ID: 923721419

View in Genome Browser
Species Human (GRCh38)
Location 1:236470168-236470190
Sequence TTGTATACACAGATTAAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923721419_923721421 28 Left 923721419 1:236470168-236470190 CCGCATTTAATCTGTGTATACAA 0: 1
1: 0
2: 0
3: 19
4: 236
Right 923721421 1:236470219-236470241 GGTAAGTATACCTTGCTGCATGG 0: 1
1: 0
2: 1
3: 7
4: 76
923721419_923721420 7 Left 923721419 1:236470168-236470190 CCGCATTTAATCTGTGTATACAA 0: 1
1: 0
2: 0
3: 19
4: 236
Right 923721420 1:236470198-236470220 TATAACAAATGATCACATGTTGG 0: 1
1: 2
2: 1
3: 31
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923721419 Original CRISPR TTGTATACACAGATTAAATG CGG (reversed) Intronic
901386543 1:8913195-8913217 ATGTTTACAAAGATTAAATGGGG + Intergenic
908801422 1:67884620-67884642 TTGTGTACAGAGAGAAAATGTGG + Intergenic
909163851 1:72191703-72191725 TTGTAATCACAGTTTAAAGGTGG - Intronic
909911812 1:81268478-81268500 TTGTAGACACAGTCTAAATGTGG - Intergenic
909925477 1:81432892-81432914 GTGTATACAGAGTTTCAATGTGG + Intronic
910633459 1:89381379-89381401 TAGTTTACACAGATAAAATGAGG - Intronic
910949119 1:92626403-92626425 ATGAATAAATAGATTAAATGTGG - Intronic
916280486 1:163045983-163046005 TTAATTACACAGAATAAATGAGG + Intergenic
916647779 1:166803856-166803878 ATATTTAAACAGATTAAATGTGG - Intergenic
916974826 1:170064659-170064681 TGATATAAACATATTAAATGAGG - Intronic
918268859 1:182875362-182875384 TTGTATATACAGATCACCTGAGG - Intronic
919368165 1:196692364-196692386 TTTTCTTCACAGATTAATTGAGG + Intronic
920760916 1:208783073-208783095 CTGTACACACAGAGTAAAAGAGG - Intergenic
923721419 1:236470168-236470190 TTGTATACACAGATTAAATGCGG - Intronic
1063725036 10:8627610-8627632 TTGTCTATTCTGATTAAATGGGG - Intergenic
1063901095 10:10733163-10733185 TTGTCTACACAGGTAGAATGTGG - Intergenic
1065438225 10:25723239-25723261 TTGAAGACACAGATTAATTAGGG - Intergenic
1065816126 10:29484328-29484350 TTGTTTAAACAAATTACATGCGG - Intronic
1065956776 10:30700568-30700590 TTGTTTAAACAAATTACATGCGG + Intergenic
1068920977 10:62483741-62483763 GTTTTTACACAGATAAAATGAGG - Intronic
1072386684 10:94937791-94937813 TTTTATGAACAGAATAAATGTGG + Intergenic
1074001415 10:109377374-109377396 TTTTATACTCAGATTAAAGAAGG + Intergenic
1075270894 10:121049517-121049539 TTCTTAAAACAGATTAAATGGGG - Intergenic
1075342024 10:121654684-121654706 TTGTATACACAGGTTCAACATGG + Intergenic
1077388769 11:2289517-2289539 TTGTGTGGACAGATTAGATGGGG + Intergenic
1078167844 11:8904976-8904998 TTGAATTCACAGATTAATTGAGG - Intronic
1079293713 11:19212276-19212298 TTGAATACATAGATAAACTGTGG - Intergenic
1079524758 11:21372343-21372365 CTGAATACACAGAATTAATGGGG + Intronic
1079705068 11:23605453-23605475 TTCTAAACAGTGATTAAATGTGG - Intergenic
1081503534 11:43690827-43690849 TTGGAAATACTGATTAAATGGGG + Intronic
1081513359 11:43799601-43799623 TGGGATAAACAGATTTAATGAGG - Intronic
1082766758 11:57174925-57174947 TTGTATTCACAGATTCAACCAGG + Intergenic
1084912315 11:72400709-72400731 TTGTGTACAGAGATCTAATGGGG + Intronic
1085694058 11:78689052-78689074 TTTTAGACAAGGATTAAATGAGG - Intronic
1088794234 11:113253964-113253986 TTGTATTCTCTGATTAAATTGGG - Intronic
1090507865 11:127338726-127338748 TTATAAACACTGATTAAATAAGG + Intergenic
1092599738 12:10046946-10046968 TTATATAGTCATATTAAATGAGG - Intronic
1092993986 12:13930546-13930568 TTTTAAACACAGATTAATGGTGG - Intronic
1093527662 12:20121441-20121463 TTGTATTCACAGTTTTCATGAGG - Intergenic
1095549115 12:43412144-43412166 TTGTATATACAGAGTTAATCAGG + Intronic
1095869921 12:47015399-47015421 TTCTATATAAAGATAAAATGGGG + Intergenic
1099082421 12:78202359-78202381 TAGTAAACAAATATTAAATGAGG - Intronic
1099552301 12:84062775-84062797 TTGGAAAAACAGATTAAATTTGG - Intergenic
1104123980 12:125827351-125827373 TTATATATACAGATTATATAAGG - Intergenic
1105274653 13:18908451-18908473 TTGTAAAGACAGATAAACTGAGG - Intergenic
1106430721 13:29677870-29677892 TTTTATAGACAGAAGAAATGAGG - Intergenic
1106954956 13:34926915-34926937 TCAAATACACATATTAAATGTGG + Intergenic
1106977668 13:35240493-35240515 TTGAATATACAGATTTAATCAGG - Intronic
1107939771 13:45373347-45373369 TTGATTACAAAGATCAAATGAGG - Intergenic
1108672956 13:52710372-52710394 TTGTTGGCAAAGATTAAATGAGG + Intronic
1109272694 13:60272137-60272159 TTGTAAATAGAGCTTAAATGTGG - Intergenic
1110947139 13:81436375-81436397 TTGTATACTTGGAATAAATGTGG - Intergenic
1110988844 13:82010989-82011011 TTGTATTCACAGAAGAAAGGAGG + Intergenic
1112021827 13:95378548-95378570 TTCTCTACACAAAATAAATGGGG + Intergenic
1112287248 13:98115117-98115139 TTAAAAACACAGAATAAATGAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112840831 13:103575739-103575761 TTGAATACACAGACTGAATTTGG - Intergenic
1113718176 13:112529349-112529371 TTATATCAACAGATTAAAAGAGG + Intronic
1118547001 14:66902540-66902562 TTCTATACTCAGTTTGAATGAGG + Intronic
1119004819 14:70914542-70914564 TTGAATACACAGATTCAGTCAGG + Intronic
1121910163 14:97782797-97782819 GTGGATACAGAGAGTAAATGGGG + Intergenic
1124048508 15:26173726-26173748 TTGTATACACAGATTCTAAATGG - Intergenic
1128055341 15:64695160-64695182 TTGTATACAGAGAATTAATTAGG + Intronic
1128352509 15:66900596-66900618 TTGTATACATGGAGAAAATGAGG + Intergenic
1133885014 16:9819091-9819113 AAGGATACACAGAGTAAATGTGG + Intronic
1134832029 16:17331424-17331446 CTGTTTCCACAGACTAAATGAGG - Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1145235580 17:21205750-21205772 TTGTATAGTCAGATTCATTGGGG - Intronic
1150173535 17:63024700-63024722 TTTGCTACACAGATTAAATTAGG - Intronic
1150307110 17:64095038-64095060 TTCTATACAAAGATTAAAGATGG - Intronic
1153442571 18:5136900-5136922 TGGTGTAGACAGATTAAAGGAGG + Intergenic
1154466339 18:14645709-14645731 TTGTAAAGACAGATAAACTGAGG - Intergenic
1156053876 18:32973939-32973961 TTGTCTTCACATATTTAATGTGG + Intronic
1158355162 18:56610212-56610234 CTATATACTCAGTTTAAATGTGG - Intronic
1158654947 18:59322163-59322185 TTGTAAACACAGATTCGTTGTGG + Intergenic
1160688632 19:449783-449805 TTATACAGACAGAATAAATGAGG + Intronic
1163919443 19:20275121-20275143 TTGTATAAAATGATTAATTGAGG + Intergenic
1166245218 19:41520324-41520346 ATGTATACACATCTTAAATTTGG + Intergenic
925085642 2:1105595-1105617 TTCTATACATAGATTTTATGAGG + Intronic
925690607 2:6519097-6519119 TTGTATGAACTGATTGAATGAGG - Intergenic
926102438 2:10127322-10127344 TTGAACTCACACATTAAATGTGG - Intronic
929217140 2:39426586-39426608 ATATATACAGAGAATAAATGTGG + Intronic
929757089 2:44776327-44776349 TTATATACACAATTTAAAGGTGG + Intergenic
931365408 2:61614787-61614809 TTGTTTCCACAGATTAGATCTGG - Intergenic
932160605 2:69456104-69456126 TTGAATAAACAGGATAAATGGGG - Intergenic
933087272 2:78070828-78070850 TTGTAGAAACTGATTGAATGAGG + Intergenic
933388712 2:81644350-81644372 TTCTATCCACAGATAACATGTGG + Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
934583235 2:95464797-95464819 TTGTGTAAACAGTTGAAATGCGG + Intergenic
934596215 2:95611917-95611939 TTGTGTAAACAGTTGAAATGCGG - Intergenic
934888241 2:98043379-98043401 CTGAATACACAGTTTATATGTGG - Intergenic
934954249 2:98603768-98603790 TTGTATACAAACATATAATGTGG - Intronic
935787062 2:106559008-106559030 ATGTCTACACAGAGTAAAGGTGG + Intergenic
938186305 2:129235041-129235063 TTGAACACACAGAGTCAATGCGG + Intergenic
938709603 2:133964841-133964863 TTGAGGACACAGATTGAATGAGG + Intergenic
938764581 2:134451840-134451862 CTGCATACACAAAATAAATGCGG - Exonic
939100025 2:137885152-137885174 TTGGTTACACAGAGTACATGAGG + Intergenic
939187140 2:138874209-138874231 TTGTATACACAGACTTGATTAGG - Intergenic
940284129 2:152016917-152016939 TTTTATACACAGGGGAAATGAGG + Intronic
940328292 2:152448534-152448556 TTGGAAAGACAGATTAAATGTGG + Intronic
940552831 2:155183289-155183311 TTGTGTACACAGAGTATATTAGG - Intergenic
940700778 2:157040082-157040104 GTGTATACAAAGATCAAATGAGG - Intergenic
941020273 2:160400490-160400512 TTTAATACAGAAATTAAATGTGG + Intronic
941242808 2:163061744-163061766 TTTTATCCACAGATTTTATGAGG + Intergenic
942143111 2:172997906-172997928 TTTTATACATAGATTACCTGAGG + Intronic
942163605 2:173218442-173218464 TTAAATTCACAGATAAAATGTGG - Intronic
942792917 2:179781069-179781091 TTGAATCTACAGATTAATTGGGG - Intronic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
945234380 2:207621220-207621242 TGGTATACACACATTAATTGAGG - Intronic
946535913 2:220628034-220628056 ATGTACAGACAGAATAAATGAGG + Intergenic
947019372 2:225657484-225657506 TTGAAGGCACAAATTAAATGAGG - Intergenic
1168902755 20:1378935-1378957 GTTTATACACAGACAAAATGTGG - Intronic
1170190469 20:13639988-13640010 TTGAATACAAAGCTGAAATGTGG - Intergenic
1173067927 20:39731690-39731712 TTATATGAACAGATTAAATAAGG - Intergenic
1174499933 20:50976993-50977015 TTGTATACACAGATCCCAAGAGG + Intergenic
1176808248 21:13512892-13512914 TTGTAAAGACAGATAAACTGAGG + Intergenic
1177095976 21:16833583-16833605 TAGTATACACAGAACAAATGTGG - Intergenic
1177229935 21:18306326-18306348 TTGTATAAACAAATTCATTGCGG + Intronic
1177442939 21:21151360-21151382 TTTCAAACACACATTAAATGAGG - Intronic
1177566001 21:22820744-22820766 TTGATTAAACAGAATAAATGAGG + Intergenic
1179260567 21:39754981-39755003 TTTCATACAGAGATGAAATGTGG + Intronic
1180556141 22:16577255-16577277 TTGTAGTGACAGATTAAATAAGG - Intergenic
1182531059 22:30957838-30957860 TTGTATACACAGAGGTAAAGAGG + Intronic
949875886 3:8625847-8625869 TTGTAGGCAAAGATGAAATGAGG - Intronic
950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG + Intergenic
951419788 3:22470750-22470772 TTGTATCTACAGTTTAAAAGAGG + Intergenic
951713992 3:25619224-25619246 GCGTATACACAGAATATATGGGG - Intronic
955641480 3:61090359-61090381 TTGCATACACAGTTGAAATATGG - Intronic
955994326 3:64663688-64663710 TTCGATACACAGATTACTTGTGG - Intronic
958163223 3:89845399-89845421 TTTAATACACATTTTAAATGTGG + Intergenic
958845349 3:99259155-99259177 TTTTATAAAAAGATTTAATGAGG + Intergenic
959255343 3:104004165-104004187 GACTATACACAGATAAAATGAGG - Intergenic
959608718 3:108270085-108270107 CTGTATCCACAGAGTAAAAGAGG - Intergenic
959907558 3:111727266-111727288 GTGTATACAAAGATTAAATAAGG + Intronic
959979540 3:112500021-112500043 ATGTATCCACAGATTAAAGACGG - Intergenic
960478628 3:118161114-118161136 ATGAATAAACAGATAAAATGTGG + Intergenic
963144966 3:141984076-141984098 ATGGATAAACAGATAAAATGTGG + Intronic
963495779 3:146058758-146058780 ATGTATACATAGAATAGATGAGG + Intergenic
964359978 3:155885299-155885321 TTGTGTACTCAGATTAAAGGAGG + Intronic
964775564 3:160272884-160272906 TTCTATACACATATTCAATGTGG + Intronic
965239605 3:166177941-166177963 TGGTATACACAAAATATATGAGG - Intergenic
966833863 3:184034214-184034236 ATGAATGGACAGATTAAATGTGG + Intronic
966858402 3:184212843-184212865 TTGAATACACACATTAACTGGGG + Intronic
967315228 3:188146094-188146116 ATATATACACAGTTTAATTGAGG - Intergenic
971080144 4:23200793-23200815 TTGTATCAACAGTGTAAATGTGG + Intergenic
971083572 4:23244185-23244207 TTGTATTCACAGATTATACAGGG - Intergenic
971959260 4:33463870-33463892 TTGTGTAAAAAGATAAAATGGGG + Intergenic
972915491 4:43872848-43872870 TTGAATAAAAAGACTAAATGAGG - Intergenic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
977421274 4:96802968-96802990 TTTTATACACAGAAAAAGTGAGG + Intergenic
978884991 4:113758412-113758434 TTGAAAAGACATATTAAATGAGG + Intronic
979001291 4:115223545-115223567 TTACATACACAGATTAGATAGGG - Intergenic
980722860 4:136720368-136720390 TAGTATCCACAGCATAAATGAGG + Intergenic
981321257 4:143394395-143394417 TTGGACACACAGATTAACTGAGG - Intronic
981395460 4:144243186-144243208 TTGAAAACCAAGATTAAATGGGG - Intergenic
982839356 4:160163023-160163045 TTGAATCTAAAGATTAAATGCGG - Intergenic
984534329 4:180954442-180954464 TCCTATACACAAAATAAATGAGG - Intergenic
985246181 4:187981971-187981993 GTGTATAAACAGATGAAATATGG + Intergenic
986728067 5:10614569-10614591 TTATATTAACAAATTAAATGAGG - Intronic
988381944 5:30508860-30508882 TTTTATATACAATTTAAATGGGG - Intergenic
989763133 5:45045137-45045159 TTGTGTACATAGAATATATGTGG + Intergenic
990422626 5:55651889-55651911 TTGTATCCTCAGAGAAAATGAGG + Intronic
990966710 5:61456045-61456067 TGGCATAATCAGATTAAATGAGG - Intronic
991176344 5:63691213-63691235 TTTTATACACAAATAGAATGTGG - Intergenic
991537084 5:67681458-67681480 TTGCATTTACAGATTAAATGGGG - Intergenic
992376410 5:76192188-76192210 AGGTATACACAGATTACTTGGGG + Intronic
994441729 5:99814989-99815011 TAGTACACACAGAGTAATTGTGG - Intergenic
994629818 5:102271106-102271128 TTGTGTAAAAAAATTAAATGGGG - Intronic
994752971 5:103762001-103762023 TTGTATTCACAGATTCTGTGGGG + Intergenic
995024682 5:107406238-107406260 ATGTATACAAATATTAATTGTGG + Intronic
995945989 5:117646347-117646369 TTGTTTTTAGAGATTAAATGTGG - Intergenic
996885482 5:128349311-128349333 TTTTATACATAGAATACATGAGG + Intronic
997814595 5:137003927-137003949 TTTCATTCACAGATTACATGGGG + Intronic
1002959497 6:1900784-1900806 TTGTCTACTCTGATTAGATGTGG - Intronic
1006854365 6:37123053-37123075 TGGTCCACACAGATTACATGTGG + Intergenic
1008422121 6:51313461-51313483 TTGGTTATAGAGATTAAATGTGG - Intergenic
1008798246 6:55333083-55333105 TTGTATACTGAAATTAAATAAGG - Intronic
1008892913 6:56516240-56516262 TGCTATACACGGATTTAATGGGG + Intronic
1009284102 6:61792831-61792853 TTGTATTCACAAATTAATTTGGG - Intronic
1009390544 6:63138674-63138696 GTGTCCACCCAGATTAAATGTGG + Intergenic
1009682667 6:66919030-66919052 ATGTATACACACATAAAATCTGG + Intergenic
1010679973 6:78787439-78787461 TTGGATATACAGATTAATTTGGG - Intergenic
1011487315 6:87856162-87856184 TTGTTTACAAAGAGTATATGAGG - Intergenic
1011819471 6:91234657-91234679 AAGTATACAAAGATTAAATAAGG + Intergenic
1012041063 6:94204303-94204325 TATTAAACACAGATTAATTGAGG + Intergenic
1012482817 6:99687012-99687034 TTGTGTTCACAGATCAAAAGGGG - Intergenic
1012811016 6:103958043-103958065 TTGTATACATTAATTAAATCAGG - Intergenic
1013163454 6:107568515-107568537 TTCTACACACAGAATAAATTAGG + Intronic
1014151637 6:118063588-118063610 TTGTATACACAGCTTTGATATGG - Intronic
1015011987 6:128360320-128360342 TGAAATACAGAGATTAAATGAGG - Intronic
1015847879 6:137539991-137540013 TAGTTTATACAAATTAAATGTGG + Intergenic
1015945698 6:138498381-138498403 TTGGATGAACAGATTAAAAGTGG - Intronic
1016723237 6:147327374-147327396 TTATATATACAGACTAAATCAGG - Intronic
1016740612 6:147524920-147524942 TTTTATACACAGGGAAAATGAGG + Intronic
1017905459 6:158755014-158755036 TTATAGACAGAGATTGAATGTGG + Intronic
1018589024 6:165396204-165396226 TATTATACACATATTACATGTGG - Intronic
1019161480 6:170070040-170070062 TTTTATATACAGAATATATGTGG - Intergenic
1019838048 7:3410482-3410504 TTGTGTACACATCTTATATGGGG + Intronic
1020592665 7:10161251-10161273 ATGTATACACAGTATAAATTCGG - Intergenic
1020750741 7:12138358-12138380 TTGTAGAAACTGATTGAATGTGG - Intergenic
1021068828 7:16211666-16211688 TAGTGGACACAGAGTAAATGCGG + Intronic
1021172154 7:17412434-17412456 TTATATACACATATTTTATGTGG + Intergenic
1021279910 7:18705080-18705102 GTGTTTAAACACATTAAATGGGG + Intronic
1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG + Intergenic
1022214853 7:28248767-28248789 TTTTATACAAATATTATATGGGG - Intergenic
1022737870 7:33092894-33092916 TTGTATATACAGACTACACGGGG - Intergenic
1024719816 7:52122924-52122946 TTTTATTCACTGATAAAATGAGG - Intergenic
1027720738 7:81738445-81738467 TTTTATACACAGAATATTTGTGG + Intronic
1028042094 7:86065424-86065446 TTGTATTCAAAGATAAAAAGGGG - Intergenic
1028720685 7:94027469-94027491 ATGTACAAACAAATTAAATGAGG - Intergenic
1030449831 7:109694072-109694094 TTTTATACACAGAAAAAAAGTGG + Intergenic
1033233685 7:139621413-139621435 TTTGATACACAGATGCAATGGGG - Intronic
1033470625 7:141645810-141645832 TTGCTTTGACAGATTAAATGAGG - Intronic
1034015313 7:147577510-147577532 TTGTATACACAAGTAGAATGGGG - Intronic
1035740320 8:1922958-1922980 TTGTAGACAAAGTTTACATGGGG + Exonic
1035862431 8:3044337-3044359 ACGTATACACATCTTAAATGTGG - Intronic
1036938111 8:13024815-13024837 TTGTATACAAATATTTAATTTGG + Exonic
1037244067 8:16811459-16811481 TTGTTTAGACACATTAAGTGAGG - Intergenic
1037266243 8:17063982-17064004 GTGAATAAACAGAGTAAATGAGG - Intronic
1038814919 8:30892453-30892475 TTTTATACACATTTTAAATTAGG + Intergenic
1039351998 8:36773160-36773182 TTGTATGGGCATATTAAATGGGG + Intergenic
1039535342 8:38306588-38306610 TTGTATAAACAGTTTACATATGG + Intronic
1039736210 8:40335558-40335580 TAGAAGACACAGATTGAATGAGG - Intergenic
1041821339 8:62037286-62037308 ATCTATACACTGATTAAATAAGG + Intergenic
1041995107 8:64045654-64045676 TTGTATACATATATTATATATGG + Intergenic
1042679017 8:71359345-71359367 TGGTATTAACAGATTTAATGTGG - Intronic
1043540535 8:81257266-81257288 TTGAATTGACAGATTAAAAGAGG + Intergenic
1043813812 8:84776901-84776923 TTGTGTAAACAGATAAAAGGAGG - Intronic
1044542662 8:93425045-93425067 GTGTATACACAAATTCTATGTGG - Intergenic
1045746554 8:105429577-105429599 CAGAATGCACAGATTAAATGAGG - Intronic
1046030906 8:108783068-108783090 TTCAATACACTGATTTAATGGGG - Intronic
1046349696 8:112991371-112991393 TTGACTACACAGCATAAATGGGG - Intronic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1046584401 8:116133549-116133571 TTGTTTTCACAGTTCAAATGGGG - Intergenic
1048886967 8:138916471-138916493 TTGTTGACACAGGTAAAATGAGG + Intergenic
1049003963 8:139843237-139843259 TTTTATGCACAGATAAACTGAGG + Intronic
1051720392 9:20030700-20030722 TTATATAAGCAAATTAAATGAGG - Intergenic
1051778747 9:20665532-20665554 TTGTATAGACATATAAAAGGTGG - Intronic
1052205654 9:25836484-25836506 TTGTATACACAGTTTAAACCAGG - Intergenic
1055982839 9:82022541-82022563 TTTTAGACAGAAATTAAATGAGG + Intergenic
1056034813 9:82593228-82593250 TTTTATTCACAGATCAAATTGGG + Intergenic
1057487665 9:95498751-95498773 TTGAATACACAGATATAATCAGG - Intronic
1061304075 9:129722600-129722622 TTTAATACACAAACTAAATGAGG - Exonic
1189258194 X:39656692-39656714 TTGGAGAAACAGATTAAAAGAGG + Intergenic
1191189835 X:57655196-57655218 TAGTATCCACAGCATAAATGAGG + Intergenic
1192095847 X:68209754-68209776 TTGGTTGCAAAGATTAAATGAGG + Intronic
1193345819 X:80403459-80403481 ATATATACTCAGATTCAATGAGG - Intronic
1194315722 X:92374848-92374870 TTTTATACACAATTTAAATATGG - Intronic
1194323828 X:92485049-92485071 TTGTATTTACATATAAAATGAGG + Intronic
1194439703 X:93916833-93916855 TTGGATAAATAGATTAAGTGAGG - Intergenic
1196631547 X:117946005-117946027 TTTTATACACAGACTAAAGAAGG + Intronic
1199208749 X:145181095-145181117 TTGTTAACACAGGTTACATGGGG - Intergenic
1199379607 X:147154412-147154434 TTGTATATACAGTTTAAATTAGG - Intergenic
1199675829 X:150188546-150188568 TTGCATTCACAGAGTGAATGGGG + Intergenic
1200623772 Y:5486382-5486404 TTTTATACACAATTTAAATATGG - Intronic
1200631929 Y:5598140-5598162 TTGTATTTACATATAAAATGAGG + Intronic