Left 923699308 1:236284559-236284581 CCCTAAAATCAGCTACACTGAAA No data
Right 923699314 1:236284583-236284605 CAGCATTGTGAGAGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923699314 Original CRISPR CAGCATTGTGAGAGGCCCTG GGG Intergenic
No off target data available for this crispr