ID: 923721287

View in Genome Browser
Species Human (GRCh38)
Location 1:236469134-236469156
Sequence CTCATTAATCAGAAGGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923721280_923721287 28 Left 923721280 1:236469083-236469105 CCGCTCCCCTTTTTTAATCATAA 0: 1
1: 1
2: 4
3: 37
4: 508
Right 923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG 0: 1
1: 0
2: 0
3: 20
4: 174
923721282_923721287 22 Left 923721282 1:236469089-236469111 CCCTTTTTTAATCATAAGACAGA 0: 1
1: 0
2: 2
3: 43
4: 500
Right 923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG 0: 1
1: 0
2: 0
3: 20
4: 174
923721278_923721287 30 Left 923721278 1:236469081-236469103 CCCCGCTCCCCTTTTTTAATCAT 0: 1
1: 0
2: 0
3: 17
4: 198
Right 923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG 0: 1
1: 0
2: 0
3: 20
4: 174
923721283_923721287 21 Left 923721283 1:236469090-236469112 CCTTTTTTAATCATAAGACAGAC 0: 1
1: 0
2: 0
3: 13
4: 260
Right 923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG 0: 1
1: 0
2: 0
3: 20
4: 174
923721281_923721287 23 Left 923721281 1:236469088-236469110 CCCCTTTTTTAATCATAAGACAG 0: 1
1: 0
2: 0
3: 19
4: 316
Right 923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG 0: 1
1: 0
2: 0
3: 20
4: 174
923721279_923721287 29 Left 923721279 1:236469082-236469104 CCCGCTCCCCTTTTTTAATCATA 0: 1
1: 0
2: 2
3: 30
4: 219
Right 923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG 0: 1
1: 0
2: 0
3: 20
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923721287 Original CRISPR CTCATTAATCAGAAGGGATA GGG Intronic
901821192 1:11830598-11830620 CTCAGTATTCACCAGGGATAGGG - Intronic
904782266 1:32959280-32959302 CAGATGAATAAGAAGGGATAAGG - Intronic
909067411 1:70952050-70952072 CTCATTACTCAGCAGACATAAGG - Intronic
909865225 1:80660242-80660264 CTCATTAATCAGGGGAAATAAGG + Intergenic
910140964 1:84027454-84027476 CTCCTTATTCCAAAGGGATAGGG + Intergenic
910405613 1:86887119-86887141 GTCATTAATCAGAAAGTATGGGG - Intronic
911954017 1:104213174-104213196 CTCATTGATCAGAAGGGTAAAGG - Intergenic
912994206 1:114517068-114517090 CTCATTAATTAGAAGTGTGACGG + Intergenic
913256973 1:116962665-116962687 TTCAGTTATCAGAAGGGAGACGG - Intronic
917372349 1:174308045-174308067 ATCACTAATCATAAGGGAAATGG - Intronic
918657214 1:187042911-187042933 CTCATAAATCAAAAGGAAAATGG + Intergenic
919264356 1:195242171-195242193 CACATTAATCAGTAGAGACATGG - Intergenic
923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG + Intronic
1063095990 10:2909584-2909606 CTCCTTATTCAGAAGGAATTTGG + Intergenic
1064517178 10:16164024-16164046 CTCAATATTCATAAGGGGTATGG + Intergenic
1064809065 10:19173914-19173936 CTCACTCATCACAAGGGACATGG + Intronic
1065158121 10:22892039-22892061 CTTACAAATCAGAAGGGATTGGG - Intergenic
1065927546 10:30448731-30448753 TTGTTTAATAAGAAGGGATAAGG - Intronic
1068026618 10:51653442-51653464 ATCATTAATCATCAGGGAAATGG - Intronic
1068568498 10:58602837-58602859 GTCATCATTCAGAAGGGATCTGG - Intronic
1069562765 10:69442259-69442281 CTCATTACTCAGAAGGGCCTGGG - Intergenic
1071186040 10:83046746-83046768 CTCATTTATAAGAGGTGATATGG + Intergenic
1071595957 10:86925469-86925491 CTTATTAATCAAAATGGTTAAGG - Exonic
1072576796 10:96708084-96708106 TTCATTTATCAGATGGCATAGGG + Intronic
1072840670 10:98770847-98770869 CTCATCAACCAAAAGGGAAAAGG + Intronic
1074883908 10:117679924-117679946 CTCATTTGTAAGAAGGGATGTGG - Intergenic
1074935918 10:118181456-118181478 CTCCTACATCAGAAGGGAAAAGG - Intergenic
1075394867 10:122120039-122120061 CTCATTAATCCCAAAGGATGCGG + Intronic
1075510551 10:123069173-123069195 GTCATTATTCAGAAAGGTTAAGG + Intergenic
1075981397 10:126743327-126743349 TTCATTGAGCAGAAGGTATATGG - Intergenic
1078689240 11:13562443-13562465 CTCATTACACAGAAGGCAGATGG + Intergenic
1078692664 11:13597604-13597626 CTCATTACACAGAAGGCAGATGG - Intergenic
1079802642 11:24889514-24889536 ATCATTAATCATAAGTGAAAAGG + Intronic
1080967380 11:37228862-37228884 CCCATTCATCAGGAGAGATAAGG - Intergenic
1081396606 11:42593369-42593391 CTCAATAATCAGAAAGGAGGGGG - Intergenic
1081723081 11:45304273-45304295 TTCACTAGTCAGAAGGGACAAGG + Intergenic
1084842842 11:71870790-71870812 CTCACTAATCATTAGGGAAATGG + Intronic
1085819128 11:79773132-79773154 CTGAGTAATCAGAAGGGATTTGG - Intergenic
1086996472 11:93362467-93362489 ATCATTAGTCATTAGGGATATGG + Intronic
1091557851 12:1589064-1589086 CTCATCAAGCAGAAGGGAGCTGG + Intronic
1091684268 12:2550434-2550456 CACATTTATCAGAATGGAAAGGG - Intronic
1093110445 12:15145410-15145432 CTCCTTAATCAAAGGGGATTTGG - Intronic
1095491348 12:42737211-42737233 GTCAGTAATTAGAAGGGGTAAGG + Intergenic
1096052839 12:48626495-48626517 ATCATAAATAAGAATGGATATGG - Intergenic
1099211676 12:79798938-79798960 CCAATTAAGCAGAATGGATAAGG + Intronic
1105653638 13:22408761-22408783 CTTATTAGCCAGAAGGGATTGGG + Intergenic
1105830100 13:24156662-24156684 ATCATTGATTAGAATGGATAAGG - Intronic
1108507673 13:51127353-51127375 CCCATTTTTCAGAAGGGAAATGG + Intergenic
1108513909 13:51179438-51179460 ATCCCTAATCAGAAGGGATTAGG + Intergenic
1109291812 13:60485157-60485179 CTCATTAATAAAAAGGAAAATGG - Intronic
1110815227 13:79853507-79853529 TTCATTAATAAGAAGGGAAAGGG + Intergenic
1112104111 13:96221703-96221725 CTCATATATCAGAAGGAACAAGG + Intronic
1112235424 13:97631464-97631486 CTGATCAATCAGAATGGACATGG - Intergenic
1112634854 13:101204239-101204261 CTCCTAAATCACAAGGAATAAGG - Intronic
1113156251 13:107326278-107326300 CTCATTTATCAGAAGGAGAATGG - Intronic
1114802946 14:25798867-25798889 CTAATTAATTTGAGGGGATAGGG + Intergenic
1117002896 14:51389718-51389740 ATCATTAATCATGAGGGATATGG - Intergenic
1117093555 14:52273746-52273768 AACATTAGTAAGAAGGGATATGG - Intronic
1118236137 14:64007049-64007071 ATCATTAATCAGACTGGATAAGG + Exonic
1118415900 14:65536580-65536602 CTCATAAGTCAGAAGAGATTGGG - Intronic
1118686460 14:68296246-68296268 GTCATTCAACAGAAGAGATAGGG + Intronic
1118810927 14:69272962-69272984 CGCATTTCTCAGAATGGATAAGG + Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1120191809 14:81446466-81446488 CCCATTGATCAGAAGTGAGAGGG - Intergenic
1120362613 14:83524784-83524806 CTAACTAATCATAAGGGATTAGG - Intergenic
1121419880 14:93805788-93805810 CTCATTAATGAGAGGAAATAAGG - Intergenic
1121614054 14:95300934-95300956 CTCAGGAATCAGAAGGGCTCTGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124817346 15:33008291-33008313 CAAATTAAGCAGATGGGATAGGG + Intronic
1125254433 15:37746541-37746563 CTTATGAATCAGAAGAGATTGGG + Intergenic
1125884296 15:43217075-43217097 CTCATTTAACAGAAGTGATATGG + Intronic
1126152956 15:45539640-45539662 CTCAATAATAGGAAGGGAGAAGG - Intergenic
1130855912 15:87839899-87839921 GTCATTAATCATCAGGGACATGG + Intergenic
1131401917 15:92131951-92131973 CTCATTAAGCTGCAGGGACAGGG + Intronic
1131743975 15:95424990-95425012 CTCATTAACCATCAGGGAAACGG - Intergenic
1134553291 16:15148275-15148297 CTCATTAGTCATGAGGGAAACGG - Intergenic
1135352970 16:21745525-21745547 ATCAGTAATCAGAAAGGATTAGG - Intronic
1135451456 16:22561648-22561670 ATCAGTAATCAGAAAGGATTAGG - Intergenic
1137255428 16:46771193-46771215 CCCATAAATCAGAAAGGACAGGG + Intronic
1137705032 16:50529192-50529214 CTGATGTATCAGAAGGGAAAGGG - Intergenic
1137807200 16:51318910-51318932 ATAATTAATCAGAGGGGATCTGG - Intergenic
1140146165 16:72311582-72311604 CCCAGTTATCAGAAGGGATTAGG + Intergenic
1142614816 17:1128025-1128047 CCCCTTAACCAGGAGGGATATGG - Intronic
1144433415 17:15217230-15217252 CTCATTCATCACAAGGTTTATGG - Intergenic
1145399929 17:22523266-22523288 TTCATTATGCAGAAGGTATAGGG - Exonic
1153432442 18:5032598-5032620 CTCACTAATCATTAGGGAAATGG - Intergenic
1153546561 18:6212104-6212126 AACATTAATAAGAAGGTATATGG + Intronic
1155022022 18:21905351-21905373 CTCATGAATGAGAAGTGAAATGG + Intergenic
1156801586 18:41121454-41121476 CTCATTGATCAGAAAGAAAAGGG + Intergenic
1158632340 18:59126481-59126503 CAAATTAATAAGAAGGGAGAGGG + Intergenic
1159886319 18:73911166-73911188 CTCACTTATCACAAGGGTTATGG + Intergenic
926481062 2:13395953-13395975 ATCATTAATCATTAGGGAAATGG + Intergenic
928252854 2:29697160-29697182 CTTATCAATCAGAAAGGACAGGG - Intronic
928738207 2:34318130-34318152 CTCATGAAGCAGAAAGGAAAAGG - Intergenic
930087007 2:47504649-47504671 CTCATGAAGCAGAAGGGATGGGG + Intronic
930406575 2:50965025-50965047 CTCATTAAACAAATGAGATAAGG + Intronic
932340346 2:70959427-70959449 CTCAGTAAACAGATGGGATAGGG - Intronic
933005171 2:76983286-76983308 ATTATTAAACAGTAGGGATATGG + Intronic
933987723 2:87606265-87606287 CTCATTCAAGACAAGGGATACGG + Intergenic
935352405 2:102163984-102164006 CTCATTAATGATAAGGCATCAGG - Intronic
936306117 2:111344543-111344565 CTCATTCAAGACAAGGGATACGG - Intergenic
937105010 2:119303168-119303190 CTAATTATTCACAAGGGAGATGG + Intronic
937351164 2:121163153-121163175 CTCATTAGTCATTAGGGAAATGG - Intergenic
938861159 2:135371159-135371181 CTCATTACTCAAAAAGGAAAAGG + Intronic
938966523 2:136393665-136393687 CTCATTAGTGAGAAGGGGTGTGG - Intergenic
939480157 2:142738261-142738283 ATCACTAATCATCAGGGATATGG - Intergenic
939781219 2:146450436-146450458 CTCATCGATCAAAAGGGTTATGG - Intergenic
940053560 2:149489841-149489863 CTCAAAAATCAGAGGGGATGGGG + Intergenic
942422845 2:175825664-175825686 CTTTTTAATGAGAAGGCATATGG + Intergenic
1169823671 20:9742401-9742423 CTCATTAATCAGATGGAAGTGGG + Intronic
1169886274 20:10402019-10402041 CTTATTAATCAAAAGGCATTAGG - Exonic
1170887441 20:20353744-20353766 CTCATGAATCATCAGGGAAATGG + Intronic
1172163922 20:32887156-32887178 ATGGATAATCAGAAGGGATAGGG - Intronic
1176368030 21:6045419-6045441 CTGACTCATCAGAAGGGCTAGGG + Intergenic
1179755489 21:43493123-43493145 CTGACTCATCAGAAGGGCTAGGG - Intergenic
1181918475 22:26300057-26300079 ATCATTAATCATCAGGGAAATGG - Intronic
1182962266 22:34486623-34486645 CTCAGTAATCAGAAGCAATCTGG - Intergenic
1184451118 22:44583433-44583455 CTCATTAATCAGCGGAGACAGGG + Intergenic
951045031 3:18028481-18028503 CTAATAAATCTGAAGGGATATGG - Intronic
951989487 3:28660693-28660715 CTCACTGATCAAAAGGGTTAAGG + Intergenic
954960204 3:54557917-54557939 CTCAGTGATCTGAAGGAATAAGG + Intronic
956638933 3:71396094-71396116 CTCATTCAGGAGGAGGGATAGGG + Intronic
959257493 3:104033111-104033133 CTTATAAACCAGAAGAGATAAGG + Intergenic
961914856 3:130363648-130363670 CTCATTATTCAGCAGGGTGAGGG - Intronic
963392245 3:144680324-144680346 CTCATTAAAGATAAGGGACAGGG + Intergenic
965961627 3:174436056-174436078 CTCATTCATCATAAAGGTTATGG - Intergenic
966196314 3:177317506-177317528 CTCATCATGGAGAAGGGATATGG + Intergenic
967376330 3:188807011-188807033 CTCTTCAAGCAGAAGGAATACGG - Intronic
967604178 3:191424720-191424742 CTCATTAATCAGATGGGACCAGG + Intergenic
971512749 4:27447333-27447355 CGCAATAATCATAAGGGAAATGG - Intergenic
976240352 4:82949246-82949268 ATCATTAATCATCAGGGAAATGG - Intronic
977953260 4:102998762-102998784 CTCATTAATCATTAGGGAAGTGG - Intronic
977983414 4:103353306-103353328 CTCACTAATCATCAGGGAAATGG - Intergenic
979794420 4:124828994-124829016 TATATTAATCAGAAGGGAAAAGG - Intergenic
979808052 4:124999854-124999876 CTCTTGAAACAGAAGGGATTAGG + Intergenic
980031870 4:127841332-127841354 CTCATTAATCAGTAGGAACAGGG - Intergenic
980487822 4:133483012-133483034 CTCACTCACCAGGAGGGATATGG - Intergenic
982502941 4:156181029-156181051 CTTATAAATCAGAAGGAAAAGGG + Intergenic
982944035 4:161595668-161595690 CTGATTAATCAGAATGTACAAGG + Intronic
985012109 4:185593316-185593338 CTCATGTATCAGAAAGGAGAAGG + Intronic
988084832 5:26461635-26461657 CTCATAAATCATAATGGCTAAGG - Intergenic
988628569 5:32903436-32903458 CTCATTAAGGAGATGGGTTATGG - Intergenic
989942910 5:50174748-50174770 CTCAGTAATCACAAGGGGTGAGG - Intergenic
990667194 5:58086335-58086357 CTCAGTAATCTGAAGGGATTTGG + Intergenic
991978339 5:72205100-72205122 CTCATGACTCAGAAGTGATGAGG + Exonic
994141228 5:96343655-96343677 TTCATAAATCAGCAGGGATCTGG - Intergenic
995533748 5:113115498-113115520 GTCATAAATATGAAGGGATAAGG + Intronic
996127837 5:119746969-119746991 CTCATGAAATGGAAGGGATATGG + Intergenic
996315101 5:122152688-122152710 CTCATGAATAGGAAGGGACAGGG - Exonic
997058433 5:130472157-130472179 CTCACTAATCATCAGGGAAATGG - Intergenic
999648226 5:153739941-153739963 CTCATAAATCATAATGGAAATGG - Intronic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1006992492 6:38227499-38227521 CTCATCAGGCGGAAGGGATAGGG - Intronic
1012207940 6:96484148-96484170 CTCGTTAATCAGTAGGCATTTGG + Intergenic
1012382447 6:98636230-98636252 CTCATAGATCAGAAGTGTTATGG + Intergenic
1014878181 6:126686938-126686960 CTCACAGATCAGAAGGGATTAGG + Intergenic
1015781137 6:136866855-136866877 ATCATTAATTAGAAAGGAAAGGG - Intronic
1022201789 7:28124155-28124177 CTTATTAATCAGATTGGATTAGG - Intronic
1024513247 7:50219628-50219650 CTCATTCATCAGAATGACTAAGG + Intergenic
1026044390 7:66896077-66896099 CTCATTAATCAAAACTGATTAGG - Intergenic
1028367828 7:90054896-90054918 CACATTAGTCAGATGGGATTAGG - Intergenic
1029108835 7:98200984-98201006 TTCTTTAATTAGAAGGGAAAGGG - Intronic
1030124026 7:106137779-106137801 TGCATTAGTCAGAAGGGACATGG + Intergenic
1032370047 7:131340066-131340088 CTTCTTAATCAAAAGGGAAAAGG - Intronic
1033142533 7:138840379-138840401 CTCCTTAATGACAAGGGATCAGG + Intronic
1033574407 7:142666436-142666458 TTCATTACGCAGAAGGTATAAGG - Exonic
1033786298 7:144735111-144735133 CTCATTAATTAAAAGTCATAAGG + Intronic
1036125292 8:6056754-6056776 ATCATTAGTGAGAAGGGATGGGG - Intergenic
1039032189 8:33322513-33322535 CTTATAAAACAGAAGGGATGGGG + Intergenic
1039233236 8:35472559-35472581 CACACTTATCAGAAGGGATATGG + Intronic
1039548803 8:38428916-38428938 CTCCTTAATCAGAGCAGATAGGG + Intronic
1041103275 8:54417843-54417865 CTCTTTAAGCAGAACTGATAAGG + Intergenic
1044328217 8:90885095-90885117 CACATGAATTAGAAGGGTTAGGG - Intronic
1045209065 8:100075963-100075985 ATCATTAGTCATAAGGGAAATGG - Intronic
1047278538 8:123424775-123424797 GTCATTAATTCGGAGGGATATGG - Intronic
1049992196 9:1000537-1000559 CTCAGTGAGTAGAAGGGATAGGG + Intergenic
1050089444 9:2002065-2002087 CTCAAGCATCAGAATGGATAAGG + Intergenic
1052886874 9:33657876-33657898 TTCATTATGCAGAAGGTATAAGG - Intergenic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1056661777 9:88548914-88548936 CTCATATATTAGAAGGGGTAAGG - Intronic
1058935338 9:109764546-109764568 CTCAAGAATCAGTAAGGATAAGG - Intronic
1203784147 EBV:117768-117790 CTCATTAGTCAGGAGGTACATGG - Intergenic
1202629100 M:1838-1860 TTCATTATGCAGAAGGTATAGGG - Intergenic
1187183106 X:16961899-16961921 ATCACTAATCATAAGGGAAATGG + Intronic
1187691069 X:21867090-21867112 CAAATTTATCAGAAAGGATAAGG + Intronic
1187878909 X:23828140-23828162 CTCATAATTTAGAAGGGATATGG + Intergenic
1188056409 X:25546092-25546114 CTCATTAATCAGGAAGGAGGTGG - Intergenic
1190508680 X:51155075-51155097 ATCATTAATCATTAGTGATATGG + Intergenic
1192699765 X:73456202-73456224 CTCACTAATCAGAAGGGTAAGGG - Intergenic
1192786792 X:74344080-74344102 GTCATTACTCAGAAGGGGAAAGG - Intergenic
1193924601 X:87467924-87467946 CTTATAAACCAGAAGGGATTGGG + Intergenic
1194127322 X:90035739-90035761 CTGATTTATCAGCAGGGATATGG - Intergenic
1194829805 X:98608505-98608527 CTAATTAATCATATGGGGTAGGG - Intergenic
1194857384 X:98950349-98950371 TTCATTAAGAAGAAGGGATAAGG - Intergenic
1198607810 X:138362306-138362328 CTCATTAATGTGAAGGGAAATGG + Intergenic