ID: 923717647

View in Genome Browser
Species Human (GRCh38)
Location 1:236438456-236438478
Sequence GTGGTGACCAGGGCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923717639_923717647 -5 Left 923717639 1:236438438-236438460 CCATTTCAGAGAACCCCGGTGGT 0: 1
1: 0
2: 1
3: 2
4: 53
Right 923717647 1:236438456-236438478 GTGGTGACCAGGGCTGTGGTGGG 0: 1
1: 1
2: 3
3: 68
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923717647 Original CRISPR GTGGTGACCAGGGCTGTGGT GGG Intronic
900136607 1:1120338-1120360 GTGGTGAGCAGGGGTGGGGCGGG + Intergenic
900515751 1:3081472-3081494 GTGAGGAGCAGGGCTGAGGTGGG + Intronic
900602880 1:3510606-3510628 GCTGTGTGCAGGGCTGTGGTGGG - Intronic
900782456 1:4626877-4626899 GAGGAGCCCAGGGCTGTGCTGGG + Intergenic
901420889 1:9150390-9150412 GAGGTGCCCAGGGCAGTGGCTGG + Intergenic
902061077 1:13643471-13643493 GTGATGACCAGCTCAGTGGTTGG - Intergenic
902351556 1:15859504-15859526 GTGGTGGCGGGGGCTGTGGCGGG - Intronic
902392831 1:16116099-16116121 GTGGGGAGCAGGCCTCTGGTGGG + Intergenic
902895420 1:19476479-19476501 ATGGTGACCAGGGCTGGGATGGG + Intronic
903876551 1:26478349-26478371 GTGGTGGCCAGCACTTTGGTAGG - Intergenic
904026893 1:27509639-27509661 GTGCTGAGCAGGGGTGGGGTGGG + Intergenic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
905014067 1:34765057-34765079 GTGATGACCAGGTCTGGGGTGGG - Intronic
905171857 1:36114427-36114449 GAGGAGCCCAGGGCTGTGGTGGG - Intronic
905471131 1:38192825-38192847 GTGGTCAGCTGGGCTGAGGTGGG - Intergenic
909133129 1:71764961-71764983 GTGATGACCAGCTCAGTGGTTGG + Intronic
909549071 1:76878079-76878101 GAGTTGAACAGGGATGTGGTAGG + Intronic
909576787 1:77184943-77184965 GAGTTGAACAGGGATGTGGTAGG - Intronic
910156433 1:84224913-84224935 GTGGTGAACAGGGCAGTCTTTGG + Intronic
910790195 1:91042804-91042826 GTGTTGAACAAGGATGTGGTGGG - Intergenic
911465588 1:98249156-98249178 GTGATTACCAGGGCTGGGGAGGG + Intergenic
912023125 1:105131964-105131986 GTGATGACCAGCTCAGTGGTTGG - Intergenic
912502412 1:110130910-110130932 GTGCTGACCATGGCTGTGTCTGG + Intergenic
912547642 1:110462436-110462458 CTGTTGCCCAGGGCTGGGGTGGG + Intergenic
913039564 1:115009312-115009334 GAGTTGAACAGGGGTGTGGTGGG + Intergenic
913528183 1:119713220-119713242 GTGGTGGACAGGGCTGAGGCGGG - Intronic
915038614 1:152948966-152948988 CTGGTGAGCAGGGCTTTGCTTGG - Intergenic
915216588 1:154344535-154344557 GTTGTGCCCAGGGCTCAGGTGGG + Intronic
915318460 1:155042958-155042980 GAGGTGACCAGGGGTGAGGGAGG + Intronic
915667784 1:157460563-157460585 GAGTTGAACAGGGTTGTGGTGGG + Intergenic
916484812 1:165249374-165249396 GTGGTGGGCAGGGCTGCGGTGGG - Intronic
916853476 1:168727003-168727025 TTGGTTACCAGGACTGTGGAGGG - Intronic
917815602 1:178706736-178706758 CTGGGGACCTGGGCTGTAGTTGG - Intergenic
918402964 1:184182121-184182143 GTGGCTGCCAGGGCTGTGGGTGG + Intergenic
919450172 1:197762713-197762735 GTGGTTACCATGGGTGGGGTGGG - Intronic
919737635 1:200963179-200963201 TTGGAGAACAGGGCTGTGTTTGG + Intergenic
920560399 1:206934506-206934528 CTGGTGACCAGGGCTGATGAGGG - Exonic
921257652 1:213356980-213357002 GTGGTCACCAGGGCTGCTGTGGG + Intergenic
922746615 1:228047924-228047946 GTGATCTCCAGGGCTGGGGTGGG - Intronic
922770852 1:228182374-228182396 GTGGGGACGAGGTGTGTGGTGGG + Intergenic
923103830 1:230838866-230838888 GTGGTGGTCAGGGCTGGGGAAGG + Exonic
923717647 1:236438456-236438478 GTGGTGACCAGGGCTGTGGTGGG + Intronic
924138793 1:241000250-241000272 GTGGTGACTAGGGATGGGGCGGG + Intronic
1062821803 10:540547-540569 GTGCTTACCAGAGCTGGGGTAGG + Intronic
1063096829 10:2915799-2915821 GTGGTGCCCAGGGCCATGGATGG - Intergenic
1064236461 10:13580665-13580687 GTGGTAACCCTGGCTGAGGTGGG + Intergenic
1064297124 10:14088926-14088948 GCGGGGACCAGGGGTGTGGCTGG + Intronic
1064545820 10:16449052-16449074 GAGTTGAACAGGGATGTGGTGGG + Intronic
1066167161 10:32800160-32800182 GAGTTGAACAGGGATGTGGTGGG + Intronic
1066281773 10:33924713-33924735 GTGGGGGGCAGGGCTGAGGTGGG - Intergenic
1067097079 10:43308583-43308605 GTGCTGACCAGGGCAGGGGAGGG - Intergenic
1067154948 10:43773123-43773145 GTGGTGAGCAGGAGTGTGGGAGG - Intergenic
1067443557 10:46326748-46326770 GTGGTCAGGAGGGCAGTGGTGGG + Intronic
1068023622 10:51616437-51616459 GTGTTGACAGTGGCTGTGGTGGG + Intronic
1068023790 10:51617500-51617522 GTGTTGGCGATGGCTGTGGTGGG - Intronic
1068448527 10:57155686-57155708 GTGGTTGCCAGGGATGGGGTTGG - Intergenic
1068649410 10:59504842-59504864 GTGGTTACCAGGGGTGTGGGGGG - Intergenic
1068984329 10:63093099-63093121 GTGGTTACCAGGGATGGGGTGGG - Intergenic
1069135489 10:64758731-64758753 GTGGTTGCCAGGCCTGGGGTGGG - Intergenic
1069244617 10:66188379-66188401 GTGGTTACCAGGGGTGAGGGTGG - Intronic
1069744522 10:70706636-70706658 CTGGTGAGCAGGGCTCAGGTGGG - Intronic
1069866389 10:71506212-71506234 GTGGTTGCCAGGGCTGGGGAAGG + Intronic
1070886572 10:79905055-79905077 GTGGTGCCGCGGGCTGGGGTAGG + Intergenic
1071364584 10:84885428-84885450 GAGTTGAACAGGGATGTGGTGGG + Intergenic
1072729690 10:97837386-97837408 GTGGTGAGAAGGGCTGGGGGTGG + Intergenic
1072980932 10:100096799-100096821 GTGGTTACCAGGGCTAAGGGTGG + Intergenic
1073067283 10:100770192-100770214 GAGGTGAGCATGCCTGTGGTGGG + Intronic
1074024001 10:109615024-109615046 ATGGTGGCCAGGGCAGTGGTTGG + Intergenic
1074362266 10:112833021-112833043 GTCTTGACCAGGGCTGGGGGAGG - Intergenic
1075048895 10:119167088-119167110 CCGGTGACTATGGCTGTGGTGGG - Intergenic
1075671370 10:124265957-124265979 TTGGAGAGCAGGGCTGTGGTGGG - Intergenic
1076251755 10:128990125-128990147 GTAGTGACCAGGGTTGTGCATGG + Intergenic
1076445810 10:130513058-130513080 CTGGTGCCCAGGGTTGAGGTGGG + Intergenic
1076744332 10:132505153-132505175 CTGTTTTCCAGGGCTGTGGTCGG - Intergenic
1076802261 10:132836056-132836078 GAGGTGAGCAGGGCTGTGTCGGG - Intronic
1076867830 10:133176760-133176782 CTGGAGACCGGGGCTGTGCTTGG + Intronic
1077024522 11:433317-433339 GTGGTGACCGGGATGGTGGTCGG + Exonic
1077547583 11:3182180-3182202 CTCGTCACCAGGGCTGTGCTGGG + Intergenic
1077579665 11:3408622-3408644 GTGGTGACATGGGATGGGGTGGG + Intergenic
1077755817 11:5026089-5026111 GTGATGAGCAGGGAGGTGGTTGG - Intergenic
1077927195 11:6693590-6693612 CTGCTGACCAGGGGTGTAGTGGG - Intergenic
1079250045 11:18780566-18780588 GAGGAGACCTGGGCTGAGGTGGG - Intronic
1079335516 11:19567280-19567302 TTGGAGGCCAGGGCTGTGGAAGG + Intronic
1080653819 11:34243002-34243024 GAGGTGGGCAGGGCTGTGGAGGG - Intronic
1080989519 11:37513826-37513848 GTGGTAACCAGAGGTGGGGTAGG + Intergenic
1081216456 11:40405090-40405112 GTAGTTACCAGGGTTGGGGTTGG - Intronic
1081633018 11:44702106-44702128 GAGAAGACCAGGGCTGTGGGAGG - Intergenic
1081810190 11:45910115-45910137 GTGGCGACCAGGGCTGTGTGTGG + Exonic
1083161219 11:60855376-60855398 GTGGTGCCCAAGGGTGTGGCAGG - Intronic
1083174052 11:60938447-60938469 AAAGTGACCAGGGCTGGGGTTGG - Intronic
1083714668 11:64568512-64568534 GGGCTGCCCAGGGCTGGGGTTGG - Intronic
1083742332 11:64717475-64717497 GTGGTGCCCAGAGCTGGAGTGGG + Intronic
1084038700 11:66529455-66529477 GTGGTGGTCAGAGCTGTGGCAGG + Intronic
1084165048 11:67371690-67371712 GAGGAGTCCAGGGCAGTGGTGGG + Intronic
1084225285 11:67711540-67711562 GAGGTGACCCGGGCTCTGGGAGG + Intergenic
1084236680 11:67792143-67792165 GTGGTGACCTGGGATGGGGTGGG + Intergenic
1084263099 11:67991387-67991409 GAGGTGACCTGGGCTCTGGGAGG + Exonic
1084402995 11:68955968-68955990 GTGGGGACCAGGGTGGGGGTAGG + Intergenic
1084546420 11:69817285-69817307 GTGGTGACCGCGTCTGTGCTCGG - Intronic
1084810292 11:71607734-71607756 GAGGTGACCTGGGCTCTGGGAGG - Intergenic
1084835739 11:71800829-71800851 GTGGTGACCTGGGATGGGGTGGG - Exonic
1085271828 11:75274255-75274277 CTGGAGATCAGGGCTGGGGTTGG - Intronic
1085321372 11:75576161-75576183 GTGGTGAGGAGGGCTGAAGTGGG + Intergenic
1085392778 11:76190964-76190986 GCTGTGACTGGGGCTGTGGTAGG + Intronic
1085417727 11:76330336-76330358 GTGGAGGCTAGGGCTGTGGAAGG + Intergenic
1089058998 11:115610724-115610746 GTAGTGGCCAGGACTGTGGTGGG - Intergenic
1090815486 11:130290452-130290474 TTGGTGACCAGGTCTGTGTTAGG - Intronic
1091943803 12:4515633-4515655 GTGCTTACCAGGGCTGGGGCGGG + Intronic
1092407585 12:8231574-8231596 GTGGTGACCTGGGATGAGATGGG + Intergenic
1093964428 12:25310021-25310043 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1094729448 12:33157857-33157879 GTGTTGTCTAGGGCTGAGGTTGG + Intergenic
1095903038 12:47348182-47348204 GTGATGACCAGGGCTGGGCATGG - Intergenic
1096789126 12:54034194-54034216 GTGGGGGCCTGGGCTGGGGTGGG + Intronic
1096812039 12:54176908-54176930 GTGGAGACCAAGGGTGTGCTTGG - Intronic
1097278194 12:57827306-57827328 GTGGTGGCCAGGGCAGGTGTGGG + Intronic
1097564764 12:61253370-61253392 GAGTTGAACAGGGATGTGGTAGG + Intergenic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1098387746 12:69936455-69936477 GTGGTTACCAGGGATGTATTAGG - Exonic
1098603129 12:72357376-72357398 GTGGTTACCAGGGTTGAGGTAGG - Intronic
1098715970 12:73828869-73828891 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1099043243 12:77682141-77682163 GTGGTGGCCAGGGGCGAGGTGGG - Intergenic
1099259610 12:80361143-80361165 GTGGTTACCAGGGCTGAGGGTGG - Intronic
1099894529 12:88628490-88628512 GTTGTAATCTGGGCTGTGGTTGG + Intergenic
1100241271 12:92712545-92712567 GAGTTGAACAGGGATGTGGTGGG + Intergenic
1100527670 12:95434960-95434982 GCGATGACCAGGTCAGTGGTTGG + Intergenic
1100971742 12:100078458-100078480 GTGGTGTCAGGGGCTGTGTTAGG - Intronic
1101740210 12:107494713-107494735 GAGGTGGCGAGGGCTGTGGAAGG - Intronic
1101766048 12:107700353-107700375 GTGGTTGCCAGGGCTGGGGGTGG - Intronic
1102039012 12:109788704-109788726 AGGGAGACCAGGGCTGTGGGAGG + Exonic
1102040803 12:109799541-109799563 GTGATGACAACGGCAGTGGTGGG + Intronic
1103570584 12:121842046-121842068 ATGGTGCCTAGGGCTGGGGTGGG + Intronic
1103595934 12:122024121-122024143 GCGGGGACCAGGCCTGTAGTTGG + Intronic
1103971237 12:124674148-124674170 GTTGAGCCCAGGGCTGGGGTTGG - Intergenic
1105620861 13:22064889-22064911 GAGAAAACCAGGGCTGTGGTTGG + Intergenic
1105623482 13:22091008-22091030 GTGGAGAGCAGTCCTGTGGTAGG + Intergenic
1105830563 13:24160563-24160585 GTGGGGTCCCCGGCTGTGGTTGG + Intronic
1106887142 13:34199344-34199366 GTGGTTATCAGGGCTGAGGGGGG + Intergenic
1107725344 13:43293314-43293336 GTGGTGAAGATGGCCGTGGTGGG - Intronic
1111952669 13:94722041-94722063 GTGGGGACCAGGGCTGGACTAGG - Intergenic
1113307987 13:109098772-109098794 GTGATGACCAGCTCAGTGGTTGG - Intronic
1113472658 13:110557878-110557900 CTGGGGACCAGGTCTGTGCTGGG + Intronic
1113492991 13:110706524-110706546 GTGCTGACGTGGGCTGTGCTGGG - Intronic
1113574020 13:111381986-111382008 GTGGTGACTGGGGGTGGGGTGGG + Intergenic
1113760101 13:112840869-112840891 GTGGTCCCCAGGGTGGTGGTGGG - Intronic
1115669624 14:35595135-35595157 GTGGTTACCAGGGGTGGAGTGGG + Intronic
1115923955 14:38410287-38410309 GTGGTTACTAGGGCTGGGGAGGG - Intergenic
1116656926 14:47665543-47665565 GTGGGAACCAGGGCTGCGCTGGG + Intronic
1116733918 14:48663970-48663992 GTGGTTACCAGGAGTGGGGTAGG + Intergenic
1116867192 14:50040421-50040443 GTGGTGAGCAGGGGTGAGGGAGG - Intergenic
1117216710 14:53559165-53559187 ATGTTGAACAGGGATGTGGTGGG - Intergenic
1117216722 14:53559244-53559266 ATGTTGAACAGGGATGTGGTGGG - Intergenic
1117376929 14:55125740-55125762 GAGGTGGCCAGGGCTGAGGTTGG + Intronic
1118245120 14:64102813-64102835 GTGGTTACCAGGGCTGTTGGGGG - Intronic
1118710195 14:68512569-68512591 GTGGGGGCCAGGGCAGAGGTGGG - Intronic
1119072888 14:71605994-71606016 GTGTTGGCCATGGCTATGGTGGG + Intronic
1119731419 14:76953633-76953655 GTTCTGCCCAGGGCTGTGGCAGG + Intergenic
1120017098 14:79486479-79486501 TTGGAGACCACTGCTGTGGTGGG + Intronic
1121266013 14:92603100-92603122 GTGGAGACCAGGGCTAAGGAGGG + Intronic
1121331570 14:93052882-93052904 GTGGTGACGAAAGGTGTGGTTGG - Intronic
1122254298 14:100465366-100465388 GTGGTGGCCAGGGCTGGGGGAGG - Intronic
1122309308 14:100784458-100784480 GTTGTGTCCAGAGCTGTGTTCGG + Intergenic
1122871598 14:104641283-104641305 AAGGGGACCAGGGCTGTGCTGGG + Intergenic
1122975638 14:105169596-105169618 CTGGTGACCAGGGCAGCAGTGGG - Intergenic
1122994637 14:105256444-105256466 GTTGTGACCAGGGTTGTGACCGG - Intronic
1122995448 14:105261421-105261443 GTGTTGTCCACAGCTGTGGTGGG - Intronic
1123486286 15:20742547-20742569 GTGATGACCAGCTCAGTGGTTGG + Intergenic
1123542777 15:21311603-21311625 GTGATGACCAGCTCAGTGGTTGG + Intergenic
1124165110 15:27319437-27319459 CTGCTGACCAGCACTGTGGTGGG + Intronic
1124666353 15:31596117-31596139 GTGGTAACCAGAGCAGTGTTTGG + Intronic
1126106515 15:45150468-45150490 TTGGGGACAAGGGCTGAGGTTGG + Intronic
1126337771 15:47605615-47605637 GTGGGGATCGGGGATGTGGTTGG - Intronic
1127848364 15:62891392-62891414 GTGGAGAACAGGGCTGTGGTGGG - Intergenic
1128183539 15:65625275-65625297 GTGGTGAGCATGGCTGGGGTTGG - Exonic
1128212248 15:65910867-65910889 GTGGGGAGCAGGGCCATGGTGGG - Intronic
1128333486 15:66771385-66771407 GTGGCGGCCTGGGCTGTGATGGG - Intronic
1128756096 15:70185111-70185133 ATGATGGCCAGGGCTGTGGAGGG + Intergenic
1129171331 15:73809980-73810002 TTAGTGCCCAGGGCTGTGGGTGG - Intergenic
1129394141 15:75235135-75235157 GTGGTGACCATGCCGGTGATGGG + Intergenic
1129645852 15:77431799-77431821 GTAGTTACCAGGGGTGGGGTGGG - Intronic
1130017595 15:80199817-80199839 CAGGTGGCCTGGGCTGTGGTGGG + Intergenic
1130333258 15:82937750-82937772 GGTGTGCCCAGGGCTGTGGATGG + Intronic
1131835754 15:96388972-96388994 GTGGAAACCTGGGGTGTGGTGGG + Intergenic
1132252111 15:100341789-100341811 GGGGTGAAGAGGGCTGTGGGAGG + Intronic
1132376957 15:101334718-101334740 TTGGTGACCAGGCCTTTTGTGGG - Intronic
1202951095 15_KI270727v1_random:38733-38755 GTGATGACCAGCTCAGTGGTTGG + Intergenic
1132846615 16:2003750-2003772 GTGGTGAGCAGGACTGGGATGGG + Intronic
1132891422 16:2206678-2206700 GTGCTGCCCGGGGCTGGGGTGGG + Intronic
1133074179 16:3267141-3267163 GTGGGCACCAGGGCTGCGGCTGG + Intronic
1133341157 16:5037061-5037083 GTGGTGAGCAGGGTTGAAGTGGG + Intronic
1133348290 16:5084686-5084708 GTGGTGACCTGGGATGGGGTGGG + Exonic
1133601581 16:7345028-7345050 GTGGTGACAAAGGCTGAGGAAGG + Intronic
1134303385 16:13011488-13011510 GAGGTTACCAGGGATGGGGTGGG - Intronic
1134314350 16:13104673-13104695 GTGGTTGCCTGGGCTGGGGTGGG + Intronic
1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG + Intronic
1135844761 16:25908954-25908976 TTGGTGCCCAGGGCTGTGCTGGG + Intronic
1138658882 16:58506480-58506502 GTGGTGACCGGGGGTGGGGTGGG + Intronic
1140041291 16:71410045-71410067 GTGGTGGCCAGAGCAGGGGTGGG - Intergenic
1140477279 16:75245281-75245303 GTGGTCACCAGGGCAGGGGCTGG - Intronic
1141014285 16:80433786-80433808 CTGCTGACCAGGGCTGGGGTGGG + Intergenic
1141064531 16:80903095-80903117 GGGGTGCCCAGGGCTGTGGGAGG + Intergenic
1141629906 16:85281739-85281761 GTGGTGTCCAGTGATGGGGTGGG + Intergenic
1142173194 16:88633552-88633574 GAGGTGCCTAGGGCTGTGGCCGG - Intergenic
1142304851 16:89279439-89279461 CTGGTGACCGGGGCAGGGGTGGG + Exonic
1142475636 17:187451-187473 GTGGTCCCCAGGCCTGTGGGAGG - Intergenic
1142960646 17:3550440-3550462 GTGCTGCCAAGGGCTGTGCTGGG + Intronic
1143005366 17:3829004-3829026 GTGGTGGCCAGGGCTCTAGGAGG - Intronic
1143311337 17:5992042-5992064 GTGTTTGCCAGGGCTGTGGGAGG - Intronic
1143712937 17:8746160-8746182 GAGGGGAGCAGGGCTGGGGTGGG - Intergenic
1143784087 17:9244020-9244042 TTGGTGGCCTGGGCTGTGGGAGG + Intergenic
1144849890 17:18238683-18238705 GTGGTGGCAAGGGAGGTGGTGGG + Intronic
1145064391 17:19752323-19752345 GTGGTTACCAGGGCTGGGAAGGG + Intergenic
1145228466 17:21151693-21151715 GTGGGAACCAGTCCTGTGGTAGG + Intronic
1145320535 17:21764722-21764744 GTGGGGTCCACGGCTGTGGGAGG - Intergenic
1146448979 17:32956760-32956782 CTGGAAACCAGGGCTGTGGCTGG + Intergenic
1146478926 17:33186970-33186992 GTGATGACCAGCTCAGTGGTTGG + Intronic
1146641494 17:34545177-34545199 GTGGATACCAGGGCTGGGGGAGG + Intergenic
1147419443 17:40314851-40314873 GTGGGCACCAGGCTTGTGGTGGG + Intronic
1147537310 17:41328957-41328979 AGGGGTACCAGGGCTGTGGTGGG + Intergenic
1147722587 17:42548093-42548115 GTCGTGGCCAGGGCCGGGGTCGG + Intergenic
1148334838 17:46834289-46834311 GTGGTGTCCTGGGCAGTGGCTGG + Intronic
1148336487 17:46845360-46845382 GTGGTAACCAGGGCTGGGGTGGG + Intronic
1148397035 17:47317242-47317264 CTGTTGGCCAGGGCTGTAGTCGG + Intronic
1148441037 17:47711690-47711712 GGGGTCCCCAGGGCTGAGGTGGG + Exonic
1148854095 17:50569299-50569321 GTGAGGACCTGGGCTGGGGTGGG + Intronic
1149075860 17:52595790-52595812 GTGGTGGCCAAGGGTGTGGGTGG + Intergenic
1149399043 17:56275079-56275101 GTGGTGATGATGCCTGTGGTGGG - Intronic
1149658534 17:58322890-58322912 CTGGGGACCGGGGCAGTGGTGGG + Intronic
1149943684 17:60898865-60898887 GTAGTCTCCAGGCCTGTGGTTGG + Intronic
1150227907 17:63533765-63533787 TGGGTGACCACGGCTCTGGTGGG - Intronic
1152748192 17:82050896-82050918 GTGAGGGCTAGGGCTGTGGTTGG - Intronic
1152805241 17:82352521-82352543 GTGTTGCCGAGGGCTGTGGGGGG + Intergenic
1153704513 18:7732205-7732227 GTGATGGCCAGGGCTGGGGAAGG - Intronic
1153709387 18:7782600-7782622 GTGGTTGCCAGGGCTGGGGGAGG - Intronic
1154042183 18:10866689-10866711 CTGGTGACCAGGGATGTGGCTGG + Intronic
1154509915 18:15087423-15087445 GTGATGACCAGCTCAGTGGTTGG + Intergenic
1155533666 18:26794128-26794150 GTGGTGGTCGGGGGTGTGGTAGG - Intergenic
1155875785 18:31086601-31086623 GTGGTGATCACGCCTGTAGTTGG + Exonic
1156537671 18:37879594-37879616 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1157165156 18:45352051-45352073 GTCGTGGACAGGGCTGTGGTGGG + Intronic
1157601639 18:48896783-48896805 GTGGGAAGCCGGGCTGTGGTAGG - Intergenic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1159772741 18:72566629-72566651 GTGGTTACCAAGGCTGTGGAGGG + Intronic
1160033455 18:75281573-75281595 GGGGTGCTCATGGCTGTGGTCGG + Intronic
1160516998 18:79484141-79484163 GTGGTGCCCAGGGCAGGGGAGGG - Intronic
1161124125 19:2546419-2546441 GTGGGGCCCAGGGCTGCGGGCGG + Intronic
1161459934 19:4390567-4390589 GTGGTGGCCAGGGCTGCAGCGGG - Intronic
1161502357 19:4623346-4623368 AGGGTGACCAGGGCTGTTTTGGG - Intergenic
1161591002 19:5129035-5129057 GTGGGGGCCAGGGCAGTGGCGGG + Intronic
1161793314 19:6373393-6373415 GTGGGGACCAGTGCTGGGATGGG + Intronic
1161986211 19:7655962-7655984 GAGGTGTCCAGGGCTGGGATAGG + Intergenic
1162035881 19:7938997-7939019 GTGGTTGCCAGGGGTTTGGTAGG + Intronic
1162263022 19:9547834-9547856 GTGGGAACCGGGGCTGTGCTCGG + Intergenic
1162417180 19:10544878-10544900 GTTGGGACCAGGGCTGGGGGAGG + Intronic
1162879043 19:13643928-13643950 GTGCTGACCAAGGATGAGGTAGG + Intergenic
1163420192 19:17209931-17209953 GTTGTGGCCAAGGGTGTGGTAGG - Intronic
1164521159 19:28981419-28981441 GTGGTGACCAGAGGTGGGGCAGG - Intergenic
1164711724 19:30361707-30361729 GTGGGGACCAGGTGGGTGGTGGG + Intronic
1164855514 19:31517710-31517732 GGAGTGACCAGGGCTCTGGGTGG - Intergenic
1165927518 19:39336029-39336051 GTGGGGACCGGGGCTGTAGGGGG + Exonic
1166364821 19:42273034-42273056 GTGGTGACAGGAGCTGGGGTGGG - Intronic
1166373934 19:42316589-42316611 GTGGAGCCCAGGGCTCAGGTTGG + Intronic
1166406796 19:42527352-42527374 GTAGTGAGCTGGGCAGTGGTGGG + Exonic
1166411116 19:42555860-42555882 ATCGTGACCAGGGTTCTGGTCGG - Intronic
1166455321 19:42935721-42935743 ATCGTGACTTGGGCTGTGGTGGG + Exonic
1166674180 19:44729531-44729553 GTGGTTGCCAGGGGTGGGGTGGG + Intergenic
1166683676 19:44782360-44782382 GTGTTGGCCATGGCTGGGGTGGG - Exonic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1166981677 19:46635187-46635209 GAGGTGACCAGGGCTAGGGTGGG - Intergenic
1167530787 19:50014928-50014950 GTGAGGACCAGGGATGTGGGAGG + Intronic
1167611006 19:50507709-50507731 GGGGTGGCCAGAGCTGAGGTGGG + Intronic
1167812376 19:51845634-51845656 GTGGTTACCAAGGCTGGGGGAGG - Intergenic
1168424391 19:56227008-56227030 ATAGTTACCAGGGCTGGGGTAGG + Intronic
1168426279 19:56241734-56241756 GTGGTTACCAGGGCTGGGATGGG - Intronic
925048429 2:791972-791994 GTGATGACCAGCTCAGTGGTTGG - Intergenic
925172632 2:1759644-1759666 GTGGGAACCCGGGCTGTGGAAGG - Intergenic
925300236 2:2806622-2806644 TAGGTGACGAGGGTTGTGGTTGG + Intergenic
925335651 2:3097551-3097573 CTGGTGACTAGGGCTGTGCTTGG - Intergenic
927928191 2:27027303-27027325 GTGGTTTCCAGGCCTGTGGGAGG - Intergenic
928475509 2:31622788-31622810 GTGATGACCAGCTCAGTGGTTGG - Intergenic
929140944 2:38666168-38666190 TCGGTGACCAGGGCCGTGTTTGG + Exonic
929438903 2:41949994-41950016 GAAGTGTCCAGGGCCGTGGTGGG + Intronic
929794693 2:45049985-45050007 CTGCTGCCCAGGGCTGTGGCGGG + Intergenic
930066238 2:47329753-47329775 TTGGTGTTCAGGGCTGTGCTTGG + Intergenic
930314232 2:49777872-49777894 GTGGTTACCAGGAGTGGGGTGGG + Intergenic
931846810 2:66212432-66212454 GTGGTGCTCGGGGCTGGGGTTGG - Intergenic
932263666 2:70347721-70347743 GTGAGGACCAGGGGTGGGGTTGG + Intergenic
932446209 2:71783067-71783089 CTGGTGGCAAGGGCTGGGGTGGG - Intergenic
933358119 2:81240802-81240824 GTGGTGGCCAGTGGTGGGGTTGG - Intergenic
934640506 2:96024733-96024755 GTGGGGACCTGGGCGGTGGGGGG - Intronic
935672424 2:105567230-105567252 GGGGTGATCACTGCTGTGGTAGG - Intergenic
935874362 2:107489803-107489825 GTGGTGACCACTGCTGGGGAGGG + Intergenic
936829520 2:116625980-116626002 GTGGTTACCAGGGCCTTGGCTGG - Intergenic
937707643 2:124939815-124939837 GTGATGACCAGCTCAGTGGTTGG + Intergenic
939068949 2:137516914-137516936 GAGTTGAACAGGGATGTGGTGGG - Intronic
939241926 2:139572521-139572543 GTGGTGGCCAGAGCTGTGCTTGG - Intergenic
941125646 2:161580266-161580288 GGGATGGCCAGGGCTCTGGTGGG + Intronic
941166725 2:162090805-162090827 GTGGTGACCAGGTTTGGGGATGG + Intergenic
941330790 2:164175505-164175527 GAGTTGAACAGGGATGTGGTGGG + Intergenic
941754741 2:169173091-169173113 GTGATGAGCAAGGCTGTGGTAGG - Exonic
942255746 2:174096251-174096273 GTGGTTACCAGGGATTAGGTTGG + Intronic
942993108 2:182226671-182226693 GTATTGACCAGTGCTGTAGTTGG - Intronic
945036191 2:205706068-205706090 ATGGTGAGCGGGGCTGTGGGGGG - Intronic
945544760 2:211137240-211137262 GAGTTGAACAGGGTTGTGGTTGG - Intergenic
946760342 2:222987570-222987592 CAGGGGACCAGGGCTGTGGTTGG + Intergenic
947097048 2:226578093-226578115 GTGGTGTCCTGGGCTATGGCTGG - Intergenic
948395077 2:237639513-237639535 TTGGTGCCCAGGTCTTTGGTTGG + Intronic
948455682 2:238103629-238103651 GTGGTGTCCAGCGCGGTGGCTGG - Intronic
948770912 2:240250891-240250913 GTGGGCACCAGGGCTGGGGCTGG + Intergenic
948790168 2:240372759-240372781 GGAGGGAGCAGGGCTGTGGTGGG + Intergenic
948873168 2:240813679-240813701 GTTCTGACCAGAGCTGGGGTGGG - Intronic
948876840 2:240833963-240833985 GACGTGACCAGGGCTCTGCTGGG - Intergenic
1168738534 20:167255-167277 GTCGTTACCAGGGGTGTGGTTGG - Intergenic
1168893350 20:1308212-1308234 GTGGAGGACTGGGCTGTGGTTGG + Exonic
1169084093 20:2816284-2816306 TTTGTGACCCGGGCTGGGGTGGG - Intronic
1170222834 20:13959266-13959288 GTGATGACCAGCTCAGTGGTTGG + Intronic
1170917506 20:20641984-20642006 GTGGAGTCCAGGACTGTGTTTGG - Intronic
1171204537 20:23268511-23268533 TGGGTGTCCAGGGCTGTGCTGGG - Intergenic
1171421302 20:25019628-25019650 GTGGTGGCAAAGGCTGAGGTGGG - Intronic
1172104105 20:32505865-32505887 GAGGTTACCAGGGCTGGGGGAGG + Intronic
1172111110 20:32545564-32545586 GTGGTGGCCAGGGCTGTGGGCGG - Intronic
1172115179 20:32569476-32569498 GAGGTGACAAGAGCTGGGGTAGG + Intronic
1172442764 20:34977682-34977704 TAGGTGATCAGGGCTGGGGTTGG + Intronic
1172588991 20:36104549-36104571 GTGGGGACCAGGGAGGTGGGGGG + Intronic
1172664736 20:36591213-36591235 CTGCTGACCAGGGCTGAGGCTGG + Exonic
1173226269 20:41164011-41164033 GTGGGGTCCAGGGCTGGGGGAGG + Intronic
1173480578 20:43395689-43395711 GTGGTGACCATGGGTTTTGTGGG + Intergenic
1173757956 20:45534867-45534889 ATGGTGCCCAGGGCTGGGCTGGG + Intronic
1174092248 20:48058786-48058808 GTGGGAACCAGGGCTGTGTGGGG + Intergenic
1175828749 20:61950918-61950940 GAGGGGCCCAGGGCTGTGGAAGG - Intergenic
1175828853 20:61951158-61951180 GGGGTGCCCAGGGCTGGGGGAGG - Intergenic
1176019577 20:62955790-62955812 GTGGAGGCCAGGGCTGTACTGGG + Intronic
1176089766 20:63313594-63313616 GGGGTGATGCGGGCTGTGGTAGG + Intronic
1176156279 20:63622946-63622968 GTGGCGGGGAGGGCTGTGGTAGG + Intronic
1176788156 21:13284356-13284378 GTGATGACCAGCTCAGTGGTTGG - Intergenic
1177565866 21:22819188-22819210 GTGGGAACCAGGGCTGTGCATGG - Intergenic
1177987298 21:27992560-27992582 GTGATGACCAGCTCAGTGGTTGG - Intergenic
1178894643 21:36548585-36548607 GTGGAGACCAAGTCTGTGGCAGG + Intronic
1179152157 21:38818285-38818307 GTGGAGACCCGGGCTTTGGTGGG - Intronic
1179231939 21:39511924-39511946 GTGCAGACCAGGGCTTTGGAAGG - Intronic
1179503414 21:41823960-41823982 TCTGTGACCAGGGCTGGGGTTGG + Intronic
1179551464 21:42146489-42146511 TTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179551479 21:42146543-42146565 TTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179551530 21:42146705-42146727 CTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179793310 21:43768107-43768129 GCCCTGGCCAGGGCTGTGGTCGG + Intergenic
1180056514 21:45361800-45361822 CAGGTGACCAGGGCTGTAGAGGG - Intergenic
1180109942 21:45643086-45643108 GTGGTGGGCAGGGCCGTGGATGG - Intergenic
1181045158 22:20210863-20210885 GGGGTGGCCAGGGCTGTGCATGG + Intergenic
1183497080 22:38152992-38153014 GTGTTGCCCAGGGATGGGGTGGG + Intronic
1183640605 22:39090320-39090342 GTGGAGACCAGAGCACTGGTGGG + Intergenic
1183714766 22:39527234-39527256 GTGGGGAAAAGGGCTGGGGTGGG - Intergenic
1183935294 22:41258419-41258441 GTGGGGACCCTGGCTGTGGTGGG + Intronic
1184389771 22:44196579-44196601 GTGGTCACCAGGGACATGGTGGG + Intronic
1184414496 22:44344376-44344398 ATTGGGACCAGGGCTGTGATGGG - Intergenic
1184430587 22:44439760-44439782 GTCGTGGCCAGGGGTGTGGGGGG - Intergenic
1184723371 22:46328954-46328976 GTGGAACCCAGGGCTGTGGCTGG + Intronic
1184890279 22:47375077-47375099 GTTGTGGCCGGGGCTGGGGTGGG - Intergenic
1184903527 22:47463376-47463398 GTGGGGGCCGGGGCTGTGGTGGG + Exonic
1184914354 22:47558992-47559014 GTGGTGGCCATGGCTGGGTTGGG + Intergenic
1184943446 22:47784721-47784743 GAGAAGACCAGGGCTGAGGTTGG + Intergenic
1185337253 22:50276215-50276237 GCTGTGAGCAGGGCTGTGGGTGG + Intronic
950548498 3:13653026-13653048 CTGGTGACCAGGTCTGGGGGTGG - Intergenic
950773123 3:15328123-15328145 GGGGTGGCCAGGGCTGGGCTGGG - Intronic
951970874 3:28442802-28442824 GAGTTGAACAGGGATGTGGTGGG + Intronic
952740110 3:36726542-36726564 GTGTTGCCCATGGCTGTGATGGG - Intronic
952933308 3:38376245-38376267 GTGGTGCCCAGGCCTGTGAAGGG + Intronic
953897505 3:46813435-46813457 GAGTTGAACAGGGATGTGGTGGG + Intergenic
954361374 3:50124494-50124516 GTGGTGACTGGGGCTGGGGTGGG + Intergenic
954491608 3:50912360-50912382 GTGGTCACTAGGTCTGTGCTGGG + Intronic
954646395 3:52134179-52134201 GTGGTTACCAGGGCTGGGATGGG + Intronic
954659056 3:52216827-52216849 GTGGTGACCAGAGCTCTGAAGGG - Intergenic
954779696 3:53049943-53049965 GTGGTGGCCAGCGCTTTGGGAGG - Intronic
955745648 3:62137712-62137734 GTGATGACCAGCTCAGTGGTTGG - Intronic
957052637 3:75421948-75421970 GTGGTGACCTGGGATGGGGTGGG + Intergenic
959587552 3:108039302-108039324 GAGGAGAGCAGGGCTGTGGTGGG - Intergenic
960349409 3:116574757-116574779 GAGTTGAACAGGGATGTGGTGGG - Intronic
961302209 3:125929609-125929631 GTGGTGACCTGGGATGGGGTGGG - Intronic
961474797 3:127139993-127140015 GCGCTGGCCAGGACTGTGGTGGG + Intergenic
961602489 3:128072350-128072372 GGCCTGACCAGGGCTGTGGGAGG + Intronic
961886249 3:130098169-130098191 GTGGTGACCTGGGATGGGGTGGG + Intronic
962001946 3:131306898-131306920 GCGGGGACCAGTGCTGGGGTAGG - Intronic
962422113 3:135237964-135237986 ATGGTGACCAGCCCTGTGGAGGG - Intronic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
965092218 3:164179265-164179287 GTGGGAACCGGGGCTGTGGGTGG + Intergenic
966490262 3:180519965-180519987 GTCTGGTCCAGGGCTGTGGTAGG - Intergenic
966655708 3:182356087-182356109 GGGGAGGGCAGGGCTGTGGTAGG - Intergenic
966742048 3:183242888-183242910 GAGTTGCCCAAGGCTGTGGTGGG + Intronic
966816765 3:183896166-183896188 GTGGTGGGTGGGGCTGTGGTGGG - Intergenic
968179112 3:196577706-196577728 GTGATGACCAGAGCTGGGGCTGG + Exonic
968596165 4:1486813-1486835 GAGGAGAGCAGGGCTGTGGGAGG - Intergenic
968995440 4:3942326-3942348 GTGGTGACCTGGGATGCGGTGGG + Intergenic
969431358 4:7156687-7156709 CGGGAGTCCAGGGCTGTGGTAGG + Intergenic
969479909 4:7441998-7442020 ATGGTGACCTGGGCTGTGAGAGG - Intronic
969479976 4:7442172-7442194 ATGGTGACCTGGGCTGTGAGAGG - Intronic
969480052 4:7442375-7442397 ATGGTGACCTGGGCTGTGAGAGG - Intronic
969480132 4:7442578-7442600 ATGGTGACCTGGGCTGTGACAGG - Intronic
969758550 4:9166470-9166492 GTGGTGACCTGGGATGGGGTGGG - Intergenic
969791841 4:9498203-9498225 GAGGTGACCCGGGCTCTGGGAGG - Intergenic
969818515 4:9703920-9703942 GTGGTGACCTGGGATGGGGTTGG - Intergenic
970196402 4:13554960-13554982 GTTGTTACCAGGGGTGGGGTTGG + Intergenic
971741938 4:30532568-30532590 GTGGTTACCAGGGCTCAGGATGG - Intergenic
972201420 4:36718094-36718116 GTGTTGAACAAGGATGTGGTGGG + Intergenic
974616394 4:64288606-64288628 GTGATGACCAGCTCAGTGGTTGG + Intronic
975761692 4:77626358-77626380 GTGGTTACCAGAGGTGAGGTGGG - Intergenic
977558983 4:98513325-98513347 GTGGTGAGCAGGGGTGGGGTAGG + Intronic
978075116 4:104518942-104518964 GTGATGACCAGCTCTGTGGCTGG - Intergenic
978510971 4:109517437-109517459 GTTGTTACCAGGGGTGGGGTGGG + Intronic
979666045 4:123312030-123312052 ATGGTGGCCAGGGCGGGGGTTGG - Intronic
980098076 4:128513612-128513634 ATGTTGACCTGAGCTGTGGTAGG - Intergenic
980957612 4:139444991-139445013 GAGTTGAACAGGGATGTGGTGGG - Intergenic
981242140 4:142490721-142490743 GTGGTTACCAGGGGTTTGGGTGG - Intronic
981486416 4:145291341-145291363 GTGGTTTCCAGGGATGTGGCTGG - Intergenic
981584439 4:146285973-146285995 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584442 4:146285997-146286019 GTGGTGAAAAGGACTGTGTTTGG + Intronic
981584445 4:146286021-146286043 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584448 4:146286045-146286067 GTGGTGAAAAGGACTGTGTTTGG + Intronic
981584457 4:146286113-146286135 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584485 4:146286305-146286327 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584488 4:146286329-146286351 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584494 4:146286377-146286399 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584497 4:146286401-146286423 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584509 4:146286493-146286515 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584512 4:146286517-146286539 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584544 4:146286733-146286755 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584547 4:146286757-146286779 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584558 4:146286849-146286871 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584571 4:146286969-146286991 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981584574 4:146286993-146287015 GTGGTGAGAAGGACTGTGTTTGG + Intronic
981683935 4:147431967-147431989 GTGGTTACCAGGGTTGGGGTTGG - Intergenic
982623462 4:157733874-157733896 GAGTTGAACAGGGATGTGGTGGG + Intergenic
984200420 4:176713944-176713966 GTGGTTCCAAGGGCTGTGGCAGG + Intronic
985033616 4:185817246-185817268 CTGGTTAACAGGGCTGTGGGAGG - Intronic
985128136 4:186715241-186715263 GTGGTGGTGGGGGCTGTGGTGGG - Intronic
985541330 5:488940-488962 GGGATGAGCAGGGCTGCGGTGGG + Intronic
985647996 5:1094042-1094064 GTGGTGTCCAGTCCTGTGGGAGG + Intronic
986261709 5:6153166-6153188 GAGTTGAACAGGGATGTGGTGGG + Intergenic
986422763 5:7600728-7600750 GTGGTCACCAGGGGTCTGGTGGG + Intronic
986850346 5:11804684-11804706 GTGGTTACCAGGGGTTTGGAAGG + Intronic
986959719 5:13198279-13198301 GAGTTGAACAGGGATGTGGTGGG - Intergenic
987666117 5:20942781-20942803 GTGATGCCAATGGCTGTGGTTGG - Intergenic
988056683 5:26106195-26106217 GAGTTGAACAGGGATGTGGTGGG + Intergenic
988756571 5:34259387-34259409 GTGATGCCAATGGCTGTGGTTGG + Intergenic
989171050 5:38470417-38470439 GAGTTGATCAGGGTTGTGGTAGG - Intergenic
989334241 5:40296882-40296904 GTGGTGTCCGGGGCTGGGGGAGG - Intergenic
991196502 5:63940667-63940689 GTGATGACCAGCCCAGTGGTTGG + Intergenic
993780580 5:92061452-92061474 GAGTTGAACAGGGATGTGGTGGG - Intergenic
994947223 5:106410475-106410497 TGGATAACCAGGGCTGTGGTAGG - Intergenic
996290140 5:121843069-121843091 GTGGTTACCAGGGATGGGGGGGG + Intergenic
997183198 5:131854315-131854337 GTGGTTTCCAGGGGTGGGGTAGG + Intronic
998079618 5:139263720-139263742 GTAGTGAACAGTGCTGTGGAAGG + Intronic
998496908 5:142598791-142598813 GTGATGGCCACGGCTATGGTGGG + Intronic
998804800 5:145907620-145907642 GTGGTGACTCGGCCTGTGGTGGG + Intergenic
1001550236 5:172597600-172597622 GTGGTGACCATGTCCTTGGTGGG + Intergenic
1001699441 5:173696093-173696115 CAGGTGACCAGGTGTGTGGTGGG + Intergenic
1002443474 5:179276024-179276046 GAGGTCAGCAGGGCTGTGGGAGG + Intronic
1003470038 6:6421006-6421028 GAGTTGAACAGGGATGTGGTGGG + Intergenic
1003665688 6:8109322-8109344 ATTGTCCCCAGGGCTGTGGTTGG - Intergenic
1004319197 6:14619398-14619420 GAGGTGGCCAGGGCTGTTGGGGG - Intergenic
1004629789 6:17410220-17410242 GAGGTGTGCAGGGATGTGGTGGG - Intronic
1004965944 6:20851300-20851322 GTGGTGACCAGGACTTTGTTGGG + Intronic
1005243874 6:23859625-23859647 GTGGTGACAAGTGGTGAGGTAGG - Intergenic
1005564759 6:27079846-27079868 GTCCTGTCCAGGCCTGTGGTTGG + Intergenic
1005692680 6:28322410-28322432 GTGGTGTACAGGGGTGGGGTGGG - Intergenic
1005990355 6:30898364-30898386 ATGGAGACCAGGGCTGTGAGTGG - Intronic
1006502431 6:34467018-34467040 GTGCAGACCTGGGCTGTTGTGGG - Intronic
1006603635 6:35241896-35241918 GTGCTTACCATGGCAGTGGTTGG - Exonic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1007357794 6:41333685-41333707 CTTGTGACAAGGGCTGTTGTGGG + Intergenic
1009994869 6:70886717-70886739 GCTGTGGCCAGGGCTGTGCTGGG - Intronic
1011039474 6:83014219-83014241 GAGTTGAACAGGGATGTGGTAGG + Intronic
1012031700 6:94076550-94076572 GTGCTGAACAGTTCTGTGGTTGG + Intergenic
1012913299 6:105140933-105140955 GTGGTTGCCAGGGGTGTGGGAGG - Intergenic
1013062611 6:106651078-106651100 GTGGTTACCAGGGCTGGGAGAGG - Intronic
1013178908 6:107701423-107701445 TGGGTGACCAGGGCTGTTCTGGG - Intergenic
1013305279 6:108841838-108841860 GGGATGACCAGGGCTGGGGATGG - Intergenic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1015475636 6:133656549-133656571 GAGTTGAACAGGGATGTGGTAGG - Intergenic
1015757501 6:136622304-136622326 GTGGGAACCAGTGCTGGGGTAGG - Intronic
1016175019 6:141070010-141070032 GAGTTGAACAGGGATGTGGTGGG + Intergenic
1016419733 6:143871618-143871640 GAGTTGAACAGGGATGTGGTAGG + Intronic
1016576368 6:145573524-145573546 GAGTTGAACAGGGATGTGGTGGG + Intronic
1017723078 6:157258055-157258077 GTGGCTACTGGGGCTGTGGTGGG - Intergenic
1018123054 6:160656164-160656186 GAGTTGAACAGGGATGTGGTGGG + Intronic
1018630842 6:165821057-165821079 TCGGGGACCAGGGCTGCGGTGGG + Intronic
1019321341 7:416859-416881 GTGGTGTCCAGCGCAGTGGCAGG + Intergenic
1019428160 7:987024-987046 GTGGAGCCCAGGGCTGGGCTGGG + Intronic
1019701324 7:2476168-2476190 AGGGTGACCAGGGCTGGGGTGGG + Intronic
1019898427 7:4000918-4000940 GGGGGGACCATGGCTGTGTTGGG + Intronic
1020082153 7:5291874-5291896 CAGGAGACCAGGGCTGGGGTGGG - Intronic
1020309038 7:6855327-6855349 GAGGTGACCCGGGCTCTGGGAGG + Intergenic
1020319713 7:6930643-6930665 GTGGTGACCTGGGATGGGGTGGG + Intergenic
1021174231 7:17432088-17432110 GAAGTGAGCAGGGCTATGGTGGG + Intergenic
1021664552 7:22962770-22962792 GTGGTGGCTGGGGCGGTGGTGGG - Intronic
1021844056 7:24746844-24746866 GTGTTGCCCAGGGCTGTGAAGGG - Intronic
1022174170 7:27857359-27857381 GTGGGAACCGGGGCTGTGGGCGG - Intronic
1024010280 7:45260686-45260708 CTGGGGACCAGGGCTGGAGTAGG + Intergenic
1024019154 7:45349314-45349336 GTGGTGGCAATGGCTGAGGTGGG + Intergenic
1024714982 7:52068902-52068924 GTGGTGACCAGGGCTGTGATGGG + Intergenic
1024986927 7:55202325-55202347 GTGGGCAGCAGGGCTGTGCTGGG - Intronic
1025190374 7:56891539-56891561 GTGCTGACAAGGACTGTGTTTGG - Intergenic
1025681565 7:63685381-63685403 GTGCTGACAAGGACTGTGTTTGG + Intergenic
1027056485 7:75053151-75053173 GTGGTGGACAGGGCTGGGGGTGG + Intronic
1027186169 7:75972040-75972062 GTGGGGACCTGGGCTGTGGGTGG + Intronic
1027685684 7:81277061-81277083 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1028977804 7:96933455-96933477 ATGGTTCCCAGGGCTGTGCTTGG - Intergenic
1029504447 7:100954051-100954073 GTGGTTACCAAGTTTGTGGTAGG - Exonic
1029504594 7:100955182-100955204 GTGGTTATCAAGGTTGTGGTAGG - Exonic
1029504759 7:100956310-100956332 GTGGTTACCAAGTTTGTGGTAGG - Exonic
1029627532 7:101729686-101729708 GTGTGGCCCAGGGCTGTGTTTGG - Intergenic
1029666279 7:101997109-101997131 GTGCTGACAAGGACTGTGTTTGG - Intronic
1030049061 7:105522092-105522114 GAGGTGGCCAGCGCTCTGGTTGG + Exonic
1031649750 7:124273646-124273668 GTGATGACCAGCACAGTGGTTGG - Intergenic
1032019933 7:128401711-128401733 TGGGTGACAAGGGCTGAGGTGGG + Intronic
1032153227 7:129447888-129447910 GAGTTGAACAGGGTTGTGGTGGG + Intronic
1032240293 7:130154410-130154432 GTGGCGGGCAGGGGTGTGGTGGG + Intergenic
1032390554 7:131552770-131552792 AAGGTGCCCAGGGCTGGGGTGGG - Intronic
1033113675 7:138606274-138606296 GTGGACACCAGGGGTGAGGTTGG + Intronic
1033240379 7:139674223-139674245 TTGGTGCTCAGAGCTGTGGTGGG + Intronic
1034146523 7:148878275-148878297 GAGGTTACCAGGGCTGTGAGGGG - Intronic
1034450442 7:151134487-151134509 CTGGTGCCCGGGGCTGTGGCAGG - Exonic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1034885236 7:154793990-154794012 GTCGTGTCCAGGGCTGGGGTCGG + Intronic
1034897956 7:154889777-154889799 GAGGGGAGCAGGGCTGGGGTGGG - Intronic
1035062039 7:156076427-156076449 GTGGTAAGCAGGGAGGTGGTGGG + Intergenic
1035306636 7:157937176-157937198 GCCGTGAGCATGGCTGTGGTGGG + Intronic
1035446351 7:158945582-158945604 CTGGTGGCCATGGCTGCGGTGGG + Exonic
1035531163 8:351923-351945 GTGGCGACCAGGGCTGGGGAAGG + Intergenic
1035999208 8:4582840-4582862 GTGGGAACCAGGGCTGTGCGAGG + Intronic
1036847972 8:12182524-12182546 GTGGTGACCTGGGATGGGGTGGG + Exonic
1036869333 8:12424807-12424829 GTGGTGACCTGGGATGGGGTGGG + Intergenic
1037779005 8:21855048-21855070 GGGGTGAGCAGGGCTGTGTCAGG - Intergenic
1037886037 8:22596991-22597013 GAGGTGACCAGAGCTGTGCCTGG - Intronic
1038485832 8:27934628-27934650 GTGGTTACCTGGGCTGTGACTGG + Intronic
1038490377 8:27966305-27966327 ATGGTGACAAGGGCAGTGTTTGG + Intronic
1038902429 8:31858543-31858565 GTGATGACCAGCTCAGTGGTTGG + Intronic
1039963808 8:42269704-42269726 ATGGTGTCCAGGGCTGTGCTAGG - Intergenic
1040286792 8:46104563-46104585 GAAGTGACCAGGGCTGTTATGGG - Intergenic
1040323930 8:46331746-46331768 GTGGGAACCAGGGCTGTGTGAGG + Intergenic
1041111492 8:54487128-54487150 GTGATGCCCAGGGCAGTGGAAGG - Intergenic
1041421256 8:57669239-57669261 CTGTTGACCAGGGCACTGGTGGG - Intergenic
1041902788 8:63000439-63000461 GTGGTTACCAGGGGTGGGGAGGG + Intergenic
1042364979 8:67925384-67925406 GTGATGATCAGGGCGGGGGTGGG - Intergenic
1042448181 8:68913953-68913975 GTGGGGACCGGGGCTGGGGGTGG - Intergenic
1042783572 8:72520975-72520997 GGGGTGACCAGGGCTGCAGGGGG + Intergenic
1043510047 8:80941464-80941486 GAAGTAACCAGGCCTGTGGTGGG + Intergenic
1045314413 8:101030594-101030616 GTGTTTAGGAGGGCTGTGGTAGG + Intergenic
1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG + Intergenic
1045542513 8:103100295-103100317 GTGGAGAACAGGGGTGGGGTGGG + Intergenic
1046199440 8:110903744-110903766 GTGGTTACCAGGGGTGTAGGAGG + Intergenic
1048541182 8:135343547-135343569 GTGGTTACCAGGGGTGGGTTAGG + Intergenic
1048952687 8:139509354-139509376 GTGGTCACAAAGGCTGTGCTTGG - Intergenic
1049545244 8:143227785-143227807 GTGGGGCCCAGGGCAGGGGTGGG - Intergenic
1049774758 8:144399108-144399130 GAGGTGCCCAGGGTTGGGGTCGG - Exonic
1049816822 8:144607495-144607517 GTGGTGGGCACTGCTGTGGTGGG + Intergenic
1050482551 9:6101681-6101703 GAGTTGACCAGGGATGTGGTGGG - Intergenic
1052642205 9:31182642-31182664 GTGGTGGTCGGGGCTGGGGTAGG + Intergenic
1055640395 9:78314924-78314946 TTGGTGACCTGGGCTCTGCTTGG + Intronic
1055985540 9:82054680-82054702 GTGGGAACCAGGGCTGTGCATGG - Intergenic
1057386315 9:94608611-94608633 GTGGTGACCTGGGTAGGGGTGGG - Intronic
1057439047 9:95068982-95069004 GGAGTGAACAGGGCTGTGGCAGG - Intronic
1058789450 9:108427602-108427624 GTGGTGGCCAGGGTTTTGGGAGG - Intergenic
1060251875 9:121993107-121993129 GTGTTTTCCAGGGCTGGGGTGGG + Intronic
1061002173 9:127908589-127908611 GTGGGGAACAGGGCTGGGGTGGG + Intronic
1061187007 9:129060661-129060683 GTGGGGACCAAGCCTGGGGTGGG + Intronic
1061557094 9:131377600-131377622 GTGGAGCCCAGGGCTGGGGTGGG - Intergenic
1061910065 9:133717654-133717676 GTGGAGGCCTGGGCTGGGGTGGG - Intronic
1062014044 9:134282429-134282451 GGCGTGACCAGGGCTGGGGCCGG - Intergenic
1062135348 9:134924079-134924101 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1062145878 9:134989431-134989453 GAGGTGAACAGTGCTGTGCTTGG + Intergenic
1062156328 9:135050671-135050693 GTGGTGAGCTGGGCGGTGGTGGG + Intergenic
1062249836 9:135588536-135588558 GGGGTGACCAGAGCCATGGTGGG + Intergenic
1062318223 9:135978431-135978453 GGGGTGTCCAGGGCTGCTGTGGG - Intergenic
1062678128 9:137760326-137760348 CTGTTGGCCAGTGCTGTGGTAGG + Intronic
1185510516 X:660697-660719 GGGGTGGGCAGGGCTGGGGTTGG + Intergenic
1186446737 X:9636125-9636147 GTGGTCACCAGGCCTGGGGGAGG + Intronic
1187520731 X:20011666-20011688 GTGATGACGTGGGCTGTGGTGGG - Intronic
1188378253 X:29459909-29459931 GTAGCGACCAGGGCTGTGGGGGG - Intronic
1189260285 X:39673616-39673638 GTGGGGACGAGGGCTGGGCTGGG - Intergenic
1190333281 X:49248531-49248553 GTGGGGCCCTGGGCTGTGGGCGG + Intronic
1190915808 X:54810299-54810321 GTGCTCATCAGGGCTGTGGGGGG + Intronic
1190938588 X:55018761-55018783 GTTTTGACCAGGGCTGAGGGTGG + Intronic
1192222353 X:69206114-69206136 CTGTTTACCAGGCCTGTGGTGGG - Intergenic
1193024228 X:76827196-76827218 GTGATGACCAGCTCAGTGGTTGG - Intergenic
1193243064 X:79195380-79195402 GTGGCCACTAGGGCTGTGCTCGG - Intergenic
1193957163 X:87877289-87877311 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1194443431 X:93960160-93960182 GAGTTGAACAGGGATGTGGTGGG - Intergenic
1195004222 X:100670677-100670699 ATGGGGACCAGGGATGAGGTGGG + Intronic
1195712242 X:107782623-107782645 GTGGTTACCAGGGGTTGGGTGGG - Intronic
1195803586 X:108737192-108737214 GTGGTGACCCGGGATGGAGTCGG + Intergenic
1197361401 X:125507968-125507990 GTGATGACCAGCTCTGTGGTTGG - Intergenic
1197594675 X:128451127-128451149 GTGGTGGCAGTGGCTGTGGTAGG + Intergenic
1199336125 X:146620476-146620498 CTGGTGACCGGGGCAGGGGTGGG + Intergenic
1200043572 X:153387794-153387816 GTGGAAAGCAGGGGTGTGGTGGG + Intergenic
1200152489 X:153958086-153958108 GTGGTGACCACAGTTGTGGGCGG - Exonic
1200521168 Y:4211102-4211124 GAGTTGAACAGGGATGTGGTGGG - Intergenic