ID: 923714383

View in Genome Browser
Species Human (GRCh38)
Location 1:236412406-236412428
Sequence CCTCATGCAAAGTCAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923714379_923714383 19 Left 923714379 1:236412364-236412386 CCTGCTTGTCTGACTTCTTGCAA 0: 1
1: 0
2: 4
3: 21
4: 195
Right 923714383 1:236412406-236412428 CCTCATGCAAAGTCAGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923714383 Original CRISPR CCTCATGCAAAGTCAGTGCA AGG Intronic
902360554 1:15940547-15940569 CCCCATGCCAAGTCTGTACATGG + Intergenic
903282459 1:22257746-22257768 CCACATGCAAAGGCAGAGCCTGG - Intergenic
904522692 1:31107932-31107954 CCTCATGCAAACGCAGGACATGG - Intergenic
905960913 1:42041361-42041383 CCTCATGCAGAGGCAGTGGCCGG - Intergenic
906381313 1:45333593-45333615 CCTGATGCACAGCCTGTGCAGGG - Exonic
907947390 1:59147832-59147854 CCCCATACCAAGTCAGTGCCTGG - Intergenic
910722237 1:90299319-90299341 CCTCATGCATAGTAGGTACATGG + Intergenic
916430541 1:164723658-164723680 CCTCAGTCACAGGCAGTGCAGGG - Intronic
923714383 1:236412406-236412428 CCTCATGCAAAGTCAGTGCAAGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1066343384 10:34558123-34558145 CCACATGCAAAGTGAGAACATGG - Intronic
1067018578 10:42775782-42775804 CCTCATCCAAAGGCAGTGTCTGG - Intergenic
1074232682 10:111553586-111553608 TCTGATGCAAAGTAAGGGCAGGG + Intergenic
1074873476 10:117595929-117595951 CCTCATGCAGGGGCACTGCATGG - Intergenic
1076399253 10:130168829-130168851 TCTCAAGAAAAGTCAGTGCTGGG - Intronic
1076427577 10:130378693-130378715 CCTCATGCAGAGCAAGAGCAGGG - Intergenic
1076450863 10:130556123-130556145 ACTCAGGCAAAGTAAGTGCTAGG - Intergenic
1076513193 10:131026592-131026614 CACGAGGCAAAGTCAGTGCAGGG - Intergenic
1076557106 10:131333653-131333675 CCTCATGAATAGCCAGTGCCTGG - Intergenic
1077751483 11:4975245-4975267 CCTCACGCAAAATCAGAGGAGGG + Intronic
1086375556 11:86196458-86196480 TCTAAAGCAAAGTCATTGCATGG + Intergenic
1086941735 11:92805184-92805206 CCTGGTGCAAAGTGAGTGGAAGG + Exonic
1091176010 11:133558545-133558567 TCTGATGCATAGTAAGTGCACGG + Intergenic
1091384254 12:82648-82670 CCTCACTCATAGTAAGTGCATGG - Intronic
1092695682 12:11169091-11169113 CCTGATGAAAAGTCAGTTAAAGG + Intronic
1094498975 12:31006599-31006621 CCTCCTGCAAAATCAGGGCAGGG - Intergenic
1097059267 12:56270281-56270303 CCTCATGGAACATCAGTTCACGG - Exonic
1099081290 12:78185345-78185367 CCTCATCTAAAGTCAGTGAGTGG + Intronic
1100430190 12:94525215-94525237 CCTCATGCAAAGTTATTGTAAGG - Intergenic
1101925840 12:108970633-108970655 CCCCATGCAATGTCAATGCTTGG - Intronic
1102983065 12:117257742-117257764 CTACATTCAAAATCAGTGCAAGG - Intronic
1104756912 12:131275081-131275103 CTTCCTGTAAAGTCAGTGCTGGG + Intergenic
1106915120 13:34505555-34505577 CCTCCTGCACAGGCAGTTCATGG - Intergenic
1107376634 13:39811131-39811153 ACTCAAGCAAATTCACTGCAGGG - Intergenic
1108738500 13:53310240-53310262 CCTCATGAGAAGTAAGTACAGGG + Intergenic
1109509518 13:63351517-63351539 CCTGCTTCAAAGTCAGAGCATGG + Intergenic
1109958958 13:69605680-69605702 TCTTATGCCAAGTCAGTTCATGG - Intergenic
1111622400 13:90741115-90741137 CCTCCTACAAAGTGAGTTCAGGG + Intergenic
1111986371 13:95070594-95070616 ACTCACTCAAAGTCAGTGAAAGG - Intronic
1112416725 13:99209075-99209097 CCACATGCACAGCCAGGGCAAGG - Intronic
1113564529 13:111311636-111311658 CCTCGTGCAAACGCAGAGCAAGG + Intergenic
1115716800 14:36114537-36114559 CCTCTTGCAAGGTCAGATCAAGG - Intergenic
1119946074 14:78695856-78695878 CCCCATGCAAGGTTAGAGCAGGG + Intronic
1120715731 14:87838908-87838930 TCTCATGCAAGGGCAGTGCTTGG + Intronic
1125759500 15:42087299-42087321 CCTTATCCAAAGTCAGGTCAAGG - Exonic
1127457164 15:59165586-59165608 GCTCATGCAAAGGCAATTCAGGG + Intronic
1128581814 15:68816055-68816077 GCTAAAGCAAACTCAGTGCAAGG + Intronic
1128726233 15:69990607-69990629 CCTCATGCACAGGCAGTAGAAGG - Intergenic
1129520921 15:76185947-76185969 GCTCACCCAAAGTCAGGGCAAGG + Intronic
1133549613 16:6841458-6841480 CCTCATGCAACCTGAGTGGAAGG + Intronic
1133931567 16:10236915-10236937 CCTCTGGCAAATTGAGTGCATGG - Intergenic
1135564447 16:23500655-23500677 CCCCAAGCAAAGCCAGTGCAGGG + Intronic
1136926622 16:34380951-34380973 CCCCAAGCAAAGCCAGCGCAGGG - Intergenic
1136977952 16:35030856-35030878 CCCCAAGCAAAGCCAGCGCAGGG + Intergenic
1140267121 16:73430216-73430238 CCTCAAGCCAAGGCAGTGGATGG - Intergenic
1141173646 16:81705677-81705699 CATGGTGCAAAGTCAGTGCTTGG - Intronic
1148087517 17:45003294-45003316 CCTCATTCAGACTCTGTGCAGGG - Intergenic
1148730007 17:49828438-49828460 ACTCAGACAAAATCAGTGCAAGG - Exonic
1151403604 17:73872353-73872375 CCCCATGCAAAGCCAGGTCAAGG + Intergenic
1158743059 18:60165633-60165655 CCTCTTGCAAAGTCATTTCCTGG - Intergenic
1159226728 18:65547656-65547678 ACTAATGCAAATTAAGTGCATGG - Intergenic
1159940310 18:74401975-74401997 TCTCATGTAAAGGCAGTCCAAGG + Intergenic
1160106765 18:75985094-75985116 TCTCCTGCAAACTCAGGGCATGG + Intergenic
1161029057 19:2049655-2049677 GCTGATACAGAGTCAGTGCATGG - Intronic
1166063805 19:40344573-40344595 CCTGATGCATAGTTAGTGCTTGG - Intronic
1166364674 19:42272494-42272516 CCTCATAGAAAGTCAGGGCTCGG - Intronic
925907728 2:8549260-8549282 CTTAATGCAAAGTGAGTGCTTGG - Intergenic
925981589 2:9181566-9181588 CTTCCTGCTAAGTCAATGCATGG - Intergenic
933533440 2:83539660-83539682 CCACATGGAAAGGCAGTGAAAGG + Intergenic
935498162 2:103806831-103806853 CATTATGCAAAGTCACTGGATGG + Intergenic
936593700 2:113827692-113827714 CCTCAGGGAAAGTCACTGAATGG + Intergenic
937016901 2:118614495-118614517 CCTCATGCAAAATGAGTGCCTGG - Intergenic
938684918 2:133728948-133728970 CACCATGCAAATGCAGTGCATGG - Intergenic
946907253 2:224429184-224429206 CCTCCAGCACAGTCAGGGCAAGG - Intergenic
948482331 2:238258008-238258030 CCTCATGCAGACACACTGCAGGG - Intronic
1173391530 20:42639420-42639442 CTGCATGCAAAGGCAGTGGATGG - Intronic
1174119023 20:48248467-48248489 CCTAAGGCAAAGTGAGTGCCTGG - Intergenic
1178143686 21:29714677-29714699 CCTCAGGCAATGTCATTGCAAGG + Intronic
1179726198 21:43342868-43342890 CTTCATGCCAACTGAGTGCAGGG - Intergenic
1180622709 22:17172348-17172370 CCTCATCCAAGGTCTTTGCACGG + Intergenic
1181185584 22:21101286-21101308 CCTCAGGCAAAGGAAGAGCATGG - Intergenic
949505235 3:4721085-4721107 CCTATTGCAAAGTCAGTGGAGGG + Intronic
951340133 3:21475748-21475770 ACTCATGCAAAGCAAGTGTAAGG + Intronic
952296430 3:32066556-32066578 CCTCCTGCAAACTCAGTGACAGG + Intronic
952334635 3:32393169-32393191 CCTCATGCACACTCAGTGTCTGG - Intronic
952731544 3:36642028-36642050 CCTGAATCAAAGTCAGTGAAAGG - Intergenic
955517901 3:59746405-59746427 TCTGATGGAAAGTCAGAGCAGGG - Intergenic
960855465 3:122098008-122098030 CTTGGTGCACAGTCAGTGCATGG - Intronic
963764170 3:149316519-149316541 CCCCATGCCTAGTCAGTCCAAGG - Intergenic
973252927 4:48079451-48079473 CCTCATGCTGAGTCAGTTCCTGG - Intronic
974204803 4:58687534-58687556 GTTCAGGCAAAGTCAGTGGAGGG + Intergenic
974703974 4:65487634-65487656 CCTCCTGCAGAGTCAGTTCCGGG - Intronic
978339551 4:107707509-107707531 CCTCAGTGAAACTCAGTGCAAGG - Intronic
980204928 4:129705406-129705428 ATTTATGCAGAGTCAGTGCAAGG + Intergenic
980964617 4:139509087-139509109 ACTCAAGAAAGGTCAGTGCAGGG + Exonic
983571154 4:169209394-169209416 CCTGATGCCAAGTCAGTTTAAGG + Intronic
983819350 4:172173372-172173394 CCTCATGCAAATTCACAGGAAGG - Intronic
986174468 5:5340360-5340382 GCTCAGGAAAAGTCACTGCAAGG + Intergenic
986359334 5:6960873-6960895 CTCCATGAAATGTCAGTGCATGG + Intergenic
987049119 5:14134876-14134898 CACCATGCAAAGTCAGATCAGGG - Intergenic
990409333 5:55525240-55525262 CATCATGCATATTAAGTGCAAGG + Intronic
992957314 5:81923124-81923146 CCTAATGAAAAAACAGTGCATGG - Intergenic
999771828 5:154781653-154781675 CATCATGCAAAGACATTGTAAGG + Intronic
1001250541 5:170143522-170143544 CCTCATGAAAATTCATTGAATGG + Intergenic
1001542497 5:172549408-172549430 CCTTGTGCAAAGTCAACGCAGGG - Intergenic
1007912597 6:45530837-45530859 CCTCAGACAAATTAAGTGCAGGG + Intronic
1020807238 7:12805280-12805302 CCTCATCAAAAGTTAGTGCTTGG + Intergenic
1022131206 7:27406212-27406234 CCTCATGAAAACTCTGTGAAAGG - Intergenic
1022873149 7:34500538-34500560 GCTCATGTTAAGGCAGTGCAGGG + Intergenic
1023531735 7:41163926-41163948 TCTCATTCAAAGTCTGTGCCTGG - Intergenic
1026146533 7:67751413-67751435 CCTCATGCAAAGACAGTCTCTGG - Intergenic
1032954463 7:136954590-136954612 CCTCATGAACAGTGAGTTCATGG + Intronic
1033044360 7:137947880-137947902 CCTCCTGTAAAGACAGGGCAGGG - Intronic
1034435765 7:151062168-151062190 CATCATGCAAAGTCAGGGTAGGG - Intronic
1034436891 7:151066751-151066773 CCTCATGAAGAGTAAGTGCTGGG + Exonic
1038362484 8:26895170-26895192 TTTCCTGCAAAGTCAGTGAAAGG + Intergenic
1039823947 8:41157286-41157308 ATTCATGCAAAGTCACCGCATGG + Intergenic
1040555460 8:48474056-48474078 CCTCCTGCAAAGGCTGTGCCTGG - Intergenic
1048878525 8:138855343-138855365 CCTCATCCAAAGTCACAGGACGG + Intronic
1048925049 8:139264161-139264183 CCTAATGCAAAGCCAGGGCTGGG + Intergenic
1049215467 8:141405868-141405890 CCTCCAGCACAGGCAGTGCAAGG + Intronic
1052343564 9:27385889-27385911 TCTCATGCAAACTCAATGAAGGG + Intronic
1057309305 9:93931849-93931871 CCTCATGCAAGGTCGGGGCATGG - Intergenic
1058419779 9:104822548-104822570 CCTCATAAAAATTCAGTGCCAGG + Exonic
1058956038 9:109949645-109949667 TCTCATGTAATGGCAGTGCAAGG - Intronic
1059254233 9:112914096-112914118 TCTCAGGTAAAGTCACTGCAGGG - Intergenic
1060754994 9:126206150-126206172 CCTGAAGCAAAGTCAATGCTCGG - Intergenic
1061839609 9:133350382-133350404 CCTAATGCCAAGTCAGTGATGGG + Intronic
1062290037 9:135790315-135790337 CCTCATGCTGAGGCTGTGCAGGG - Intronic
1186040752 X:5475167-5475189 TCACATACCAAGTCAGTGCAGGG + Intergenic
1186123353 X:6386167-6386189 CTCCATGCAAATTCAGTACAAGG + Intergenic
1189649144 X:43170468-43170490 CCTCATACTAAGTCAGTGAGAGG + Intergenic
1190788323 X:53675452-53675474 TATCATGCATAGACAGTGCAGGG + Intronic
1191781153 X:64867102-64867124 CCTCAGGCAGGGTCAGGGCAGGG + Intergenic
1199694912 X:150337085-150337107 CCCCATGCAGAGGAAGTGCACGG + Intergenic
1201716583 Y:17050958-17050980 CTTCATGCAAAGTCTGTAAATGG + Intergenic