ID: 923723273

View in Genome Browser
Species Human (GRCh38)
Location 1:236485193-236485215
Sequence CTGGGTAACCAAAAGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923723273_923723280 27 Left 923723273 1:236485193-236485215 CCAAATCCCTTTTGGTTACCCAG 0: 1
1: 0
2: 1
3: 14
4: 124
Right 923723280 1:236485243-236485265 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
923723273_923723281 28 Left 923723273 1:236485193-236485215 CCAAATCCCTTTTGGTTACCCAG 0: 1
1: 0
2: 1
3: 14
4: 124
Right 923723281 1:236485244-236485266 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923723273 Original CRISPR CTGGGTAACCAAAAGGGATT TGG (reversed) Intergenic
901056924 1:6452700-6452722 CTGAGTAGCCAAGAGGGCTTTGG + Intronic
902619501 1:17642681-17642703 CTGGGTGACCAGAAGGCCTTTGG + Intronic
902810482 1:18885352-18885374 CTGGGTCCCCAAAAGGGCTTAGG + Exonic
907833803 1:58090471-58090493 ATTGGTAAACAAAAGGGAATTGG - Intronic
908851221 1:68378283-68378305 CTGGTAAACATAAAGGGATTAGG + Intergenic
909903779 1:81171744-81171766 TTTGGTAACCAAAAGAGATCAGG - Intergenic
911210562 1:95134275-95134297 TTGAGTAAGCAAAAGTGATTGGG + Intronic
912747719 1:112259272-112259294 CTGGGAAACAAAAAGGGTTTTGG - Intergenic
915784017 1:158587528-158587550 CAGGGTAAGCAAAAGAGAGTGGG + Intergenic
917494899 1:175531520-175531542 CTGTGTAAGCTAAAAGGATTTGG - Intronic
923723273 1:236485193-236485215 CTGGGTAACCAAAAGGGATTTGG - Intergenic
923723326 1:236485528-236485550 CCGGGTAACCAAAGGAGATTTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1066298343 10:34075610-34075632 ATGAGCAACAAAAAGGGATTTGG + Intergenic
1068111981 10:52690529-52690551 CTGGGTTAAGATAAGGGATTGGG + Intergenic
1070485482 10:76926631-76926653 CACGGTAATCTAAAGGGATTTGG - Intronic
1073344840 10:102775296-102775318 GAGGGTAGCCAGAAGGGATTTGG + Intronic
1075519168 10:123133840-123133862 CTGGGTATCCAGCAGCGATTGGG + Intergenic
1078469976 11:11578938-11578960 CTGGAAACCCAAAAGGGATGGGG + Intronic
1079097013 11:17517499-17517521 CTGGTGAACCAAAAGGGACTTGG + Intronic
1080752882 11:35166875-35166897 CTGGGCAGCCAAAGGCGATTCGG + Intronic
1081154094 11:39667663-39667685 CTGGGTTAAGATAAGGGATTTGG - Intergenic
1083161912 11:60859560-60859582 ATGGGTCACCACAAGGGACTGGG - Intergenic
1083245189 11:61421361-61421383 GTGGGTAACCAAAAATGCTTAGG - Intronic
1083682427 11:64357732-64357754 CTGGGTAGCCAGCAGGGATTGGG + Intergenic
1085819128 11:79773132-79773154 CTGAGTAATCAGAAGGGATTTGG - Intergenic
1086929158 11:92673521-92673543 CTGGGTGACAATAAGGGGTTGGG + Intronic
1087091247 11:94275475-94275497 GTGGGTAACCAATAGGGGTTTGG + Intergenic
1088461598 11:110089115-110089137 CTTTGTAACCAAAAAAGATTTGG + Intergenic
1089985680 11:122810588-122810610 CTGAGTATCCAAAAGTGCTTTGG - Exonic
1098739353 12:74152339-74152361 ATGGCTACCCAGAAGGGATTTGG + Intergenic
1099379786 12:81939634-81939656 CTGGGTAACAAGTAGAGATTGGG - Intergenic
1099454098 12:82843644-82843666 CTGGGTAAAGAAAGGTGATTTGG + Intronic
1099884356 12:88508794-88508816 CTGAGTAATAAAATGGGATTTGG + Intronic
1102074154 12:110046761-110046783 GTGGGTATCCAATGGGGATTTGG + Intronic
1111775160 13:92652384-92652406 CAGGGTAACTAAAAGGCATAAGG - Intronic
1112712142 13:102141198-102141220 CTGGGTGACCAAAGTTGATTGGG - Intronic
1115135831 14:30107138-30107160 CTGGGGAAGCACAAGGGGTTGGG + Intronic
1115411845 14:33084231-33084253 TTGTGTAACTAAAAGTGATTAGG - Intronic
1116372778 14:44157108-44157130 CATGGTAACCAAAAGAGATCAGG + Intergenic
1118380984 14:65217263-65217285 CAAGGAAACAAAAAGGGATTTGG - Intergenic
1119520936 14:75284612-75284634 CTGAGTGAGTAAAAGGGATTTGG - Intergenic
1119978866 14:79057110-79057132 GTGGGTAACCAAATGTTATTTGG + Intronic
1120175680 14:81290813-81290835 CTTGGTAACTAAAAGAGAGTTGG - Intronic
1128749409 15:70138353-70138375 CTGGGTACCCAGAAGAGGTTTGG + Intergenic
1130035902 15:80361256-80361278 CTGGGTCAGGAAAAGGGATAGGG + Intronic
1131100422 15:89684584-89684606 ATAGGTAGCCAAAAGGGGTTTGG - Intronic
1132068035 15:98749348-98749370 CTTGGTGACCCAAAGTGATTTGG + Intronic
1133848556 16:9480097-9480119 CTGGGTGACCCAAAGTGATGGGG + Intergenic
1134569639 16:15280284-15280306 CTGTACAACCACAAGGGATTTGG - Intergenic
1134732740 16:16475765-16475787 CTGTACAACCACAAGGGATTTGG + Intergenic
1134934702 16:18236203-18236225 CTGTACAACCACAAGGGATTTGG - Intergenic
1135092241 16:19527041-19527063 CAAGGTAACCAGGAGGGATTAGG - Intronic
1137973462 16:53009260-53009282 ATTGGAAACCAAAAGGGAGTAGG - Intergenic
1140756398 16:78071407-78071429 CTGAGGAGCCAAGAGGGATTTGG + Intergenic
1148194829 17:45705778-45705800 CTGGGTAACCAATACGTATGTGG + Intergenic
1149009537 17:51841101-51841123 ATGGGTAAACAAAAGGGACTTGG - Intronic
1150655626 17:67037466-67037488 GTGGGAGACCCAAAGGGATTTGG - Intergenic
1150811790 17:68362509-68362531 CAGGGGAACCAAATGGGGTTTGG - Intronic
1151018582 17:70585657-70585679 CTGGATAAACAAGAGGCATTAGG + Intergenic
1151552152 17:74828399-74828421 CTCGGACACCCAAAGGGATTAGG + Intronic
1153426489 18:4970659-4970681 CTGGGTAAACTGAAAGGATTAGG + Intergenic
1154489885 18:14913212-14913234 CTGGGTAACTAAAAGGCTGTAGG - Intergenic
1156140808 18:34108517-34108539 AATGGTAACCAAAAGGGATCAGG + Intronic
1156145234 18:34167252-34167274 CTTGGTATCCATTAGGGATTGGG - Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1161148469 19:2694127-2694149 CTGGGTAAGCACAGGGGATTTGG + Intronic
1161740182 19:6016363-6016385 CTGTGTTACCAAATGGGATGAGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165846808 19:38823297-38823319 CTGGGTCACCAAAATGTATCCGG - Intronic
1166169179 19:41015367-41015389 CTGGGTATGCCAAAGGGATGTGG + Intronic
925056565 2:861287-861309 CTGAGTAACAAAAAGGGAAATGG - Intergenic
927353167 2:22142803-22142825 CAGGGTCAGCAAAAGTGATTGGG - Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
931683720 2:64774215-64774237 CTGGGAAACCAAAATAAATTAGG - Intergenic
937492814 2:122387618-122387640 CTGTGTAGAGAAAAGGGATTTGG + Intergenic
938705432 2:133920523-133920545 CTGGGGAAAGAAAAGGGATATGG + Intergenic
938885865 2:135647189-135647211 GTATGTAACCAAATGGGATTGGG - Intronic
939245612 2:139619920-139619942 CTTGCAAACCAGAAGGGATTGGG - Intergenic
939744504 2:145952138-145952160 CTGGGGAAGCACAAGGGATCAGG - Intergenic
939941922 2:148361868-148361890 CTGGGGAAGCACAAGGGGTTGGG + Intronic
940002909 2:148984689-148984711 CTGGGAAAGCAAAGGGGACTGGG + Intronic
942758668 2:179372290-179372312 CTGGGAAATCAAAAGGGAGTTGG + Intergenic
942759927 2:179385954-179385976 CTTGGGAAGCAAAAGGGATCAGG + Intergenic
943807542 2:192140980-192141002 CTGGGTATACAAAAGTGAGTGGG + Intronic
948773685 2:240268468-240268490 CTTACAAACCAAAAGGGATTGGG - Intergenic
1171569055 20:26228952-26228974 CTGAGTAAATAAAAGGGTTTGGG + Intergenic
1181659734 22:24335522-24335544 CTGGGAAAGGAAAAGGGATGTGG + Intronic
1182508847 22:30804164-30804186 CTGCCTAGGCAAAAGGGATTTGG + Intronic
1183707531 22:39483653-39483675 CTGGGTGAGCAAAAGGGGCTAGG - Intronic
951173657 3:19573855-19573877 CTAGGAAAACAAAAGGGATGGGG + Intergenic
957869823 3:86076917-86076939 CTGGGAAGACAAAAGGTATTTGG - Intergenic
961647947 3:128402480-128402502 GTGGGTAAGCAAACGGGCTTGGG + Intronic
962378803 3:134880337-134880359 CTGGGTCAACAAAGGGGCTTTGG + Intronic
962488031 3:135863769-135863791 CTGGGTAACAAAATGAGACTTGG + Intergenic
964214331 3:154262778-154262800 CTGGGGAATCACAAGGGGTTGGG + Intergenic
968377758 4:57843-57865 CTGGAAAAACAAAAGGGTTTTGG + Intronic
971897520 4:32616828-32616850 CTGGGAAACCAAAATGCAATGGG + Intergenic
973182830 4:47290512-47290534 CTGGGTAACAGGCAGGGATTGGG + Intronic
974343676 4:60649473-60649495 CTGGTTAGCCAAATGGGTTTGGG - Intergenic
975429058 4:74266991-74267013 CTGGGGAACCTAAAGGGATTTGG + Intronic
978628851 4:110719492-110719514 CTAGTTAACCAAAAGAGATCCGG - Intergenic
983331945 4:166341125-166341147 CTCGGTAACCAGAAGGCTTTTGG - Intergenic
985036586 4:185846596-185846618 AAGGCTAACCAAAAGGGCTTTGG + Intronic
989267842 5:39498169-39498191 CTGGGTAAACAAAAGAGAATTGG + Intergenic
994063020 5:95502760-95502782 TTGGGTGAACAAAAGGGATTGGG - Intronic
995346438 5:111125086-111125108 CTGGGTAAGAATAAGGGATGGGG + Intronic
995678360 5:114688839-114688861 CTGGGAAACCAAAAGTGGTGTGG - Intergenic
998159409 5:139804701-139804723 CTGGGTATGCAGAAGGGACTGGG - Intronic
1001378923 5:171289545-171289567 CTGGGCAACAAAAAGAGATCTGG + Intronic
1001466943 5:171975792-171975814 CTTGGTGAATAAAAGGGATTAGG + Intronic
1001670469 5:173469241-173469263 CTGGGCAACTAAAAGAAATTGGG + Intergenic
1006176707 6:32126908-32126930 CTAGATAACCAAAGGGGATGTGG + Intronic
1006672106 6:35735959-35735981 ATTTGTAACCTAAAGGGATTCGG - Intergenic
1010716522 6:79236005-79236027 CTGTGTTACCAAAGTGGATTTGG - Intergenic
1012070759 6:94612495-94612517 CTAGGTAACCAAAACAGAATTGG + Intergenic
1012255413 6:97026177-97026199 ATGGGGAAACAAAAGGGTTTAGG - Intronic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013745830 6:113344914-113344936 CTGGATAACCAAAAAGGCCTAGG - Intergenic
1016967167 6:149729630-149729652 CTGGGAAAACAAAAGGTAATAGG - Intronic
1019990865 7:4689854-4689876 CTGGGTCACCTAAGGGGACTGGG - Intronic
1020902084 7:14016891-14016913 CAGGGTAACACAGAGGGATTGGG + Intergenic
1022794928 7:33724461-33724483 CTGGGTGACAAGATGGGATTGGG + Intergenic
1023206250 7:37753034-37753056 CTACGTAAACAAAAGGTATTAGG + Intronic
1023238374 7:38115093-38115115 CTGGGTATACAGAAGGGATTAGG - Intergenic
1028692084 7:93663973-93663995 CTGGGGAAACACAAGGGGTTGGG - Intronic
1035462903 7:159056193-159056215 CTTGGTATCCACAGGGGATTGGG + Intronic
1036194704 8:6703915-6703937 CTGGGTAAGAAAGTGGGATTGGG + Intergenic
1041416869 8:57620264-57620286 CCTGGGAACCAAAAGGGTTTAGG + Intergenic
1043571901 8:81613800-81613822 CTCGGTCACCAAGAGTGATTTGG + Intergenic
1044169303 8:89028703-89028725 CTTGCAAGCCAAAAGGGATTGGG + Intergenic
1049837018 8:144742775-144742797 GTTGGTAAACAAAGGGGATTGGG + Intronic
1059520415 9:114935464-114935486 CAGGGTAACCGAAAGAGATCTGG + Intergenic
1061773909 9:132947782-132947804 CTGGGTAACAAAGAGAGACTTGG + Intronic
1203571480 Un_KI270744v1:136404-136426 CTGGAAAAACAAAAGGGTTTTGG - Intergenic
1187746326 X:22413198-22413220 CTGGGTAACAAATGGGGATGTGG + Intergenic
1190447011 X:50536031-50536053 CTGAGTAACACAAAGAGATTGGG + Intergenic
1197081364 X:122421806-122421828 CAGGAAATCCAAAAGGGATTCGG + Intergenic
1200801307 Y:7389316-7389338 CTGGGTCACCAAAATGTATCTGG + Intergenic