ID: 923705788

View in Genome Browser
Species Human (GRCh38)
Location 1:236343717-236343739
Sequence CCATGCACAAAGGCCCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923705783_923705788 1 Left 923705783 1:236343693-236343715 CCTGAGGGGGAGGCCAGGAGAGC No data
Right 923705788 1:236343717-236343739 CCATGCACAAAGGCCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923705788 Original CRISPR CCATGCACAAAGGCCCCAAA GGG Intergenic