ID: 923715693

View in Genome Browser
Species Human (GRCh38)
Location 1:236423105-236423127
Sequence GAAATCTCTGGGGGTCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923715685_923715693 20 Left 923715685 1:236423062-236423084 CCAGAGACTTCAGGAGGAATGAG 0: 1
1: 0
2: 1
3: 39
4: 226
Right 923715693 1:236423105-236423127 GAAATCTCTGGGGGTCCTAGTGG 0: 1
1: 0
2: 1
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923715693 Original CRISPR GAAATCTCTGGGGGTCCTAG TGG Intronic
901119424 1:6878669-6878691 CAAATCGCTGGGGATCCTTGGGG - Intronic
905545242 1:38792632-38792654 CCAATCTCTGTGGGTCCCAGTGG + Intergenic
906240947 1:44241991-44242013 GATGTCTCTGGGGCTCCAAGGGG + Intronic
906679631 1:47716942-47716964 GAAGTATCTGGTGGTCCCAGTGG + Intergenic
910185903 1:84539428-84539450 GAAATGTCTTGGATTCCTAGCGG - Intergenic
915650532 1:157307328-157307350 GAAAACTCTGGGTGTCCCTGTGG - Intergenic
917049585 1:170905025-170905047 GAATTCTTTGGGGGTTCTACAGG + Intergenic
919550671 1:198982456-198982478 GAAATATCTTGGTGTCCTGGGGG - Intergenic
923715693 1:236423105-236423127 GAAATCTCTGGGGGTCCTAGTGG + Intronic
1068937190 10:62647519-62647541 TAGATCTGTGGGGGGCCTAGTGG - Intronic
1070620480 10:78005920-78005942 CAAATATCTGGTGGTCCTTGAGG - Intronic
1073377701 10:103050972-103050994 GAGATGTTTGGGGGTCCCAGGGG + Intronic
1075258988 10:120946616-120946638 GAAATCTCTGGATGTCCACGAGG + Intergenic
1076350639 10:129812806-129812828 GAAAGCTCTGGGGGCACTTGAGG - Intergenic
1076738591 10:132469508-132469530 GAAACCTCTGCAGGTCCCAGAGG + Intergenic
1077130205 11:968246-968268 GACATCTCTGGGAGGCCCAGAGG + Intronic
1077338651 11:2016466-2016488 GGTATCTCTGGGGGTCCTCCGGG + Intergenic
1078085469 11:8230925-8230947 CAAAGATCTGGGGGTTCTAGAGG - Intronic
1078718417 11:13861067-13861089 CAGATCTCTGGGGGTCACAGAGG + Intergenic
1080650141 11:34215928-34215950 TAAATCACTGTGGATCCTAGTGG - Intronic
1081043957 11:38249465-38249487 AAAATATCTGAGGGCCCTAGAGG - Intergenic
1084079676 11:66813368-66813390 TAAATTTCTGGGGATCCTAGTGG + Intronic
1085694509 11:78692521-78692543 GCAATCTCCTGGGGTCCTGGGGG - Intronic
1202821635 11_KI270721v1_random:71648-71670 GGTATCTCTGGGGGTCCTCCGGG + Intergenic
1097099300 12:56575516-56575538 GAAGTGGCTGGGGGTCCTATGGG - Intronic
1098023664 12:66180701-66180723 CACATGTCTGGGGTTCCTAGGGG + Intergenic
1098247808 12:68538356-68538378 GAAATCTTTGTGGGAGCTAGAGG - Intergenic
1098901805 12:76118765-76118787 GATATTTCTGGGGGTCCCAAAGG + Intergenic
1100369052 12:93948704-93948726 GAAATGTCTAAGGTTCCTAGGGG - Intergenic
1103258348 12:119562855-119562877 GGCATTTCTGGGGGTCCTTGAGG - Intergenic
1104277712 12:127344936-127344958 GAGATCTCTGGGGGTTCTGGAGG - Intergenic
1112707761 13:102091332-102091354 GAAGTCTCTGGTGCTCCTAGTGG - Intronic
1113455795 13:110447988-110448010 GACATCTCAGGGGCTCCTGGAGG - Intronic
1113657863 13:112080245-112080267 AAAATCCCTGGGGGTGCTAAGGG + Intergenic
1125975379 15:43946586-43946608 GATATGTCTGGGAGTCTTAGGGG + Intronic
1126080861 15:44959908-44959930 CAAATCTCTGGGGTTTCTAATGG - Intronic
1128289692 15:66468432-66468454 GAAAAGTCTGGTGGTGCTAGAGG + Intronic
1129383040 15:75179547-75179569 GCCAACTCTGGGGCTCCTAGTGG - Intergenic
1129660786 15:77551818-77551840 GAAATGTCTTGTGGACCTAGGGG - Intergenic
1133627603 16:7585997-7586019 AAAACCTCTGGGGGTCATAAAGG + Intronic
1142624406 17:1182743-1182765 GAAATCTCTGCGGGTCCATGGGG + Intronic
1146524123 17:33551641-33551663 GAGAGAGCTGGGGGTCCTAGGGG - Intronic
1150943482 17:69718976-69718998 GAAAACCCTGGGGTTCCCAGTGG + Intergenic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1165069194 19:33245982-33246004 GAAATCCCTGGGGTTCCTTCAGG - Intergenic
1165804903 19:38574315-38574337 GAAATCATTAGGGGCCCTAGGGG + Intronic
1167586673 19:50379198-50379220 GCTATCTCTGGGGTTCCTTGTGG - Intronic
1168060939 19:53891871-53891893 GAATGATCTGAGGGTCCTAGTGG + Intronic
925375095 2:3378513-3378535 GAAGGCCCTGGGGTTCCTAGAGG + Intergenic
926922052 2:17948609-17948631 GAAATGTCTGGGTTTCCTTGAGG - Intronic
927103568 2:19806261-19806283 GAAATCAGTGTGGGTCCTGGCGG - Intergenic
930075126 2:47400365-47400387 GAAATCTCTGGTGGGCACAGTGG - Intergenic
932716790 2:74106445-74106467 GACATCTCTGGGAGTCCCAAGGG + Exonic
938074763 2:128325904-128325926 GAATTCTTTGGGAGTCCCAGAGG + Intergenic
940988162 2:160070454-160070476 AAAATATCTGGTGGTCCTAGAGG + Intergenic
944580990 2:201132721-201132743 GTAACCTCTGGGGGAGCTAGGGG + Intronic
948403565 2:237701627-237701649 GGAATCTCTGGGGCTCTGAGCGG + Intronic
1168906390 20:1407388-1407410 GCTCCCTCTGGGGGTCCTAGGGG - Intergenic
1169674897 20:8142344-8142366 GAAATCTCCTAGGGTCCTAAGGG + Intronic
1171223325 20:23420851-23420873 GGGAGCTCTGGGGGTCCTAGGGG + Intronic
1172127255 20:32632081-32632103 CTAAGCCCTGGGGGTCCTAGAGG - Intergenic
1172915570 20:38440900-38440922 GCACTCTCTGGGGGTGCTATGGG + Intergenic
1173844150 20:46177546-46177568 GAAAGCGCTGGGGGTCAGAGAGG - Intronic
1175612284 20:60361720-60361742 AAACTCTCTGGGGCTCCAAGTGG + Intergenic
1176091666 20:63321085-63321107 GGACTCACTGGGGGTCCTTGAGG - Exonic
1179707454 21:43190285-43190307 CAAGTCTCTGTGGGTCCTAGGGG + Intergenic
1182464594 22:30506474-30506496 AAAAGCCCTGGGGGTCCTAGAGG - Intergenic
949782668 3:7707654-7707676 GAAATTTCTGGTGATCCTAAAGG - Intronic
950156875 3:10728006-10728028 GAAGACCCTGGGGGTCCCAGAGG + Intergenic
951791078 3:26485337-26485359 TAAGCCTCTGGGGGGCCTAGAGG - Intergenic
952588566 3:34923374-34923396 GAAATCCCAGAGGTTCCTAGGGG - Intergenic
954160320 3:48716997-48717019 GAAATCTCCCGGGGTCCCTGTGG - Intronic
954591951 3:51790404-51790426 GTAATCACTGAGGGTCCTTGAGG + Intergenic
958966225 3:100561830-100561852 GGAATCTCTGGGGGGACTAGTGG - Intronic
959105479 3:102060029-102060051 AAAATCTCTGGGGGTTCTTTTGG + Intergenic
960934659 3:122890830-122890852 GAAATCTCTGGTAGTCTAAGGGG + Intergenic
962903244 3:139779061-139779083 GAAATCCGTGGGAGTCCCAGGGG + Intergenic
968035824 3:195546761-195546783 GAAATCTCTGTGTACCCTAGGGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968797238 4:2715472-2715494 GAAATCTCTGGATGTCATATGGG + Intronic
970957007 4:21824545-21824567 GAAATCATAGGGGGTCCAAGTGG - Intronic
972209510 4:36820510-36820532 GAAAGCACTCAGGGTCCTAGGGG - Intergenic
985771676 5:1815621-1815643 GATGTCCCTGGGGGTCCTAGGGG + Intronic
990734951 5:58850080-58850102 GCAATCTCTGGCTGGCCTAGTGG + Intronic
992751544 5:79867250-79867272 GCAATCCCTGAGGGTCCTATTGG - Intergenic
993629942 5:90274096-90274118 GAAGTCTCTGGAGGTCTTAGAGG - Intergenic
996247895 5:121287361-121287383 GAAATCACAGGGGGTCAAAGTGG - Intergenic
997928013 5:138048666-138048688 AAAAGCTCTGAAGGTCCTAGGGG - Intronic
1008653360 6:53586074-53586096 GAAATCCCTGGAGGTGCTGGAGG - Intronic
1008954708 6:57201881-57201903 GAAATCACTTGGGATCCCAGAGG + Intronic
1015385479 6:132618073-132618095 AAGATCTCTGGGTGTCCGAGTGG - Exonic
1015911345 6:138170475-138170497 GAAATCTCTGGGGCTCTCAAGGG + Intronic
1018500754 6:164409029-164409051 GACATGTCTGAGGGCCCTAGAGG + Intergenic
1019962324 7:4471149-4471171 GAAATCTCGGTGGGGCATAGTGG - Intergenic
1023991329 7:45130496-45130518 GACATGACTGGGGGTGCTAGTGG - Intergenic
1026137353 7:67674980-67675002 GAAAACTCAGAGGGTCCTACTGG - Intergenic
1026678205 7:72446064-72446086 GTCATCTCTGGGGGTCCCGGGGG - Intronic
1028759401 7:94478675-94478697 GAAGTCTTTTGTGGTCCTAGTGG + Intergenic
1029298127 7:99558122-99558144 GAAATCTCAGTAGGTCCTTGGGG - Intronic
1034280363 7:149849795-149849817 GAAATCTTAGGTGCTCCTAGAGG + Intronic
1034461603 7:151200663-151200685 GAAATCCCTGGGGGGCCCTGGGG - Intronic
1035399859 7:158557665-158557687 GAAATCTCAGTGGGTTCTAAAGG - Intronic
1037300399 8:17445418-17445440 GAAATCTGTTTGGGTCCTAGCGG + Intergenic
1037734374 8:21554991-21555013 GAAATCTTTGGGGTTCCTAGGGG + Intergenic
1037970413 8:23167793-23167815 GAAATCTCTAGGGGAGCTTGAGG + Intergenic
1048294686 8:133205691-133205713 GAAACCTCAGAGGGTCCCAGGGG + Intronic
1049179602 8:141215517-141215539 GAAGCCTCTGGAGGTGCTAGGGG + Intronic
1049246616 8:141566091-141566113 GAGATCTCTGGGGGCCAAAGAGG - Intergenic
1049422378 8:142522743-142522765 GAAGTCTCTGGGGGGCCATGTGG - Intronic
1050085492 9:1960561-1960583 GACATCTCTGGAAGTCCCAGGGG - Intergenic
1050491671 9:6195162-6195184 GAAATCACAGGGGGTCAAAGTGG + Intergenic
1051771735 9:20586482-20586504 AAAATCACTGGGGGGCTTAGGGG + Intronic
1052761918 9:32601421-32601443 GAAGACTCTGTGGGTCCTGGAGG + Intergenic
1055845639 9:80559188-80559210 GAAATCACTGAGGGTCATAATGG - Intergenic
1062179007 9:135180659-135180681 GAAAGCTATGGGGATCCTGGGGG - Intergenic
1062255140 9:135617354-135617376 GCAATGTCTCGGGGTCCTGGGGG + Intergenic
1187336307 X:18385116-18385138 GCTCTCTCTGGGAGTCCTAGAGG + Intergenic
1187451252 X:19398414-19398436 GACAACTCTGGGGGCCTTAGAGG - Intronic
1191899173 X:66023185-66023207 GGACTCTCTGGGGATCCTTGGGG - Intronic
1195068252 X:101256280-101256302 GAAATCTGTGTGGGTTCTTGAGG + Intronic
1195793331 X:108614982-108615004 GGAATCCCTGGTGGTCCTGGTGG - Exonic
1197938231 X:131762476-131762498 GAACTCTCTGGTTGTCCGAGAGG + Intergenic