ID: 923705786

View in Genome Browser
Species Human (GRCh38)
Location 1:236343716-236343738
Sequence ACCATGCACAAAGGCCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923705783_923705786 0 Left 923705783 1:236343693-236343715 CCTGAGGGGGAGGCCAGGAGAGC No data
Right 923705786 1:236343716-236343738 ACCATGCACAAAGGCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923705786 Original CRISPR ACCATGCACAAAGGCCCCAA AGG Intergenic