ID: 923706974

View in Genome Browser
Species Human (GRCh38)
Location 1:236351952-236351974
Sequence GGATGTTCCCAGAACTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 5, 2: 15, 3: 38, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923706971_923706974 0 Left 923706971 1:236351929-236351951 CCACTCATTTTTACACCAAATAT 0: 6
1: 37
2: 46
3: 88
4: 579
Right 923706974 1:236351952-236351974 GGATGTTCCCAGAACTGTCATGG 0: 1
1: 5
2: 15
3: 38
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923706974 Original CRISPR GGATGTTCCCAGAACTGTCA TGG Intronic
900129851 1:1082774-1082796 GGCTGTGCCCAGGACTGTCCCGG + Exonic
901411015 1:9084187-9084209 GGATGTCCCAGGAACTGTCATGG - Intronic
901591108 1:10343902-10343924 GTAACTTCCCATAACTGTCAGGG + Intronic
902446196 1:16466165-16466187 GGATGGTCCCCAAACTATCAAGG + Intergenic
903955466 1:27022357-27022379 GGGTGTTCTCAGAACTGTTGTGG - Intergenic
905805675 1:40875448-40875470 GTTTCTTCCCAGGACTGTCAAGG - Intergenic
906286828 1:44593007-44593029 GGATGGGCCCAGAGCTGCCATGG + Intronic
906880267 1:49582241-49582263 GGATTGCCCCATAACTGTCATGG - Intronic
908398997 1:63752715-63752737 GTATCTTCCCAGAACTCCCAGGG - Intergenic
909440495 1:75690722-75690744 GGGTGTTCCTGGAAGTGTCATGG - Intergenic
910009018 1:82437431-82437453 GAATGTTCCCAGATATGCCATGG - Intergenic
910253598 1:85223591-85223613 GGGTGTCCCTGGAACTGTCATGG + Intergenic
919303108 1:195795296-195795318 GGGTGTTCTCAAAACTGTCATGG + Intergenic
919484744 1:198132524-198132546 GTATGTTTCCAGAACTGCAACGG - Intergenic
920795801 1:209134864-209134886 GGATGCTCCTGGAACTGTCTTGG + Intergenic
921041693 1:211438869-211438891 GGATGTTCACATATATGTCATGG + Intergenic
921546986 1:216484666-216484688 GGATGCTCCCAGAACTGATATGG - Intergenic
923069278 1:230547979-230548001 AAATGTTCCCAGAATTGTGAAGG + Intergenic
923706974 1:236351952-236351974 GGATGTTCCCAGAACTGTCATGG + Intronic
923906562 1:238391682-238391704 GGATGTTCAGAGAGCTGTCCTGG + Intergenic
924414385 1:243844134-243844156 AGATGTGCCAAGAACTGTTACGG + Intronic
1065474002 10:26114175-26114197 GGATGGTGCCAGATCTGCCAGGG + Intronic
1068997833 10:63227624-63227646 GGATGTTACCACAAAGGTCAAGG - Intronic
1073986457 10:109215311-109215333 AGATGTTCCCAGAACTGTCATGG + Intergenic
1074489628 10:113927592-113927614 GGATTTTCCCAGAAATCTCAGGG + Intergenic
1075603134 10:123785461-123785483 AGATTTTCCCAGGACTGTCCTGG + Intronic
1076020960 10:127072758-127072780 GGATCCTCCCAGCACTGCCATGG + Intronic
1076795564 10:132796535-132796557 GCTTGTTCCCAGCACTCTCAGGG + Intergenic
1078308237 11:10212681-10212703 AGGGGTTCCTAGAACTGTCATGG - Intronic
1080021310 11:27563110-27563132 GGATGTTACCAAAACACTCAAGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084905200 11:72340678-72340700 GTATGTTCCCAGAGCTCTCTAGG - Intronic
1085249639 11:75134464-75134486 TGATTTGCCCAGAACTGTCCTGG + Intronic
1085335450 11:75690385-75690407 GGGTGTTCCTGAAACTGTCATGG - Intergenic
1085788727 11:79477302-79477324 GGGTGTTCCCAGCACTGGCTTGG + Intergenic
1087446861 11:98267051-98267073 GGGTGTTCTCAGGACTTTCATGG - Intergenic
1087836763 11:102882815-102882837 GGATGTTCTCAGAGCTGACTTGG - Intergenic
1087886419 11:103488184-103488206 GGGTGTTCCTGAAACTGTCATGG - Intergenic
1091035378 11:132228247-132228269 GGATGTTCACAGAATTCCCAGGG - Intronic
1093961870 12:25282628-25282650 GGATGTGAGCAGAAGTGTCATGG + Intergenic
1094777821 12:33752053-33752075 GAATGTTTCCAGAAATATCAAGG + Intergenic
1095182575 12:39163071-39163093 GGGTGTTCTCTGAACTGTCATGG + Intergenic
1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG + Intergenic
1095746637 12:45666730-45666752 GGGGGTTTCCAGAACTGTCATGG + Intergenic
1095819514 12:46462033-46462055 GGATATTGCCATAACTCTCAAGG - Intergenic
1097285988 12:57877860-57877882 AGATTTTCCCATAACAGTCATGG - Intergenic
1097341622 12:58444742-58444764 GGATGTTTCCGGAGCTGTCTAGG - Intergenic
1099483434 12:83196882-83196904 GGATGTTCTTGGAACTGTCATGG + Intergenic
1103998803 12:124847283-124847305 GGCTGTTCCCAGAGCTGCCAAGG + Intronic
1108112890 13:47095739-47095761 AGGTATTCTCAGAACTGTCATGG - Intergenic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1109514096 13:63418439-63418461 GGATGATACCAGAATTGTTAAGG + Intergenic
1111280004 13:86010147-86010169 GGGTGTTCCTGGAACTGTCATGG - Intergenic
1111405498 13:87799089-87799111 AGAGGGTCCCAGAACTTTCAAGG - Intergenic
1111825556 13:93263095-93263117 GGGTGTTCTGGGAACTGTCATGG + Intronic
1112113225 13:96325646-96325668 GGATGGTTCCAGAACTCCCAAGG - Intronic
1113315167 13:109172062-109172084 AGATGTTCCCAGAACTGGTGTGG - Intronic
1113778611 13:112963077-112963099 GGCTGGTGCCAGATCTGTCATGG + Intronic
1113779358 13:112967210-112967232 GAAGGTTCCCTGAACTGACAGGG + Intronic
1115339649 14:32279376-32279398 GGTTGTTCCCAGAACTTGAAAGG - Intergenic
1118932143 14:70252749-70252771 TGATTTTCCCAGGACTGTCCTGG + Intergenic
1118953099 14:70452782-70452804 TGATTTTCCCAGGACTGTCCTGG - Intronic
1119161028 14:72452627-72452649 GGATGTGCCAAGAACTCTCCTGG - Intronic
1119278820 14:73386029-73386051 GGAGGTTCCTAGGACTTTCATGG - Intronic
1121661224 14:95636613-95636635 GGGTCTTTCCAGAACTGTCAGGG + Intergenic
1122010928 14:98746331-98746353 GCATTTCCCCAGAAGTGTCATGG + Intergenic
1122206781 14:100151638-100151660 TGCTGTTTTCAGAACTGTCATGG - Intronic
1124180480 15:27468385-27468407 GGGTGTTCCTGGAACTGTCATGG + Intronic
1126727978 15:51652454-51652476 GGGTGTTCCTGGAAGTGTCATGG - Intergenic
1127302232 15:57666297-57666319 GGGTGTTCCCTTAACTGTCTAGG - Intronic
1128237596 15:66078582-66078604 GGATGTCCCTAGAACTCTGAGGG - Intronic
1129078613 15:73019919-73019941 GGGTGTTCTTGGAACTGTCATGG + Intergenic
1130737973 15:86570547-86570569 GGGTGTTCCCCGAACTGTCATGG + Intronic
1131796352 15:96021063-96021085 GAATGTTTGCAGAGCTGTCAGGG - Intergenic
1132312067 15:100864533-100864555 GGAAGTTGCCAGAAGTCTCATGG + Intergenic
1132331612 15:101015880-101015902 GGAGGGTGCCAGCACTGTCAGGG + Intronic
1132888652 16:2193870-2193892 GGAAGGTCCCAGAACTGAGAAGG + Intronic
1133682227 16:8130383-8130405 GTGTGTTCCCGGAATTGTCATGG - Intergenic
1133870827 16:9684351-9684373 GGGTGTTCCTGGAACTGTCATGG - Intergenic
1134118276 16:11565745-11565767 GGATGTTCCCAAACATGTCACGG + Intronic
1138650975 16:58461324-58461346 TGATGTTTCCAGAAGGGTCAGGG + Intergenic
1138786653 16:59854446-59854468 GAATGTTCCCAGAACTGTTATGG - Intergenic
1139126794 16:64088241-64088263 GAATGCCCCCAAAACTGTCATGG - Intergenic
1140046485 16:71443164-71443186 GGATGGTCCCAGGACTCTGACGG - Intergenic
1140475177 16:75236215-75236237 GGCTCGTCCCAGAGCTGTCATGG - Intronic
1141423133 16:83930176-83930198 GGCTGTTCCCACAGCTGGCATGG + Intronic
1143886341 17:10067717-10067739 GTATTTTCAAAGAACTGTCATGG - Intronic
1143901171 17:10175956-10175978 GGATGTGCCCAGCACAGTGAGGG - Intronic
1144132745 17:12263935-12263957 TCATTTTCCCAGAATTGTCATGG + Intergenic
1144629621 17:16864293-16864315 GCATTTTCCCAGGACTGTCAGGG + Intergenic
1144651807 17:17011824-17011846 GCATTTTCCCAGGACTGTCAGGG - Intergenic
1145215110 17:21045038-21045060 GCAAGTTCCCAGAACTGTATTGG + Intergenic
1146651672 17:34610895-34610917 GGATGTTCTCAGAACTGTCATGG + Intronic
1147928303 17:43959772-43959794 GGATGTGCGCAGAACTCACAGGG - Intronic
1150951909 17:69812465-69812487 ACGTGTTCCCAGAACTGTCCTGG - Intergenic
1151702263 17:75749841-75749863 GAATGTTCCCTGAGCTGCCAAGG + Intronic
1155584517 18:27349524-27349546 GAGTGTTCTCGGAACTGTCATGG - Intergenic
1156379682 18:36546754-36546776 TGATGTTACCAGAGCTGTGAGGG + Intronic
1156399167 18:36725172-36725194 GCAAGTTCCAAGAACTCTCAGGG - Intronic
1156903837 18:42331574-42331596 GGATGTTCCTGGAACTGTCATGG - Intergenic
1157794777 18:50563493-50563515 GCATGATCCCACAGCTGTCAAGG + Intronic
1163349854 19:16769617-16769639 GGATGTTTCCATCACTGTCTGGG - Intronic
1166657391 19:44622402-44622424 GGAAGTTCCCAGCACAGTCTGGG + Intronic
1168215988 19:54926159-54926181 GGTAGTTCCCAGAGCTGTCCTGG - Intronic
926762969 2:16295756-16295778 CAGTGTTCCCAAAACTGTCATGG - Intergenic
928358763 2:30645935-30645957 GGATGTTGCCAGACCTGCCCAGG - Intergenic
930074593 2:47396385-47396407 AGGTGTTCTCGGAACTGTCATGG - Intergenic
931781615 2:65583423-65583445 GGATGTTCCAAAAACTCTCCTGG - Intergenic
931962712 2:67499969-67499991 AGATATTCCCAGAAGTGTCAGGG - Intergenic
932076062 2:68663923-68663945 GGGTGTTCCTGGAACTGTCATGG + Intergenic
936792075 2:116162854-116162876 GGATGGTCCCAGAAGTGTCATGG + Intergenic
938040126 2:128068929-128068951 GAAAATACCCAGAACTGTCAGGG + Intergenic
938801829 2:134770946-134770968 GAGTGTTCTCAAAACTGTCATGG - Intergenic
940509318 2:154592708-154592730 AGATGTTTCCAGAACTGTCATGG + Intergenic
942201626 2:173577199-173577221 GGTTGTTTCCAGAACTCTGACGG - Intergenic
943620544 2:190143018-190143040 GGATGTTCTTGGAACTGTCATGG + Intronic
944531348 2:200670499-200670521 TGTTGTTCCCTGACCTGTCATGG + Intronic
946653659 2:221921195-221921217 GGATGATGTCAGAACTGCCAAGG - Intergenic
948014302 2:234675371-234675393 GGGTGTTCTCAGAACCATCATGG + Intergenic
1171427054 20:25055847-25055869 AGATGCTCCCAGAAGAGTCATGG + Intronic
1172200100 20:33119635-33119657 GGATGTTCCTGGAACTGTCATGG + Intergenic
1174487066 20:50868006-50868028 CGATATTCTCAAAACTGTCAAGG - Intronic
1175609640 20:60339977-60339999 GTGTGTTCCCAGAATTGTCCTGG + Intergenic
1176133408 20:63507264-63507286 GTGTGTTCCTGGAACTGTCATGG + Intergenic
1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG + Intergenic
1177508579 21:22051908-22051930 GAATGTTACCAGAAGTCTCAGGG - Intergenic
1177730065 21:25017221-25017243 GAATGTTCCTGGAACTGTCATGG + Intergenic
1179333086 21:40424509-40424531 GGACCTCTCCAGAACTGTCAGGG + Intronic
1179336808 21:40464210-40464232 TGATGTTCCCAGAACAGTCCCGG - Intronic
1180004490 21:45013884-45013906 GGGTGTTCCCAGAACTGTCCTGG + Intergenic
1180017096 21:45094524-45094546 GGATGTTCCCTGATCTGGCGGGG - Intronic
1181978023 22:26745983-26746005 GGATGTGCCTAGAGCAGTCAAGG + Intergenic
1182815976 22:33164140-33164162 TTATGTTCCCAGCACTGTTAGGG - Intronic
1184225856 22:43128538-43128560 GGATGTTCTTAGAAGTTTCATGG + Exonic
952637589 3:35550555-35550577 GGAATTTCCCATAACTGTGAAGG + Intergenic
954442571 3:50529939-50529961 GGCTGTTCCCAGGAGGGTCAGGG - Intergenic
954938752 3:54351682-54351704 AGAGGTTCCAAGAACTGTCTTGG - Intronic
956056257 3:65301756-65301778 GGGTATTCCTGGAACTGTCATGG - Intergenic
957519030 3:81295104-81295126 TGATGTTCCCACACCTTTCATGG + Intergenic
961243526 3:125432594-125432616 GGGTGTTCTGGGAACTGTCATGG - Intergenic
962086323 3:132195732-132195754 GGATGTTCCCAGAAGTCATAGGG + Intronic
963555585 3:146783237-146783259 GAATGTTCCTGGAACTTTCATGG + Intergenic
967518308 3:190398330-190398352 GGATTCTTCCAGAACTTTCAGGG - Intronic
969602686 4:8186300-8186322 AGTTCTCCCCAGAACTGTCAAGG + Intronic
970444724 4:16114167-16114189 GGAAGTCTCCAGAACTTTCACGG - Intergenic
971421427 4:26477189-26477211 GGGTGGTCTCAGAACGGTCATGG - Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
973934836 4:55833988-55834010 AGAAATTCCCAGAACAGTCAGGG - Intergenic
975485269 4:74928398-74928420 GGGTGTTCTCAGGACTGTCATGG - Intergenic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
977917749 4:102612859-102612881 GGATTTTCACAGAACTTTAACGG + Intronic
979809872 4:125023254-125023276 GAGTGTTCTCAGAACTGTCATGG + Intergenic
980136428 4:128862762-128862784 GGGAATTCCCAGTACTGTCATGG + Intronic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
983254194 4:165379543-165379565 GGATGCCCCCAGGGCTGTCAGGG - Intronic
984268228 4:177519889-177519911 GGGTGTTCCTGGAACTGTCATGG - Intergenic
986818609 5:11440053-11440075 TGATTTTCTCAGAACTGTCCTGG - Intronic
988585508 5:32504303-32504325 AGGTGTTCCCGGAACTGTCATGG - Intergenic
989590258 5:43106026-43106048 GGATGTTTCTAGAACTTTCTAGG + Intronic
990853372 5:60233833-60233855 GTAAGTTCCCACAACTGTTATGG + Intronic
992241962 5:74780777-74780799 TGATGTTAACAGTACTGTCAGGG - Exonic
995130286 5:108622934-108622956 GAGTGTTCCCAGAACTGTCATGG + Intergenic
997532775 5:134592430-134592452 GGATGATCACAGAGCTGACAAGG - Intergenic
998140042 5:139694601-139694623 GGAGGGTCCCAGAAATGGCAAGG - Intergenic
998940694 5:147279761-147279783 GAATGTTCCTGGAACTGTCATGG + Intronic
1000140111 5:158394915-158394937 AGCTTTTCCCAAAACTGTCAGGG + Intergenic
1000871495 5:166582820-166582842 GGATGTTTCCAGAAGTGTTATGG + Intergenic
1001113077 5:168914505-168914527 AGATGTTCCCAGAAAAGTCCAGG - Intronic
1002618618 5:180470627-180470649 GGATGTTCACAGAAGCGCCATGG + Intergenic
1003174860 6:3746859-3746881 GCATCTTCCTAGAGCTGTCAGGG + Intronic
1004784587 6:18952940-18952962 GGATGATCTCAAAACTGTTAGGG + Intergenic
1005357575 6:24999308-24999330 AGATGTTCTTGGAACTGTCATGG - Intronic
1005637768 6:27767754-27767776 GGCTGATCCCAGGACTGTTAGGG - Intergenic
1005651382 6:27888329-27888351 GGGTGTTCTCGGAACTGTCATGG + Intergenic
1006706611 6:36026529-36026551 GCAAGTTCCCAGAACTCACAGGG - Intergenic
1006962243 6:37945036-37945058 GGGTGCTCCCGGAACTGTCTTGG + Intronic
1009228825 6:61040503-61040525 GGATGTTACCAACAATGTCACGG + Intergenic
1009691619 6:67041608-67041630 AGATGTTCTAGGAACTGTCATGG - Intergenic
1009967224 6:70590445-70590467 AGGTGTTCCCAGAATAGTCATGG + Intergenic
1012026188 6:93994937-93994959 AGATCTTCTCAAAACTGTCAAGG + Intergenic
1012147721 6:95707399-95707421 AGGTGTTCCTGGAACTGTCATGG - Intergenic
1013488147 6:110617976-110617998 GGATGTTCTTGGAACTGTCATGG - Intronic
1013770966 6:113627894-113627916 GGAAGATCCCAGAATTGTCAAGG - Intergenic
1016283628 6:142448326-142448348 TGATGATCCCAGCACAGTCATGG - Intergenic
1017349451 6:153422341-153422363 GAGTGTTCTCAGAACTGTCATGG + Intergenic
1020515953 7:9119158-9119180 GGGTGTGCCTGGAACTGTCATGG + Intergenic
1021153165 7:17176736-17176758 GGATGTTCCCGGAACTGTCATGG + Intergenic
1022505767 7:30907973-30907995 GGCTGTTCCCAGGACTGTCTGGG - Intergenic
1022552515 7:31254703-31254725 GAGAGTTCCCAGAACTGTCACGG - Intergenic
1022797987 7:33748114-33748136 AGAAGTTCCCGGAACTGACAAGG - Intergenic
1023731455 7:43195896-43195918 AGGTATTCCCAGAACTGTCACGG + Intronic
1024147513 7:46532478-46532500 GTGTGTTCCCAGAACTATAATGG + Intergenic
1025164710 7:56702709-56702731 GGATGTTTCCAGAATTATCCTGG - Intergenic
1030734759 7:113034502-113034524 GGATGTTTCCATAACTGTTTAGG + Intergenic
1032292312 7:130599405-130599427 GGGTGTTCTTGGAACTGTCATGG - Intronic
1032489065 7:132310395-132310417 TGGTGTTCCCAGAGCTGCCAGGG - Intronic
1036454431 8:8894320-8894342 GGGTGTCCCCGGAATTGTCATGG - Intergenic
1038026391 8:23594919-23594941 GGGTGTTCCTGGAACTGTCATGG + Intergenic
1038279743 8:26153175-26153197 GCATGTTCCCAAAACTCTCCTGG + Intergenic
1038369176 8:26970454-26970476 GGGTGTTCCTGGAACTGTCATGG - Intergenic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1039663128 8:39488610-39488632 GGATGTCTCCATTACTGTCAAGG + Intergenic
1040299406 8:46180189-46180211 GGAAGTCCCCAGGACTGTCCAGG - Intergenic
1040299848 8:46182267-46182289 GGAAGCTCCCAGGTCTGTCACGG - Intergenic
1040307639 8:46220485-46220507 GGAAGCCCCCAGAACTGTCCCGG + Intergenic
1040853616 8:51926615-51926637 AGATGTTCCCAAAACTGTCATGG - Intergenic
1041469501 8:58193090-58193112 GGATTTCCCCAGAACTGTCGTGG - Intronic
1041862444 8:62529930-62529952 GGATGGTGCCAGAACTGGTAGGG - Intronic
1043360737 8:79468982-79469004 GGATGTTTCTGGAACTGTTATGG + Intergenic
1044300760 8:90580498-90580520 GGGTGTTTCCAGAACTGTCATGG - Intergenic
1044390272 8:91641767-91641789 GGATGTTCCCAGTACTAGGAAGG - Intergenic
1050063327 9:1733290-1733312 GGATGTGACCACAGCTGTCATGG + Intergenic
1050163630 9:2742628-2742650 GGGTCTTCCCGGAACTTTCATGG + Intronic
1053861705 9:42393492-42393514 TGATGTTCCCTGAACTGGCCAGG - Intergenic
1055078521 9:72243095-72243117 GCATTTTCCCAGAACTGCCATGG + Intronic
1055616163 9:78075133-78075155 AGATGCTCCCACAACTGACATGG - Intergenic
1056619189 9:88196347-88196369 GGATGTTCCTGGAACTGTCATGG - Intergenic
1056945116 9:90988165-90988187 GAAAGTTCCCAGACCTGTTAAGG - Intergenic
1060309480 9:122446407-122446429 GAATATTCCCAGAGCTTTCATGG + Intergenic
1061162271 9:128902248-128902270 GGATGTTCCCAGACCAAGCACGG + Intronic
1062595284 9:137296416-137296438 GGAGGTTCCCAGACCTTCCACGG + Intergenic
1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG + Intergenic
1186967060 X:14799053-14799075 GAATGTTCCTGGAACAGTCATGG - Intergenic
1188133347 X:26465564-26465586 GAGTGTTCCTAGAACTGTCATGG - Intergenic
1188322532 X:28757667-28757689 GGCAGTTTCCAGCACTGTCATGG + Intronic
1189690604 X:43613397-43613419 GGGTGTGTCTAGAACTGTCAAGG + Intergenic
1190707783 X:53044952-53044974 GGGTTTTCCCAGAAGAGTCATGG - Intergenic
1198256658 X:134929998-134930020 GGGTGTTCCCAGAACTGTTATGG + Intergenic
1198309539 X:135416869-135416891 GGGTGTTCCTGGAACTGTCCTGG + Intergenic