ID: 923729336

View in Genome Browser
Species Human (GRCh38)
Location 1:236535638-236535660
Sequence TTGTGTGTAGAGAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923729336 Original CRISPR TTGTGTGTAGAGAATGGGGA AGG (reversed) Intronic
901053500 1:6437714-6437736 CTGTGTCTAGGGAGTGGGGAGGG + Intronic
901127093 1:6937283-6937305 TGGTAAGTAGTGAATGGGGATGG - Intronic
902480782 1:16710451-16710473 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
903217928 1:21853244-21853266 TTGTGGTTAGAGGCTGGGGAGGG - Intronic
904283924 1:29442030-29442052 TTTTGTGGAGAGGATGGCGAGGG + Intergenic
904755736 1:32767637-32767659 TTATGTGTCCAGACTGGGGAAGG + Intronic
904833781 1:33322054-33322076 TTGTGTGTAGCAAAGAGGGAGGG - Intergenic
905033451 1:34902660-34902682 CTCTCTGTAGAGAATGGGGAAGG - Intronic
905071158 1:35226538-35226560 TTTTGTGTAGAGATTGGGGAGGG + Intergenic
905721479 1:40206583-40206605 TTGTGTGCAGAGAAGTGGCATGG - Intronic
905772495 1:40647329-40647351 CTGTGAGTAGAGGATGGGGAGGG - Intronic
905856250 1:41316701-41316723 TTCTGTCTAGAGAATTGGGCTGG - Intergenic
906139411 1:43524855-43524877 AGGTGTAAAGAGAATGGGGAGGG + Intergenic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907269852 1:53284496-53284518 TTGTGAGGAGAGTTTGGGGATGG - Intronic
907729025 1:57047833-57047855 TGGTGTATAGAGCATGGGGCTGG - Intronic
908396177 1:63727785-63727807 TGGTGAGTAGTGAATGGGGAGGG + Intergenic
909111307 1:71481354-71481376 TTGTGTAAAGAGAATGGTTATGG - Intronic
909180392 1:72416344-72416366 TTGTGTGTAGAGAGTGGTAAGGG + Intergenic
909341631 1:74538500-74538522 TTGTGTGGAAAGAATATGGAGGG + Intronic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910105517 1:83627603-83627625 ATGGGTATAGAGAAAGGGGAAGG + Intergenic
910781457 1:90939989-90940011 ATGCTTGTAGAGAATGTGGACGG - Exonic
911498157 1:98655472-98655494 TTGTCAGTAGAGAATCTGGAGGG - Intergenic
912265247 1:108150772-108150794 TTGTGTGTAGGGAAAGGGAGTGG - Intronic
912902046 1:113661717-113661739 TTGTGTGCAGAGAAAAGAGAAGG + Intronic
912949957 1:114113780-114113802 TGCTGTGTGGAGAATGGGGCGGG - Intronic
913061542 1:115212982-115213004 TTGTGTATGGAAAATGGAGAAGG - Intergenic
913986054 1:143567072-143567094 TTGTGTCTAAAGAACGGAGATGG - Intergenic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
914898672 1:151699223-151699245 TTGAGTGCAGGGAATGGAGAAGG + Intergenic
915033402 1:152903058-152903080 TTGGGTGCAGGGAATGGGGGAGG - Intergenic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
915687078 1:157644456-157644478 TTGTGTGTGGAGAGAGGTGATGG + Intergenic
917589232 1:176459840-176459862 TTATGGGTAGAGGATGGGGGGGG + Intergenic
917803943 1:178596991-178597013 TTGAGTGGTGAGAATGGAGAAGG - Intergenic
918746763 1:188211189-188211211 TGGGGTGTAGAGAAAGGTGAGGG + Intergenic
918860464 1:189819604-189819626 ATGTGTGTGGAGATTGGGGTAGG + Intergenic
919163951 1:193868531-193868553 TTTTATGGAGAGGATGGGGAGGG - Intergenic
919612347 1:199760635-199760657 TTGTTTGTAGAGGCTGGGCATGG - Intergenic
920084044 1:203401492-203401514 CTGTGTATAGAGAGTGCGGAAGG + Intergenic
920192182 1:204200856-204200878 TGGTGTGGAGAGAATAGGGGTGG - Intronic
920203898 1:204277544-204277566 TTGTGGGTTGAGAATTGGGGAGG - Intronic
920670056 1:207996922-207996944 TTCTCTGCAGAGACTGGGGATGG - Intergenic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
920819281 1:209365236-209365258 TTGTGGTTGGAGAGTGGGGAAGG - Intergenic
920857308 1:209673842-209673864 TTGTGTGTGGAGAATGGTCAAGG - Intergenic
921595241 1:217047507-217047529 TTGAGTGATGACAATGGGGATGG - Intronic
922000352 1:221471276-221471298 GTGTGTTTGGAGGATGGGGAGGG - Intergenic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
922476259 1:225908741-225908763 TTGTTTGTGGGGACTGGGGAAGG + Intronic
922496237 1:226060477-226060499 TAGAGTCTAGATAATGGGGAAGG - Intergenic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923356827 1:233164858-233164880 TGGTTTGTAGAGGCTGGGGAGGG + Intronic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1064276292 10:13908313-13908335 TTCTGGGGAGGGAATGGGGAGGG - Intronic
1064371268 10:14753607-14753629 TTGTGTGTAGATGGTTGGGAAGG + Intronic
1064623696 10:17240920-17240942 GTGTGTGTAGTGATGGGGGAGGG + Intergenic
1066105398 10:32151955-32151977 TTGTGGGTGGAGCAAGGGGAAGG + Intergenic
1067430715 10:46242027-46242049 GTGTGAGTAGGGCATGGGGACGG - Intergenic
1068224738 10:54092448-54092470 TAGTGTGTATGGCATGGGGAGGG - Intronic
1068461532 10:57336237-57336259 TTTTGTGTCCAGAATTGGGAGGG + Intergenic
1068610476 10:59054733-59054755 GTGAGTGTAAAGAAAGGGGAGGG - Intergenic
1069625558 10:69865736-69865758 TTGAGTCTAGAGAAGGGGGCTGG + Intronic
1069851532 10:71408569-71408591 TGGGGTGTAGAGAGTGGGGGTGG + Intronic
1070758134 10:79006132-79006154 TGTTGTGTAGAGATTGGGGTGGG - Intergenic
1070869166 10:79733400-79733422 GTGAGTGTAGGGAATGGGCAGGG - Intergenic
1071636080 10:87255575-87255597 GTGAGTGTAGGGAATGGGCAGGG - Intergenic
1071659161 10:87482369-87482391 GTGAGTGTAGGGAATGGGCAGGG + Intergenic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1073135887 10:101220092-101220114 TTGTATGTATAAAGTGGGGATGG + Intergenic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073443735 10:103568463-103568485 TTCTGAGTAGAGGCTGGGGAGGG + Intronic
1073571213 10:104582607-104582629 TGGTGAGTTGTGAATGGGGAGGG - Intergenic
1074008027 10:109447824-109447846 TTGTGTGTAGAGGCAGGGGTGGG - Intergenic
1074971552 10:118543571-118543593 TTCTGTGTGCAGAATGGGGAAGG + Intergenic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1076335901 10:129706279-129706301 TTGTGTGGACAGAGTTGGGACGG + Intronic
1076426497 10:130371031-130371053 TTGTGTGTGGAGGATAGGCATGG + Intergenic
1076819216 10:132930474-132930496 CTGTGTGGGGAGTATGGGGAAGG - Intronic
1077128116 11:953550-953572 CTGTGTGAAGACAATGGGGGGGG - Intronic
1077304511 11:1863075-1863097 GTGTATGTAGGGAGTGGGGACGG + Intronic
1077879623 11:6338634-6338656 TTGTGTGTATAGAAGTGGGTTGG - Intergenic
1078009693 11:7563238-7563260 TCATGTGTACAGAATGGAGAGGG + Intronic
1078147333 11:8730721-8730743 ATGTGTGGAGAGAAGCGGGAGGG - Exonic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1079014562 11:16857525-16857547 TTCTGTCTGGAGAAAGGGGATGG - Intronic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1079544492 11:21616199-21616221 TTGAGTTTAGCGAATGAGGAGGG - Intergenic
1080470778 11:32543381-32543403 GGGTGGGAAGAGAATGGGGAGGG + Intergenic
1080691330 11:34561080-34561102 TTGAGTCTAGAGAATGAGCAGGG - Intergenic
1082769309 11:57194162-57194184 GTGTGTGTAGAGTAGGGGGTGGG - Intergenic
1083480011 11:62937998-62938020 TTCTGCATAGAGAATGGGGTGGG - Intronic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1086187461 11:84035722-84035744 TTGTGTGAAGAGACTGTAGAGGG + Intronic
1088548618 11:110987470-110987492 GTGTATGTGGAGGATGGGGAAGG - Intergenic
1088606433 11:111537989-111538011 TTGTCTTTAGAAAATGGGGAGGG + Intergenic
1088615676 11:111625243-111625265 TGCTGTGTTGAGAATGGGAAAGG + Intronic
1088873371 11:113911894-113911916 GTGGGTGAAGAGGATGGGGATGG - Intronic
1089039605 11:115434337-115434359 TTGTCTGTAGCAAAAGGGGAGGG - Intronic
1090590613 11:128262949-128262971 ACATGAGTAGAGAATGGGGAAGG + Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091334417 11:134755596-134755618 GTTTGGGTAGAGCATGGGGACGG + Intergenic
1091929905 12:4387384-4387406 TTGTGTGCAGAGTAGGGAGAAGG + Intergenic
1091999025 12:5017937-5017959 TTGTGTGTAGGGGCTGGGGCTGG + Intergenic
1092030391 12:5278733-5278755 TTCTGTGTAGAAAATGGGGCTGG - Intergenic
1092104116 12:5908817-5908839 TTGTGTGCACAGAATAGGGAAGG + Intronic
1092242807 12:6845858-6845880 TGGGGGGTACAGAATGGGGAGGG - Intronic
1093412967 12:18888408-18888430 TTGTGTATAGGGAAATGGGAAGG - Intergenic
1093824787 12:23670634-23670656 TTATGGGTAGGGAAAGGGGAAGG + Intronic
1093904229 12:24671109-24671131 TAGTGGGTAGAGAATGGGCAGGG + Intergenic
1094265430 12:28554004-28554026 TTTGGTGTAGGGAATGGGGAGGG - Intronic
1095425897 12:42074499-42074521 TGGTTTGAAGAGAAAGGGGAAGG + Intergenic
1096137812 12:49217160-49217182 TAGTTTGTAGAGTAGGGGGAGGG + Intronic
1096298654 12:50406307-50406329 TTGTTTGTAGAGGTTGGGGGTGG - Intronic
1096590286 12:52654121-52654143 TTCAGTGGAGAGAGTGGGGAGGG - Intergenic
1096807739 12:54150716-54150738 TGGTGTGGAGACAATGGGTATGG - Intergenic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1097087017 12:56476425-56476447 TGGGGTGTAAGGAATGGGGATGG - Exonic
1097926062 12:65128429-65128451 TTGTAAGTTTAGAATGGGGAAGG + Intergenic
1099358402 12:81666611-81666633 TGGGGTGGAGAGAGTGGGGAGGG + Intronic
1099675789 12:85759140-85759162 TCGTGTTTAGAGATTGGGAAGGG + Intergenic
1099805508 12:87513758-87513780 ATGTGTGTATAGCAGGGGGAGGG - Intergenic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100692030 12:97048289-97048311 TTGTGTCTAGGAAATGGGGTTGG + Intergenic
1100846920 12:98668749-98668771 TTTCCTGCAGAGAATGGGGATGG + Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102388943 12:112534342-112534364 TTGTTTGTAGAGATGGGGGGTGG + Intergenic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1102772410 12:115489675-115489697 TTGTGAACAGAGAATTGGGAAGG - Intergenic
1102957125 12:117066046-117066068 GTGTGTGAAGAGAAGAGGGAGGG - Intronic
1102970280 12:117160991-117161013 TTGTGTTGAGAGCGTGGGGAAGG + Intronic
1103170761 12:118817453-118817475 ATGTTTGTTGAGAATGGGGGTGG - Intergenic
1103458230 12:121084025-121084047 GTGTGTGGAGAGAATGGGGTTGG + Intergenic
1105586584 13:21750711-21750733 TTTTTTGTAGAGACTGGGGTGGG + Intergenic
1105607317 13:21936902-21936924 GTGTGTGTAGAGAAGGTGGGTGG + Intergenic
1105986083 13:25568669-25568691 TTGTGTATAGATAGTGGTGATGG + Intronic
1106726316 13:32490061-32490083 ATGTGTGTAGGGGAGGGGGATGG - Intronic
1107379695 13:39843021-39843043 TTGTGTGTTGAAAATTGGGGAGG + Intergenic
1107417836 13:40217778-40217800 TTGTCTGGAGAGAAGGGGAAAGG + Intergenic
1107480182 13:40779700-40779722 TTGTTTGTAGAGAAGGGGGGGGG - Intergenic
1108354412 13:49617442-49617464 TTTTTTGTAGAGATTGGGGTGGG - Intergenic
1108636421 13:52339394-52339416 TTGTGTATAGTGTAAGGGGAGGG + Intergenic
1108712589 13:53048530-53048552 TTGGGTGAGGAGGATGGGGAGGG + Intronic
1110926142 13:81154534-81154556 TTTTGGGGGGAGAATGGGGAAGG - Intergenic
1111623145 13:90749609-90749631 TAGTGTGAAGAAAATGAGGAGGG - Intergenic
1114185886 14:20401876-20401898 TTGTTTGTAGAGGAGGGGAAAGG + Intronic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1114559939 14:23582329-23582351 GTGGGAGTAGAGAATAGGGATGG + Intergenic
1114638771 14:24205103-24205125 TTGTATGTAGGGATTGAGGAAGG + Intronic
1114833071 14:26168477-26168499 ATGTGTCTAAAGAATGGGGGAGG + Intergenic
1115957165 14:38794193-38794215 TTGTGAGGAAAAAATGGGGAAGG - Intergenic
1116012667 14:39369158-39369180 TTGTGGGTAGGGCTTGGGGAGGG + Intronic
1116831685 14:49726487-49726509 TTGTGGGTAAAGAATGACGATGG - Intronic
1116844801 14:49855267-49855289 TTTTTTGTAGAGATTGGTGAGGG - Intergenic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1121843963 14:97157004-97157026 TTGTGTGTGAATCATGGGGAAGG + Intergenic
1121865262 14:97356848-97356870 ATGTGTGTAGGCAATGGGGTGGG - Intergenic
1122842272 14:104472022-104472044 TGATGTGTGGGGAATGGGGATGG - Intergenic
1123905202 15:24914084-24914106 GTGAGTGTGGAGAGTGGGGAGGG + Intronic
1124272798 15:28298477-28298499 TTTTGTGGAATGAATGGGGATGG - Intronic
1124457947 15:29862013-29862035 TTTTGTGTATAGTATGAGGAAGG + Intronic
1124896238 15:33780051-33780073 TAGTGTCTAGAGAAAGAGGAGGG + Intronic
1128066895 15:64770788-64770810 TTGTGTGGATGGAACGGGGAGGG - Intronic
1128526431 15:68415337-68415359 TGGAGTCTAGAGAAAGGGGAGGG + Intronic
1129156446 15:73721293-73721315 TTGTGTGGGGAGGATGGGGGTGG + Intergenic
1131349654 15:91687256-91687278 TTGTGTGTACAGGGTGGGGTTGG - Intergenic
1132507512 16:318935-318957 GTGTGTGGAGAGAATGCGGCCGG + Intronic
1133818835 16:9218429-9218451 TTTTTTGTAGAGATTGGGGTTGG - Intergenic
1133844837 16:9444082-9444104 GTGTGTGAAGGGAATGAGGAAGG - Intergenic
1136138717 16:28275151-28275173 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1138144930 16:54599974-54599996 TTGGGTATAGATAATGGTGATGG - Intergenic
1138161612 16:54759986-54760008 GTGTGTGTATAGAGAGGGGAAGG + Intergenic
1138297895 16:55902326-55902348 TTGTGGGGGGAGAGTGGGGATGG - Intronic
1139735910 16:68988152-68988174 TCCTGGGAAGAGAATGGGGAGGG - Intronic
1140224956 16:73069594-73069616 TGGTGGGTAGAGAAGGGGAAGGG + Intergenic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140874517 16:79138299-79138321 TTGTGTGGAGAGGATGGCGGTGG + Intronic
1141272092 16:82550177-82550199 CTCTGTGTAGAGAGTGGGTATGG + Intergenic
1142281373 16:89149724-89149746 TTCTGGGCACAGAATGGGGAGGG + Intronic
1142825661 17:2508514-2508536 TGGTGTGTTGTGAATGGGGGAGG - Intronic
1143024769 17:3935070-3935092 TCGTGTATAGCGAGTGGGGAAGG + Intronic
1143612636 17:8028420-8028442 ATGTGGGCTGAGAATGGGGAAGG + Intergenic
1146554033 17:33807659-33807681 ATGTGTGAAGAGGATGAGGAGGG - Intronic
1146647730 17:34586233-34586255 TTCTGTGTTGAGCATGGGCAAGG - Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1146739795 17:35273509-35273531 TGATGTGTGGAGAGTGGGGAGGG + Exonic
1147582660 17:41636048-41636070 TTGTTAGGAGAGGATGGGGATGG - Intergenic
1148170547 17:45515933-45515955 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148171024 17:45519926-45519948 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148278658 17:46329879-46329901 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148300868 17:46547741-46547763 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148364996 17:47048626-47048648 GTGGGAGCAGAGAATGGGGAGGG + Intergenic
1148451918 17:47784147-47784169 TTGTGTGTACAAGCTGGGGAAGG - Intergenic
1149285606 17:55160790-55160812 TTGGGTGCAGAGAAGGGGGAAGG - Exonic
1149560828 17:57606853-57606875 TTGGGTGGAGAGTGTGGGGAAGG + Intronic
1150728969 17:67675280-67675302 GTGTGTGTACACCATGGGGAAGG + Intronic
1150981343 17:70145266-70145288 GTGTGTGTGTAGAATGGGGGTGG + Intergenic
1151192774 17:72410834-72410856 TAGTGAGTAGAGGCTGGGGATGG - Intergenic
1153455578 18:5278745-5278767 TTTTGTGTAGATACTGGGGATGG - Intergenic
1153761940 18:8339962-8339984 TTGAGGGTAGAAAATAGGGAAGG - Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156548503 18:37990127-37990149 TTCTGTGTATATAATGGGGCTGG - Intergenic
1156651429 18:39231136-39231158 GTGTGTGTGGAGAATAGGTAGGG - Intergenic
1156673085 18:39493880-39493902 TTGTTATTAGAGACTGGGGAGGG + Intergenic
1156762366 18:40608662-40608684 TGGTGTTTTGAGAATTGGGAGGG - Intergenic
1157649594 18:49314132-49314154 CTGTGTGTAAAGAAAAGGGAGGG - Intronic
1157692876 18:49698184-49698206 TTGTGTGTGGAGATTGGCGGTGG + Intergenic
1158969568 18:62654067-62654089 ATGTTTGTAGGGAATGGGGTCGG - Intergenic
1160035363 18:75296716-75296738 GTGTGTGCAGAGCAGGGGGACGG + Intergenic
1160154274 18:76421530-76421552 TTCTGTGGAGAGCAGGGGGAGGG - Intronic
1160522991 18:79519509-79519531 TTGTTTGTAGAGATGGGGGGTGG + Intronic
1160692010 19:464494-464516 ATGTGTATGGAGGATGGGGAAGG - Intronic
1161752496 19:6108761-6108783 TTGTGCGGCAAGAATGGGGAGGG - Intronic
1161761705 19:6178158-6178180 TTATGTTGAGAGAATGGGGAAGG - Intronic
1161941202 19:7405389-7405411 GTCTGTGTAGAGAAAGGAGAGGG - Intronic
1163452603 19:17387394-17387416 GTGTGTGTAGGGCTTGGGGAGGG - Intergenic
1164529542 19:29037880-29037902 TTGTGTGTAGGGGAAGGGGGAGG - Intergenic
1164863215 19:31580281-31580303 TTGTCTGAACAGAATGGGCATGG - Intergenic
1164875082 19:31679020-31679042 TTGTGTGGATAAAAAGGGGAAGG + Intergenic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1167768642 19:51500403-51500425 GTGTGAGCAGAGAAGGGGGAGGG + Intronic
1168550751 19:57291296-57291318 TTGTGTGCAGTGAATGTGGAAGG + Exonic
1202714819 1_KI270714v1_random:36356-36378 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
925206338 2:2010203-2010225 TTCTGTGTAGAGAGTGAGGAAGG + Intronic
925228266 2:2205785-2205807 ATATGTGAAGAGAAGGGGGATGG - Intronic
925938000 2:8786160-8786182 TTGTGTGTAAGGGATGGGGGTGG - Intronic
925995477 2:9289223-9289245 GTGTGTCCAGAGCATGGGGAAGG - Intronic
926152859 2:10434510-10434532 TAGTGTGTGGGGGATGGGGAGGG + Intergenic
926528802 2:14015888-14015910 TTTTGTGTATAGTATGGGAAAGG + Intergenic
927840620 2:26440553-26440575 TTCTGTGCTGAGAATAGGGATGG + Intronic
927840747 2:26441700-26441722 GTGGGTGAAGAGAATGGGTAAGG + Intronic
927904173 2:26845624-26845646 TGATGGGAAGAGAATGGGGATGG - Intergenic
928572696 2:32625041-32625063 TGGAGTGTAGAGGATGGGGATGG + Intergenic
928630404 2:33185741-33185763 TTCTGTGTAGAGGAGGGGCAGGG + Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929830870 2:45345374-45345396 TTCTCTGTAGGAAATGGGGATGG - Intergenic
930317872 2:49819255-49819277 TTGGGGGAAGAAAATGGGGATGG + Intergenic
930975529 2:57454950-57454972 CTGTGTATAAAGAATGGGGGTGG - Intergenic
931267809 2:60675969-60675991 TTGTGGGTAGAGACAGTGGATGG + Intergenic
932113340 2:69021947-69021969 AAGTATGCAGAGAATGGGGAAGG - Intronic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
932811796 2:74832441-74832463 TTCTGTGTGGAGTATAGGGAAGG + Intergenic
933338564 2:80992268-80992290 TGGAGTGGAGAGAGTGGGGATGG + Intergenic
933572357 2:84028476-84028498 TTGTGGGTAGAGGAAGAGGAAGG - Intergenic
933834695 2:86236265-86236287 TTTTGTGTAGAGACTGAGAAGGG - Intronic
936528751 2:113260373-113260395 GTGTGTGTTGGGGATGGGGATGG + Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938653958 2:133411867-133411889 GTGTGTGTACATCATGGGGAGGG - Intronic
943369993 2:187003670-187003692 CTGTGTGTAAAGACTGTGGAAGG - Intergenic
943460294 2:188165059-188165081 TTGGGAGCAGAGAATAGGGAGGG + Intergenic
944009651 2:194958241-194958263 TGGGGTGTGGAGAGTGGGGAGGG + Intergenic
945442731 2:209899637-209899659 GTGTGTGTAGAGGGTGTGGAAGG - Intronic
945858002 2:215091087-215091109 TTGGGAGTAGAGACTAGGGAGGG - Intronic
946892832 2:224296148-224296170 CTGTAGGTAGAGGATGGGGATGG - Intergenic
947103998 2:226649569-226649591 TTGTGGCCAGAAAATGGGGATGG - Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947646721 2:231747584-231747606 TTCTATGAAGAGAATGGAGAAGG - Intronic
948360911 2:237419532-237419554 AAGTGTTTAGGGAATGGGGAGGG - Intergenic
948736099 2:240006073-240006095 TTGTGAGGAGAGAATGCGTATGG - Intronic
1168743347 20:213907-213929 TTGTGTGTAAAGCATGAGGGAGG - Intergenic
1168895898 20:1323257-1323279 GTGTGTGTACACAGTGGGGAAGG - Intronic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1171559622 20:26111567-26111589 TGGTGTGTGGGGAGTGGGGAGGG - Intergenic
1172266294 20:33617535-33617557 TTGTGGGTAGACAAGGGGAAAGG - Intronic
1172525366 20:35597802-35597824 TTGGGTGTAGAGGTTGGGGAAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173729733 20:45319873-45319895 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1173848802 20:46204795-46204817 TAGGGTGGAGAAAATGGGGAGGG + Intronic
1174346178 20:49931856-49931878 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1176047465 20:63100369-63100391 TTGTTTTAACAGAATGGGGAGGG + Intergenic
1176204301 20:63879725-63879747 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204343 20:63879925-63879947 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204351 20:63879965-63879987 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204368 20:63880045-63880067 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204376 20:63880085-63880107 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204392 20:63880165-63880187 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204418 20:63880285-63880307 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204435 20:63880365-63880387 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204452 20:63880445-63880467 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1178191944 21:30293035-30293057 TTGTGTGTAAAGATAGGGGGAGG + Intergenic
1178562766 21:33654566-33654588 TTTTGTGTAGAGAAGGAGGTAGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179493707 21:41758173-41758195 TTGGGTGTAGATAGTGGTGATGG - Intronic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1181661333 22:24351356-24351378 TTGTGGGTGGAGAATGGGTGTGG + Intronic
1182401435 22:30080646-30080668 TACTGTGAAGAGAATCGGGAGGG + Intronic
1183249479 22:36719784-36719806 TTGGGAGGAGAGAATGAGGACGG + Intergenic
1183973514 22:41496368-41496390 TTGTGTGTAGAACATGGTGGGGG + Intronic
1184867732 22:47210822-47210844 CTGTGTGTAGACAATTGCGAAGG + Intergenic
949107676 3:220137-220159 TTGTTTTTAAAGACTGGGGAGGG + Intronic
949390524 3:3557359-3557381 TAGTGTGTAGAGATTAGAGATGG - Intergenic
949439546 3:4065992-4066014 TTGTGTTTAGACAATGGAGCAGG - Intronic
953353906 3:42237996-42238018 TTGGGGGTGGAAAATGGGGATGG + Intergenic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953669554 3:44951295-44951317 CTCTGTGCAGAGAATGTGGAAGG - Intronic
953715778 3:45315957-45315979 TTGTCTGTAGAGAATTAGAAAGG - Intergenic
954413956 3:50383817-50383839 TTGGGGGCAGGGAATGGGGAAGG + Intronic
954805660 3:53218511-53218533 TGCTGTGTAGAGAATGAGCAGGG + Intergenic
956490978 3:69771820-69771842 ATGTGTGTAGAGAATTGGACTGG + Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957585167 3:82123656-82123678 TTGTTTGCAAAGAAAGGGGAAGG - Intergenic
958879191 3:99650247-99650269 TTGTTAGTTGAGAATAGGGAAGG - Intronic
959553170 3:107687404-107687426 TTTCTTGTAGAGAATGGAGAGGG + Intronic
959894605 3:111592081-111592103 ATGTGGGTTGGGAATGGGGATGG - Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960719445 3:120611372-120611394 TGGTGTGCAGATACTGGGGATGG + Intergenic
961205195 3:125076186-125076208 GTGTGCCTAGAGAATGAGGAGGG - Intergenic
961554457 3:127688629-127688651 GTGTGGGTATAGAATGGAGAGGG + Intergenic
961930828 3:130531001-130531023 GTGTGTGTAGAGGAGGGGGGTGG - Intergenic
962033422 3:131625271-131625293 TTGTTTAGAGAGAATGGAGAAGG - Intronic
962664957 3:137644615-137644637 ATGAATGTAGAGAATGGGGAGGG - Intergenic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
963340556 3:144027306-144027328 TGGTGTGTAGGGAGTGGGGAGGG + Intronic
964582288 3:158253906-158253928 TGGGGTGGAGAGAGTGGGGAGGG - Intronic
964763127 3:160153247-160153269 TTGTGTGGAGATAAGTGGGATGG - Intergenic
964873212 3:161336092-161336114 TTGTGTGTTGACAGTGAGGAAGG + Intergenic
965928093 3:174007976-174007998 GTGTGTGTTGTGAGTGGGGATGG + Intronic
966755661 3:183369023-183369045 TTGTGTCAAGAATATGGGGAAGG - Intronic
966905098 3:184516916-184516938 TTGGGTATAGATAATGGTGATGG + Intronic
967679480 3:192343566-192343588 TTTCCTGTTGAGAATGGGGAGGG - Intronic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
968356336 3:198110463-198110485 TTTTGTTTTGAGATTGGGGATGG + Intergenic
969688251 4:8688948-8688970 GTGTGTGCAGAGAATGGAGGAGG + Intergenic
970032956 4:11698477-11698499 TCCTGTGAAGAGAGTGGGGAAGG + Intergenic
972478153 4:39472477-39472499 ATTTGTGAAGAGAATGGGGGAGG - Intronic
973266497 4:48216220-48216242 TGGGGCGTAGAGATTGGGGAAGG - Intronic
973298436 4:48553795-48553817 TTGACTATAGGGAATGGGGAAGG - Intronic
973967544 4:56179438-56179460 TTTTATGTAGAGTATGGAGAGGG + Intronic
974807115 4:66894716-66894738 TTGTGTTTAAAAATTGGGGAAGG - Intergenic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
975974813 4:80082560-80082582 TTTTCTGTAGATAAGGGGGAAGG - Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
977003830 4:91540164-91540186 TGGGATGTAGAGAGTGGGGAAGG - Intronic
977177885 4:93838089-93838111 TTTTGTGTTTAGAATTGGGATGG - Intergenic
977749484 4:100591823-100591845 TGCTATATAGAGAATGGGGAAGG - Intronic
977762196 4:100752123-100752145 TTGTCTTTAGAAAATAGGGAGGG - Intronic
978318352 4:107465182-107465204 AGGTGTTTAGAGCATGGGGACGG + Intergenic
978354429 4:107856565-107856587 TTGCGTGGAGTGAGTGGGGATGG + Intronic
978432224 4:108644742-108644764 TCATGTGTAGGGAATGGGAATGG - Intergenic
978996087 4:115155044-115155066 TTCTGTGCAGAGAATGGTGGAGG - Intergenic
979545052 4:121931089-121931111 TTGTGTGTATGGAAAAGGGATGG + Intronic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980625359 4:135368561-135368583 TTGGGTGTTTTGAATGGGGAGGG + Intergenic
980890452 4:138809287-138809309 GTGTGTGTAGTGTATGGTGAGGG - Intergenic
981495847 4:145391422-145391444 TTGTGAGTTGAGATTGGGCAAGG - Intergenic
981882148 4:149627123-149627145 TTCTGTGTGGAGGCTGGGGAGGG + Intergenic
982484521 4:155951613-155951635 ATGGGTTTAGAGAATGGTGAAGG - Intronic
983429136 4:167625570-167625592 TTGTTTATATAGAATGAGGAGGG - Intergenic
988113202 5:26850333-26850355 ATGTCTGGAGAGAATGGGAAGGG + Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
989317273 5:40096416-40096438 GTGTGTGTATAAAATGTGGAGGG - Intergenic
989689815 5:44127895-44127917 TTGTGTGTAGAGGAATGGGGAGG - Intergenic
990728537 5:58783773-58783795 TTGTTTGTGGATAAAGGGGAAGG - Intronic
991625621 5:68597920-68597942 TGGTGTGGAGAGTATGGTGAGGG - Intergenic
992623369 5:78615192-78615214 TGGTGTGTGGAGTGTGGGGAAGG + Intronic
995010808 5:107255389-107255411 TTGTGGGTAGAGGAGAGGGATGG + Intergenic
995164491 5:109023210-109023232 TTGTATGTGGAGAATGAGGCAGG + Intronic
997655700 5:135552779-135552801 TTGGGTGCAGAGAATGGGGTTGG + Intergenic
1000234480 5:159344748-159344770 TTGTGGGTACAGGGTGGGGAGGG + Intergenic
1001031082 5:168263420-168263442 TTGTGTGTAGCGCCTGGGGAGGG + Intronic
1001835152 5:174825299-174825321 CTGAGTCTAGAGAATGGGAAAGG - Intergenic
1003341607 6:5226935-5226957 GTGTGAGAAGAGAATGGGGAAGG + Intronic
1003847489 6:10188351-10188373 TTGTGATTAGAGAGTGGGGCTGG - Intronic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1005093245 6:22081328-22081350 TTTTTTGTAGAGACTGGGCATGG - Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005823665 6:29618887-29618909 TTGGGGGTAGGGGATGGGGAGGG - Intronic
1006265053 6:32914016-32914038 GTGTGCGTAGAGAATGGGCAGGG + Intergenic
1006468831 6:34214082-34214104 TTTTTTGTAGAGATGGGGGAAGG - Intergenic
1006480002 6:34284707-34284729 CTGTATGTAGAGAAAAGGGAAGG + Exonic
1007075824 6:39065554-39065576 TTGTGTGTAAAGAAGGGAAAAGG + Intronic
1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG + Intergenic
1008395341 6:51000079-51000101 TTGGGTGAAAAGATTGGGGAGGG - Intergenic
1010050227 6:71495401-71495423 TTGGCTGCAAAGAATGGGGAAGG + Intergenic
1010923668 6:81716743-81716765 TTGTCTGTAGAGTATGAGGCAGG - Intronic
1011404761 6:87007339-87007361 GGGGGTGGAGAGAATGGGGATGG + Intronic
1011746888 6:90415066-90415088 TTCTGTGTAGGGAAGGGGGCTGG + Intergenic
1011992840 6:93545705-93545727 TTGGGTGGGGAGAGTGGGGAGGG - Intergenic
1012699063 6:102429215-102429237 TTGTGTGTAGTGAAAGGTAAGGG - Intergenic
1013098255 6:106965911-106965933 TTGTCTGCAGAGAATTGGCAAGG - Intergenic
1014353003 6:120367217-120367239 TTTTGTGTAAAGTATAGGGAAGG + Intergenic
1015218041 6:130772798-130772820 TTGCTTGTGGAGGATGGGGAAGG + Intergenic
1015900863 6:138064391-138064413 TGGTGAGGAGAGAATGGGTAGGG + Intergenic
1016572795 6:145533544-145533566 TTGTGTCTGGAGCATGGGGTAGG - Intronic
1018981494 6:168605072-168605094 TAGTGAGGAGAGAATGGGAAGGG + Intronic
1019845602 7:3496973-3496995 TTCTGTGCCGAGAATGTGGAGGG - Intronic
1020095860 7:5368951-5368973 TGGGGTGTAGGGAAGGGGGAGGG - Intronic
1020703620 7:11513900-11513922 TTGTGTGTAGGGAAAGTGTAAGG - Intronic
1020743789 7:12055523-12055545 CTGTCTTTAGAGAGTGGGGATGG - Intergenic
1021267494 7:18543173-18543195 GTGTGGGTAGAGAATTTGGAAGG - Intronic
1021585886 7:22207771-22207793 TTGTAGCTAGAAAATGGGGAAGG + Intronic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1021844268 7:24748790-24748812 TTGTGATTAGTGAATGGAGATGG - Intronic
1022110288 7:27225883-27225905 TTGTGTGTAGAGAATAGGCCCGG + Intergenic
1022340902 7:29467345-29467367 TTGTGTGTAGCGGGTGGGGTAGG + Intronic
1023176119 7:37437272-37437294 TTGAGGGGAGAGAATGGAGATGG - Intronic
1023299194 7:38750784-38750806 TTGTGCTTAGGGAATGGGAAGGG + Intronic
1023569808 7:41560295-41560317 TTGTGTTTCTAGAAGGGGGAGGG + Intergenic
1026839872 7:73664416-73664438 TTGTCTGCGGAGTATGGGGAAGG + Intergenic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1027902608 7:84136886-84136908 GTGTGTGTGGAGAGTGGGGTGGG - Intronic
1029008381 7:97233133-97233155 TTTTGTCTAGATAATGGGAAGGG + Intergenic
1029591596 7:101510683-101510705 TTTTTTGTAGAGAATGAGGCTGG + Intronic
1030272197 7:107681933-107681955 TTTTTTGTAGAGATTGGGGCGGG - Intronic
1030554638 7:111008135-111008157 TTGAAAATAGAGAATGGGGAGGG - Intronic
1031865074 7:127029950-127029972 TTGAGTGTTGATAATGGGGTAGG - Intronic
1033334838 7:140443746-140443768 GTGTGTGTTGAGAATGATGAGGG - Intergenic
1033966660 7:146983512-146983534 TTGTGTGTAGCGATGGGGCAAGG - Intronic
1034142938 7:148839326-148839348 TTTGGTGTAAAGAATGGGTAGGG - Intronic
1034862922 7:154615587-154615609 TTGTGTATAGATAGTGGTGATGG - Intronic
1034862935 7:154615703-154615725 TTGTGTATAGATAGTGGTGATGG - Intronic
1034862946 7:154615813-154615835 TTGTGTATAGATAGTGGTGATGG - Intronic
1034947098 7:155269348-155269370 GTGGGGTTAGAGAATGGGGAGGG + Intergenic
1035326530 7:158069613-158069635 TTGTGGGTAAAGAATGGAGGAGG - Intronic
1035712481 8:1729313-1729335 TGCTGTGCAGAGAGTGGGGAAGG - Intergenic
1035846263 8:2868168-2868190 TTGTCTGTTGAGAATGAGGATGG - Intergenic
1036008682 8:4695608-4695630 GCGTATGTTGAGAATGGGGAAGG - Intronic
1036825505 8:11972767-11972789 TTCTTAGTAGAGAATGAGGAGGG + Intergenic
1037800584 8:22033019-22033041 TAGTGTGTAGGGTTTGGGGAGGG + Intronic
1039233575 8:35475592-35475614 TTGTGGGAAGAGAATGGGGTGGG + Intronic
1039418681 8:37417831-37417853 TTGTGTGTATGCAGTGGGGAGGG - Intergenic
1041354417 8:56985232-56985254 TTTGGTTTAGACAATGGGGATGG - Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042847265 8:73180971-73180993 TAGACTGTAGAGAAAGGGGAGGG - Intergenic
1042924591 8:73954169-73954191 CTGAGGGTAGAGAATGGGAAGGG + Intronic
1043076983 8:75715198-75715220 TTATGGGTACAGAATGGGGAGGG - Intergenic
1043670729 8:82881258-82881280 CTGTGTGTAGATAATGTGGTGGG + Intergenic
1043809956 8:84727053-84727075 GTGTGTTTAGAGAATGAAGAGGG + Intronic
1043921856 8:85992029-85992051 TTAAGTGTGGAGAAAGGGGATGG + Intronic
1044144989 8:88701591-88701613 TTGTGTGAAGACAATGGGAAAGG + Intergenic
1044683313 8:94803257-94803279 TGGGGTGTAGAGGTTGGGGAGGG + Intergenic
1044866499 8:96576068-96576090 TTGTGTGTGGGGATCGGGGAGGG - Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047009986 8:120661877-120661899 GTATGTTCAGAGAATGGGGAAGG + Intronic
1047708378 8:127525271-127525293 TAGAGTGTAGACATTGGGGAGGG + Intergenic
1048178802 8:132176801-132176823 GTATGTTTAGAAAATGGGGAGGG - Intronic
1049529508 8:143147356-143147378 GTGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529520 8:143147406-143147428 GTGTTTGGAGAGAAGGGGGATGG + Intergenic
1049610495 8:143552829-143552851 TTGTGTGTAGAGCAGGGGGCAGG + Intergenic
1049938573 9:523154-523176 TCGGGTGTAGATACTGGGGAAGG - Intronic
1050042961 9:1514808-1514830 TGGTGGGTGTAGAATGGGGATGG + Intergenic
1050075532 9:1858808-1858830 TGGGGTGTAGGGAAGGGGGAGGG - Intergenic
1050615958 9:7402050-7402072 GTGTGTGTTGGGAAAGGGGATGG - Intergenic
1053363868 9:37509091-37509113 TTATTTGTAGAGACAGGGGAAGG + Intergenic
1053514996 9:38723081-38723103 TGGTGTGGAGAGTTTGGGGAAGG + Intergenic
1055793524 9:79949306-79949328 TTGAATGTAGATAGTGGGGATGG + Intergenic
1055904810 9:81280673-81280695 TTGTGTGTGGAAAATGAGGTAGG - Intergenic
1058370981 9:104267366-104267388 TAGTGGGTAGATAATAGGGATGG + Intergenic
1060529818 9:124341606-124341628 GAGTGTGTAGTGGATGGGGAAGG + Intronic
1060946932 9:127575143-127575165 GTGTGGCTAGAGAATGGGGAGGG - Intronic
1061261992 9:129485482-129485504 TTTGGTGTAGGGGATGGGGAGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061692433 9:132344387-132344409 TTTTTTGTAGAGATGGGGGAGGG + Intronic
1061775985 9:132964607-132964629 TTGTGTGTGTAGAATTGTGACGG - Intronic
1061875063 9:133539523-133539545 TTGTGTCTAGAGTAGGCGGAGGG + Intronic
1061910081 9:133717695-133717717 TTGTGAGTAGGGAAGGGGCATGG - Intronic
1188076846 X:25787572-25787594 ATGTGTTTAGAGAACGGTGAAGG + Intergenic
1188142240 X:26565766-26565788 TTGGAGGTAGAGAAAGGGGAGGG + Intergenic
1189343139 X:40219778-40219800 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1189393868 X:40602734-40602756 TTGTGTGTGGGGGATGGGAATGG + Intronic
1189780331 X:44507664-44507686 TTGGGTGTAGATAGTGGTGATGG + Intergenic
1190324638 X:49199336-49199358 GTTCGGGTAGAGAATGGGGATGG + Intronic
1190760788 X:53436445-53436467 TGGTGTGTAGATGCTGGGGAGGG - Intergenic
1190817251 X:53939331-53939353 TTGTGGGTAGAGAAACAGGAAGG - Intronic
1191260372 X:58312723-58312745 TTGTGTGTAGAATATGTGAAGGG + Intergenic
1192179971 X:68910306-68910328 TTGTGTCTAAAGAATTGTGAGGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192477232 X:71453392-71453414 TTGTTTGTAGAGATTGGGGGTGG - Intronic
1192864443 X:75116317-75116339 TTGTGTTTATACAATGGGGGCGG - Intronic
1193082833 X:77422669-77422691 GCGTGTGTTGAGAATGAGGAGGG - Intergenic
1194909335 X:99620487-99620509 TAGTAGTTAGAGAATGGGGAAGG + Intergenic
1195042575 X:101027899-101027921 TTTTGTGTAGAGCAAGTGGAAGG - Intronic
1195799095 X:108687097-108687119 TTTTGTGTAGAGAACAGGCAGGG - Intronic
1197030605 X:121809239-121809261 TTGTGTGGTGCTAATGGGGATGG + Intergenic
1199449166 X:147960009-147960031 TTATGTGGGGAGAAAGGGGAAGG + Intergenic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1200431268 Y:3085623-3085645 TTTTGTGTAGAGTATAAGGAAGG + Intergenic
1201262525 Y:12174146-12174168 TTTTTTGTAGAGATTGGTGAGGG - Intergenic