ID: 923734026

View in Genome Browser
Species Human (GRCh38)
Location 1:236583772-236583794
Sequence CTACCGTGCCTGGCCAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1242
Summary {0: 1, 1: 2, 2: 39, 3: 233, 4: 967}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923734021_923734026 8 Left 923734021 1:236583741-236583763 CCTCCCAAAATGCTGGGATTATA 0: 1562
1: 42775
2: 341097
3: 259675
4: 195051
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967
923734023_923734026 5 Left 923734023 1:236583744-236583766 CCCAAAATGCTGGGATTATAGGC 0: 1179
1: 32299
2: 265143
3: 279236
4: 220500
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967
923734019_923734026 14 Left 923734019 1:236583735-236583757 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967
923734016_923734026 18 Left 923734016 1:236583731-236583753 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967
923734017_923734026 17 Left 923734017 1:236583732-236583754 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967
923734015_923734026 21 Left 923734015 1:236583728-236583750 CCACCCGCCTCGGCCTCCCAAAA 0: 1290
1: 45467
2: 132962
3: 201493
4: 160826
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967
923734024_923734026 4 Left 923734024 1:236583745-236583767 CCAAAATGCTGGGATTATAGGCG 0: 450
1: 15890
2: 167312
3: 300971
4: 243966
Right 923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG 0: 1
1: 2
2: 39
3: 233
4: 967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923734026 Original CRISPR CTACCGTGCCTGGCCAAAAT AGG Intronic
900773409 1:4563588-4563610 CCACTGAGCCTGGCTAAAATGGG + Intergenic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
900961664 1:5925900-5925922 CCACCGTGCCTGGCCAGGAATGG + Intronic
901102954 1:6733519-6733541 CCACCGTGCCTGGCTAATTTTGG - Intergenic
901373705 1:8822277-8822299 CCACTGTGCCCGGCCAGAATTGG - Intergenic
901406613 1:9051996-9052018 CCACCGCGCCTGGCCCAGATTGG - Intronic
901430646 1:9212160-9212182 CCACTGTGCCCGGCCTAAATTGG - Intergenic
901595543 1:10382700-10382722 CCACCGTGCCTGGCCATGTTGGG + Intergenic
901725082 1:11235329-11235351 CCACCGTGCCTGGCCGACTTTGG - Intronic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902832564 1:19026670-19026692 CCACCATGCCTGGCCTAAGTGGG + Intergenic
902874207 1:19331295-19331317 CCACCGCGCCCGGCCAAGATGGG + Intergenic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903513108 1:23891329-23891351 CCACCGTGCCTGGCCTGATTTGG - Intronic
903563085 1:24243686-24243708 CCACCGCGCCTGGCCAAACTGGG - Intergenic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
905178528 1:36152935-36152957 CCACTGTGCCTGGCCAGGATAGG + Intronic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
906003187 1:42445093-42445115 CCACCGTGCCCGGCCAGAAAGGG + Intronic
906151365 1:43589567-43589589 CCACCGTGCCTGGCCAGAATCGG - Intronic
906210356 1:44009508-44009530 CCACCGCGCCCGGCCAAGATGGG + Intronic
906259449 1:44375622-44375644 CTACCGTGCCCGGCCTATGTAGG + Intergenic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907421686 1:54352006-54352028 CCACCAGGCCTGGCCAAGATCGG - Intronic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
907799147 1:57747520-57747542 CCACCGTGCCTGGCCTACAATGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908120571 1:60982297-60982319 CCACCGTGCCTGGCCTTCATGGG + Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908236963 1:62156239-62156261 CCACCATGCCTGGCCTACATTGG - Intronic
908781872 1:67698314-67698336 CCACCGTGCCCGGCCTACATGGG + Intergenic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
909815120 1:79983254-79983276 CCACTGTGCCTGGCCACAAAAGG - Intergenic
910178106 1:84452908-84452930 CCACCGTGCCTGGCCGAATGTGG - Intergenic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910408755 1:86917229-86917251 CCACCGTGTCTGGTCAAAAATGG - Intronic
910414917 1:86987359-86987381 CCACCATGCCTGGCCCAACTAGG + Intronic
910506005 1:87950916-87950938 CCACCGTGCTTGGCCAAACATGG - Intergenic
910983168 1:92978507-92978529 CCACCGTGCCCGGCCAATAAGGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911312100 1:96305954-96305976 CTACTGTGCCAGGCCATTATTGG - Intergenic
912407679 1:109454189-109454211 CCACCATGCCTGGCCCACATAGG + Intergenic
913270401 1:117087578-117087600 CCACCATGCCTGGCCATATTAGG + Intronic
913287080 1:117236466-117236488 CCACCGTGCCCGGCCTAAGTTGG - Intergenic
914320108 1:146551101-146551123 CCACCATGCCAGGCCAAGATGGG - Intergenic
914357281 1:146897943-146897965 CCACAGTGCCTGGCCACAATGGG - Intergenic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914421311 1:147530890-147530912 CCACCACGCCTGGCCAATATGGG - Intergenic
915211214 1:154310998-154311020 CCACCGTGCCCGGCCAAAGATGG + Intergenic
915232369 1:154455196-154455218 CTACCATGCCCGGCCCAAAGAGG + Intronic
915467455 1:156105829-156105851 CCACCGTGCCTGGCCAGATAAGG - Intronic
915591393 1:156872962-156872984 CCACCGCGCCTGGCCCAGATTGG + Intronic
915717844 1:157961379-157961401 CCACCGTGCCTGGCCAATTTTGG - Intergenic
916408416 1:164520811-164520833 CCACCGTGCCTGGCCAGAGAAGG - Intergenic
916483104 1:165233165-165233187 CCGCCGTGCCCGGCCAAAACTGG - Intronic
916530801 1:165654401-165654423 CCACTGTGCCTGGCCAGCATAGG - Intronic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919918154 1:202151902-202151924 ACACCGTGCCTGACAAAAATAGG + Intronic
919959729 1:202454644-202454666 CTACCATACCTGGCCAAGAAGGG - Intronic
919996961 1:202761151-202761173 CCACCGTGCCAGGCCTAAATTGG - Intronic
920370243 1:205474217-205474239 CCACCGTGCCCAGCCAAAATAGG - Intergenic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920584589 1:207145386-207145408 CCACCATGCCTGGCCATACTTGG + Intergenic
920639624 1:207739407-207739429 CCACCGTGCCTGGCCAGCTTTGG + Intergenic
920914587 1:210249927-210249949 CCATCGTGCCTGGCCTAAACAGG - Intergenic
921125766 1:212176586-212176608 CCACGGTGCCTGGCCAGAAAAGG + Intergenic
921211519 1:212903390-212903412 CCACTGTGCCTGGCCTTAATGGG + Intergenic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922295027 1:224242618-224242640 CCACCATGCCTGGCCAATTTTGG + Intronic
922295497 1:224246315-224246337 CCACTGTGCCTGGCCGAAGTGGG + Intronic
922296645 1:224255477-224255499 CCACCGCGCCTGGCCTAAAATGG + Intronic
922417485 1:225434753-225434775 CCACCGCACCTGGCCAGAATGGG - Intergenic
922435484 1:225601231-225601253 CCACCGTGCCTGGCCGTAATTGG - Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922634965 1:227159197-227159219 CCACCGTGCCCGGCCAACTTTGG - Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922773606 1:228204504-228204526 CTACTGTGCCTGGCCAGAAATGG - Intronic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923568707 1:235095527-235095549 CCACCGTGCCTGGCCACACGTGG - Intergenic
923727722 1:236522041-236522063 CTGCTGTGCCTGGCCATGATAGG + Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
924518677 1:244787327-244787349 CCACCGTGCCCAGCCAATATGGG + Intergenic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
924687318 1:246307704-246307726 CCACCGCGCCCGGCCAAATTAGG + Intronic
924696539 1:246406209-246406231 CCACCGCGCCCAGCCAAAATGGG + Intronic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924852737 1:247846895-247846917 CTACCACGCCTGGCTAAATTTGG - Intergenic
1063002244 10:1935395-1935417 CCACTGTGCCTGGCCAATTTTGG + Intergenic
1063231688 10:4071816-4071838 CCACTGTGCCCGGCCAAAAATGG - Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063976663 10:11423223-11423245 CTACCGCGCCTGGCCCCAACAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064212331 10:13370514-13370536 CTACTGTGCCTGGCCTAAAATGG + Intergenic
1064264982 10:13818836-13818858 CCACCGTGCCTGGCCATACATGG - Intronic
1064358192 10:14638901-14638923 CCACCGTGCCTGGACAAAGTAGG - Intronic
1064372937 10:14769671-14769693 CCACCGCGCCCGGCCACAATTGG + Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064612177 10:17114954-17114976 CCACCGTGCCCGGCCGAAATGGG - Intronic
1064751647 10:18536547-18536569 CTGCCATGCCTGGCCAGAACTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065006279 10:21383209-21383231 CCACCGCGCCTGGCCAAAAGAGG + Intergenic
1065096948 10:22290692-22290714 CCACCGTGCCTGGTCAACAGTGG - Intergenic
1065134875 10:22657786-22657808 ATTCCATGCCTGGGCAAAATGGG - Intronic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065359683 10:24877906-24877928 CCACTGTGCCTGGCCAGAATAGG + Intronic
1065413120 10:25452331-25452353 CCACGATACCTGGCCAAAATTGG + Intronic
1065537192 10:26726772-26726794 CCACCGTGCCCGGCCTAAAATGG - Intronic
1065731508 10:28713538-28713560 CCACCGCGCCTGGCCATAATGGG - Intergenic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066045435 10:31590871-31590893 CTACCATGCCCGGCCTAAAAGGG - Intergenic
1066245286 10:33577335-33577357 TCACCGTGCCTGGCCCAAAGTGG - Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066466467 10:35654540-35654562 CCACTGCGCCTGGCCAAGATAGG + Intergenic
1066535755 10:36389691-36389713 CTACCGTGCCTGGCCCCTTTGGG - Intergenic
1066559794 10:36657541-36657563 CCACTGCGCCTGGCCTAAATGGG + Intergenic
1066577629 10:36843831-36843853 CCACCGTGCCTGGCCTTTATGGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067353660 10:45503248-45503270 CCACCGTGCCCGGCCATAATTGG - Intronic
1067676714 10:48386674-48386696 CCACCGTGCCTGGCCATTTTTGG - Intronic
1067765059 10:49079117-49079139 CCACTGTGCCTGGCCAGAAATGG + Intronic
1069023270 10:63513623-63513645 CCACCGTGCCCGGCCTAAATGGG - Intergenic
1069333163 10:67317709-67317731 CCACCGCGCCTGGCCATCATCGG + Intronic
1069411167 10:68154890-68154912 CCACCGTGCCTGGCCTGAAATGG - Intronic
1069927306 10:71859725-71859747 CCACCGTGCCTGGCCTTAAATGG - Intergenic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1070182914 10:74031775-74031797 CCACCGTGCCGGGCCACACTCGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1070994286 10:80762313-80762335 CCACCGTGCCTGACCAGGATTGG + Intergenic
1071262525 10:83933680-83933702 CCACCGTGCCTGTCCAAATGTGG - Intergenic
1071816434 10:89236984-89237006 CCACCGTGCCTGGTCTATATTGG - Intronic
1072049493 10:91689305-91689327 CCACCGTGCCTGGCCTACAAAGG - Intergenic
1072143185 10:92608722-92608744 CCACCGTGCCTGGCCGAACTTGG + Intronic
1072168647 10:92838785-92838807 CCACCGTGCCTGGCCTAGGTAGG - Intronic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072593132 10:96845752-96845774 CCACCGCACCCGGCCAAAATGGG + Intronic
1072897758 10:99381452-99381474 CCACCGCGCCTGGCCTAAAGAGG - Intronic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073346631 10:102787788-102787810 CCACCGTGCCTGACCACTATTGG - Intronic
1073470621 10:103720005-103720027 CCACCGTGCCCGGCCACACTAGG + Intronic
1074095555 10:110308837-110308859 CCACCGGGCCTGGCCAGAAATGG + Intergenic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074168614 10:110909479-110909501 CCACCGTGCCCGGCCAGAAAAGG + Intronic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1075128261 10:119718421-119718443 CCACCGTGCCCGGCCTAACTCGG + Intergenic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1077952061 11:6970067-6970089 CCACTGTGCCTGGCCAGCATTGG + Intronic
1078084372 11:8224915-8224937 CTACAGGGCCTGGCCAAGGTTGG - Intronic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078208762 11:9253138-9253160 CTACCATACCTGGCCACAACAGG + Intronic
1078308049 11:10210723-10210745 CCACCGCGCCTGGCCACAAGAGG - Intronic
1079026673 11:16954226-16954248 CCACTGTGCCTGGCCATTATTGG - Intronic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1079234624 11:18679333-18679355 CCACCGTGCCTGGCCACCTTGGG - Intergenic
1079369233 11:19836268-19836290 CCACCGCGCCTGGCCCAGATCGG - Intronic
1079403258 11:20123753-20123775 CCACCGTGCCCAGCCTAAATTGG - Intergenic
1079606460 11:22375083-22375105 CCACCGTGCCTGGCCACAAATGG - Intronic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080799056 11:35592620-35592642 CCACCGTGCCTGGCCAGCAATGG - Intergenic
1081112678 11:39156118-39156140 CCACCGTGCCCGGCCAACACAGG + Intergenic
1081616738 11:44595780-44595802 CTACCATGTCTGGCCAGAAGGGG - Intronic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1082023699 11:47555718-47555740 CTACCGCGCCTGGCCGACATTGG - Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082916422 11:58443311-58443333 CCACCGCGCCTGGCCAAACTTGG - Intergenic
1083103122 11:60330624-60330646 CCACCGCGCCTGGCCAATTTTGG + Intergenic
1083131268 11:60624906-60624928 CCACTGTGGCTGGCCAAAATAGG - Intergenic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083565175 11:63708449-63708471 CCACCATACCTGGCCTAAATAGG + Intronic
1083601308 11:63950029-63950051 CCACCGTGCCCAGCCAAACTTGG + Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083937081 11:65875208-65875230 CCACCGCGCCCGGCCAATATAGG + Intergenic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1083991436 11:66248330-66248352 CCACCGTGCCCGGCCAAAATAGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084050740 11:66597961-66597983 CCACTGCGCCTGGCCTAAATGGG - Intronic
1084152320 11:67294795-67294817 CCACCGTGCCTGGCCACTAAGGG + Intronic
1084299224 11:68235449-68235471 CCACCGTGCCTGGCCCACAGCGG - Intergenic
1084378032 11:68791822-68791844 CCACCGCGCCTGGCCAGAATGGG + Intronic
1084388600 11:68860613-68860635 CTACCATGCCTGGCTAATTTTGG - Intergenic
1084975021 11:72792340-72792362 CCACCGTGCCTGGCCTATCTGGG + Intronic
1085232767 11:74987524-74987546 CCACCGCGCCTGGCAATAATGGG - Intergenic
1086091524 11:83009351-83009373 CCACCGCGCCCGGCCAAAAACGG + Intronic
1086109478 11:83183775-83183797 CCACCGTGCTCGGCCAAAATAGG + Intronic
1086204617 11:84242691-84242713 CCACCGCACCTGGCCAAAATAGG + Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087055387 11:93930908-93930930 CCACCGTGCCTGGCCACCTTTGG - Intergenic
1087293590 11:96344237-96344259 CCACTGTGCCTGGCCAGGATTGG - Intergenic
1087473185 11:98603169-98603191 ACACCGTGCCTGGCCCACATTGG - Intergenic
1087774629 11:102245902-102245924 CCACCGTGCCCAGCCAAGATTGG + Intergenic
1088288313 11:108209600-108209622 CCACCGTGCCTGGCCCAATGTGG - Intronic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1089420129 11:118325841-118325863 CCACCGTGCCTGGCCAGATATGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089483048 11:118822715-118822737 CCACCGTGCCCAGCCAGAATTGG + Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1090582239 11:128173070-128173092 CCACCGCGCCCGGCCACAATGGG - Intergenic
1092265319 12:6976435-6976457 CCACCGTGCCCGGCCCAAAGGGG - Exonic
1092338850 12:7658349-7658371 CCACCGTGCCCGGCCAAAATTGG + Intronic
1092340965 12:7675781-7675803 CCACTGTGCCCGGCCAAAATTGG - Intergenic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092787861 12:12045710-12045732 CCACCGCGCCCGGCCAAGATTGG - Intergenic
1093032157 12:14298185-14298207 CCACCGTGCCTGGCCAGGAATGG - Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093483061 12:19625221-19625243 CCACCGTGCCTGGGCTAAAATGG - Intronic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093916560 12:24808721-24808743 CCACTGCGCCTGGCCAAGATTGG + Intergenic
1094096239 12:26707815-26707837 CCACCGCGCCTGGCCAACCTGGG + Intronic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1096172628 12:49485339-49485361 CCACCATGCCCGGCCGAAATAGG + Intronic
1096479712 12:51930979-51931001 CCACCGTGCCTGGCCAGAAGAGG - Intergenic
1096486960 12:51989570-51989592 CCACTGTGCCTGGCCTAAATTGG + Intronic
1096610818 12:52800302-52800324 CTACAGTGCCTTGCTAAGATAGG + Intergenic
1096725893 12:53562350-53562372 CCACCGTGCCCGGCCTACATGGG - Intronic
1097037388 12:56132831-56132853 CCACCGTGCCTGGCCAGCATGGG - Intronic
1097712569 12:62932920-62932942 CCACCGCGCCCGGCCTAAATGGG + Intronic
1097904108 12:64902581-64902603 CCACCATGCCTGGCCACCATAGG + Intergenic
1098175051 12:67781451-67781473 CCACCGTGACTGGCCAGGATGGG + Intergenic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1098505781 12:71249051-71249073 CTACCGTGCCCGGCCACTCTAGG + Intronic
1098754869 12:74348583-74348605 CCACCGCGCCCGGCCAATATAGG + Intergenic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1099961079 12:89397489-89397511 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1100034712 12:90236497-90236519 CCACTATGCCCGGCCAAAATTGG - Intergenic
1100385902 12:94104482-94104504 CCACCGCACCTGGCCAAAACTGG - Intergenic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100507184 12:95233687-95233709 CCACTGTGCCTGGCCAATGTTGG + Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100514612 12:95314982-95315004 CCACCGCGCCTGGCCGAACTTGG - Intergenic
1100597261 12:96082319-96082341 CCACCATGCCTGGCCAATTTTGG - Intergenic
1100602304 12:96122405-96122427 CCACCTTGCCTGGCCAATGTTGG + Intergenic
1100700342 12:97140539-97140561 CCACAGTGCCTGGTCAAAAGAGG - Intergenic
1100828187 12:98494177-98494199 CCACCTTGCCTGGCCAAGGTTGG - Intronic
1101118400 12:101554101-101554123 CCACCATGCCTGGCCCACATAGG + Intergenic
1101586417 12:106089502-106089524 CCACCGTACCTGGCCAGACTCGG - Intronic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102385118 12:112502456-112502478 CCACCGTGCCTGGCCAGCTTAGG - Intronic
1102515807 12:113445877-113445899 CTCATGTGCCTGGTCAAAATTGG + Intergenic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1103025526 12:117570968-117570990 CCACCGTGCCTGGCTGGAATAGG - Intronic
1103030757 12:117610450-117610472 CCACCGTGCCTGGTCATAACTGG - Intronic
1103223873 12:119270002-119270024 GCACCATGGCTGGCCAAAATGGG - Intergenic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103466731 12:121147898-121147920 CCACCGAGCCCAGCCAAAATGGG + Intronic
1103545657 12:121699339-121699361 CCATCGTGCCCGGCCAGAATAGG + Intergenic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103613850 12:122139959-122139981 CCACCGTGCCCGGCCATAAGAGG + Intronic
1103888526 12:124221131-124221153 CCCCCGTGCCTGGCCTAAAGTGG + Intronic
1104471838 12:129035661-129035683 CCACCGTGCCTGGCCAGCACTGG + Intergenic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1105219046 13:18308608-18308630 CTACCCTGCCTGGCTAATTTTGG - Intergenic
1105275450 13:18919059-18919081 CCACTGTGCCCGGCCAAATTTGG + Intergenic
1105342443 13:19539855-19539877 CCACCATGCCTGGCCCCAATGGG - Intergenic
1105395591 13:20030819-20030841 CCACTGCGCCTGGCCAACATAGG + Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106724159 13:32467563-32467585 CCATCGTGCCTGGCCAACAGAGG + Intronic
1107963444 13:45578763-45578785 CCACCGTGCCTGGCCAGATTTGG - Intronic
1108079497 13:46720097-46720119 CCACCGTGCCTGGCCAAGGTAGG - Intronic
1108087517 13:46809662-46809684 CCACCGTGCCTGGCCAGATCTGG - Intergenic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108364559 13:49696920-49696942 CCACAGCGCCTGGCCTAAATTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109393303 13:61721358-61721380 CCACTGTGCCCGGCCAAAATTGG + Intergenic
1110215009 13:73015277-73015299 CCACCGCGCCCAGCCAAAATAGG + Intronic
1110527047 13:76550436-76550458 CCACCGTGCCTGGCCAGTATAGG - Intergenic
1110656452 13:78005519-78005541 CCACCATGCCTGGCCCACATAGG + Intergenic
1110791029 13:79586896-79586918 CTACTGTACCTGGCCTTAATTGG + Intergenic
1110982003 13:81911993-81912015 CCACCGCGCCCGGCCAACATTGG - Intergenic
1111110894 13:83707686-83707708 CCACCGCGCCCGGCCAAGATAGG + Intergenic
1111483457 13:88863963-88863985 CCACCGCGCCTGGCCTAAATGGG - Intergenic
1111555263 13:89872837-89872859 GTACATTGCCTGGCCAATATGGG + Intergenic
1111583257 13:90252009-90252031 CCACCATGCCTGGCCTCAATAGG + Intergenic
1111795874 13:92918968-92918990 CCACCGTGCCTGGCCACTAATGG + Intergenic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1112590117 13:100755611-100755633 CCACCATGCCTGGCCATATTCGG - Intergenic
1113369751 13:109712996-109713018 CCACCGTGCCTGGCCCATCTGGG - Intergenic
1114209878 14:20605449-20605471 CTACCGTGCCCAGCCAATACAGG - Intronic
1114214976 14:20650464-20650486 CCACCGTGCCTGGCCACCACTGG - Intergenic
1114716126 14:24826910-24826932 CCACCACACCTGGCCAAAATAGG - Intronic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115549916 14:34495754-34495776 TCACCGTGCCTGGCCAACTTTGG - Intergenic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1116171771 14:41411726-41411748 CCACCGTGCCTGGTCGAAAATGG - Intergenic
1116201921 14:41808295-41808317 CTTCCTTGTCTGGCCACAATTGG - Intronic
1116201964 14:41808483-41808505 CTTCCTTGTCTGGCCACAATTGG - Intronic
1116429540 14:44830015-44830037 CTAAAATGCCTGGCAAAAATAGG - Intergenic
1116523120 14:45873202-45873224 CCACTGTGCCTGGCCACAAGTGG - Intergenic
1116558953 14:46352103-46352125 CCACTGTGCCTGGCCTTAATAGG + Intergenic
1118107937 14:62681942-62681964 CCACCGTGCCTGGCCTACTTAGG - Intergenic
1118170580 14:63385037-63385059 CCACCGTGCCTGGCCCACTTTGG - Intronic
1118208328 14:63744022-63744044 CTACGGTGCCTGGCCCAGAGGGG + Intergenic
1118227304 14:63913988-63914010 CCACTGTGCCTGGCCATAAATGG + Intronic
1118648597 14:67865823-67865845 CCACTGCGCCTGGCCTAAATTGG + Intronic
1118706431 14:68484642-68484664 CCACCGTGCCTGGCCCAGTTGGG + Intronic
1118994908 14:70826930-70826952 CCACCGTGCCTGGCCCAATTTGG - Intergenic
1119283791 14:73433800-73433822 CCACCGCGCCTGGCCTAAATCGG - Intronic
1119516996 14:75256140-75256162 CTACCATGCCAGGCCTAAAATGG + Intronic
1119723671 14:76908798-76908820 CCACCGTGCCCGACCATAATGGG + Intergenic
1119942829 14:78659389-78659411 CTACCATGCCCAGCCAAAAATGG - Intronic
1120233631 14:81866212-81866234 CCACCGTGCCTGGCCAGATGTGG + Intergenic
1120517299 14:85485968-85485990 CCACCGTGCCCGGCCTATATAGG + Intergenic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121154532 14:91670714-91670736 CCACTGCGCCTGGCCAAAAGTGG - Intronic
1121213056 14:92223698-92223720 CCACCGTGCCTGACCAAGGTAGG - Intergenic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1122343124 14:101041688-101041710 CCACCGTGCCCGGCCAAGGTAGG - Intergenic
1122524124 14:102368294-102368316 CCACCGTGCCTGGCCTTACTGGG + Intronic
1122917172 14:104864719-104864741 CTCCCGAGCCTGGCCAGACTGGG - Intergenic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123446503 15:20334621-20334643 CCACCGTGCCTGGCCAATGTTGG + Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1124336449 15:28860982-28861004 CCACCGTGCCCGGCCAACAGTGG + Intergenic
1124566158 15:30816185-30816207 CCACCGCGACTGGCCAACATTGG + Intergenic
1124984521 15:34593089-34593111 CCACCGTGCCCGGCCAATATTGG + Intergenic
1125069415 15:35534088-35534110 CCACCGCTCCTGGCCAATATTGG - Intronic
1125560924 15:40632730-40632752 CTACCAAGCCAGGCCTAAATTGG - Intronic
1125706399 15:41741059-41741081 CCACCGCGCCCGGCCAAAATAGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126133725 15:45370087-45370109 CAACCATGCCTGGCCAATAATGG - Intronic
1126596858 15:50391812-50391834 CTACCGTGCCTGGCCCCGCTTGG - Intergenic
1126625792 15:50685173-50685195 CCACCGCGCCAGGCCAACATGGG - Intronic
1126983447 15:54273859-54273881 GTACTGTCCCTGGCCAAACTGGG + Intronic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1127424701 15:58844258-58844280 CCACCGTGCCCGGCCAACAATGG - Intronic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127839054 15:62814093-62814115 CCACCAGGCCTGGCCAATATGGG + Intronic
1127897143 15:63311229-63311251 GTACTGTGCCTGGCCAAGAGAGG + Intergenic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1127946062 15:63754995-63755017 CTACAATGCCTGGTCATAATAGG + Intronic
1128044430 15:64605116-64605138 CCACCGTGCCCGGCCTAATTTGG + Intronic
1128057497 15:64711302-64711324 CCACTGTGCCTGGCCAGGATTGG - Intergenic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1128888182 15:71307482-71307504 CCACCGTGCCTGGCCTGAATGGG - Intronic
1128947576 15:71839695-71839717 CTACTGTGCCTGGCCTGAATCGG + Intronic
1129380388 15:75161347-75161369 CTGCCCTGCCTGGCCCAAGTTGG - Intergenic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129788742 15:78326605-78326627 CCACCATGCCTGGCCTGAATTGG - Intergenic
1129849220 15:78782316-78782338 CCACCGTGCCTGGCCAGTCTAGG + Intronic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130201611 15:81834418-81834440 ACACCGTGCCTGGCCTACATAGG - Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1131145755 15:90010579-90010601 CCACCGCACCTGGCCAAAACAGG + Intronic
1131509498 15:93041872-93041894 CCACCGTGCCCGGCCAAAAAAGG - Intronic
1131566741 15:93492569-93492591 CCACCGCGCCTGGCCCAGATAGG + Intergenic
1131844569 15:96475478-96475500 CCACCGTGCCCGGCCTACATAGG - Intergenic
1132118194 15:99153084-99153106 CCACCGTGCCTGGCCAGCACTGG + Intronic
1132126811 15:99234657-99234679 CCACCGCACCTGGCCAAAAATGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132866711 16:2096802-2096824 CCACCGCGCCCGGCCAAAAATGG + Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133641359 16:7720505-7720527 CTACTGTGCCTGGCCAGATGTGG - Intergenic
1133759429 16:8786433-8786455 CCACCGTGCCTGGCCATCAAAGG + Intronic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133945008 16:10340734-10340756 CCACTGTGCCCAGCCAAAATAGG - Intronic
1134027089 16:10962769-10962791 ATACCATGCCTGGCCAATCTTGG - Intronic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134642010 16:15836875-15836897 CTACCATGCCTGGCTAATTTTGG + Intronic
1134660896 16:15983706-15983728 CTACCATGCCTGGCTAATTTTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135147636 16:19976560-19976582 CCACTGTGCCTAGCCAAAATTGG + Intergenic
1135234810 16:20745296-20745318 CCACCGTGCCTGGCCCCAAGTGG - Intronic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135414974 16:22262222-22262244 CCACCGTGCCTGGCCTAGTTGGG - Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1136249425 16:28994249-28994271 CCACCGTGCCTGGCCACACTGGG - Intergenic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136353799 16:29730020-29730042 CTACCATGCCTGGCCAATTTTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1137440342 16:48493541-48493563 CCACCGTGCCTGGCCAACTTAGG - Intergenic
1137463326 16:48685811-48685833 CCACTGCGCCTGGCCCAAATAGG - Intergenic
1137600233 16:49751503-49751525 CCACCGTGCCCAGCCTAAATTGG + Intronic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1137764652 16:50968560-50968582 CCACCGTGCCTGGCCTGAATGGG - Intergenic
1137975762 16:53030551-53030573 CCAACGTGCCTGGCCTAAAAGGG - Intergenic
1138190949 16:55013797-55013819 CCACTGTACCTGGCCAAAAAAGG - Intergenic
1138500930 16:57443736-57443758 CCACCGTGCCTGGCCAATTTTGG + Intronic
1138644721 16:58416173-58416195 CCACCGCGCCTGGCCAGTATAGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1138935987 16:61723789-61723811 CTAACGTCCATGGCAAAAATGGG - Intronic
1139401809 16:66687972-66687994 CCACCGCGCCTGGCCAAAATGGG + Intronic
1139414762 16:66799513-66799535 CCACCGTGCCTGGCCTAAGAGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1139727233 16:68910962-68910984 CTACCGTGCCCAGCCATTATTGG + Intronic
1139768945 16:69256880-69256902 CCACTGTGCCTGGCCTTAATTGG - Intronic
1139826101 16:69758359-69758381 CCACCGCGCCCGGCCAAGATAGG + Intergenic
1139897307 16:70298004-70298026 CTACTGTGCCTGGCCAATCCTGG + Intronic
1139976888 16:70819200-70819222 CCACAGTGCCTGGCCACAGTGGG + Intronic
1140013417 16:71158976-71158998 CCACCATGCCAGGCCAAGATGGG + Intronic
1141136763 16:81470743-81470765 CCACTGTGCCCAGCCAAAATTGG + Intronic
1141662840 16:85450771-85450793 CCACCGTGCCCGGCCAAACCTGG - Intergenic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141738019 16:85868237-85868259 CCACCGCGCCTGGCCAAGAGGGG - Intergenic
1141878655 16:86843364-86843386 CCACCGCGCCCGGCCAAAAAAGG - Intergenic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142704622 17:1686799-1686821 CCACCGTGCCAGGCCAAAAAAGG + Intergenic
1142874976 17:2846561-2846583 CCACCATGCCTGGCCAACTTTGG + Intronic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143170039 17:4923687-4923709 CCACCGTGCCTGGCCCCATTAGG + Intergenic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143346920 17:6256581-6256603 CCACCGTGCCCGGCCAAAGTTGG - Intergenic
1143421164 17:6793595-6793617 CCACCGTGCCTGGACAAATTTGG + Intronic
1143428617 17:6862180-6862202 CTACCGTGCCTGGGCTTGATTGG + Intergenic
1143533354 17:7519505-7519527 CCACCATGCCTGGCCAACTTAGG + Intergenic
1143643376 17:8213030-8213052 CCACCGCGCCTGGCCAGAACTGG - Intergenic
1143685955 17:8515829-8515851 CCACCGTGCCTGGCCGGGATTGG + Intronic
1143808727 17:9453091-9453113 CCACCGCGCCTGGCCAGGATGGG + Intronic
1143958588 17:10696155-10696177 CCACCGCGCCCGGCCATAATTGG - Intronic
1144822082 17:18082328-18082350 CCACCGTGCCTGGCCTAGCTTGG - Intergenic
1144934540 17:18887514-18887536 CCACCGTGCCTGGCCATCTTTGG + Intronic
1145075847 17:19854009-19854031 CCACTGTGCCTGGCCAGAATTGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145223903 17:21111730-21111752 CCACCGTGCCCGGCCAGTATAGG - Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145950172 17:28811151-28811173 CCACCGCGCCTGGCCTAAATGGG - Intronic
1146073051 17:29701856-29701878 CCACTGTGCCTGGCCACATTTGG + Intronic
1146210216 17:30936627-30936649 CCACCGCGCCCGGCCAATATGGG - Intronic
1146363382 17:32197713-32197735 CCACCGTGCCTGGCCACACCCGG + Intronic
1146590044 17:34121025-34121047 CCACCGTGCCTGGCCAGTACTGG + Intronic
1146898996 17:36569038-36569060 CCACCGTGCCTGGCCTACAAAGG + Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147115063 17:38293030-38293052 CCACCGTGCCCAGCCAAAAAGGG - Intergenic
1147163985 17:38583838-38583860 CCACCGCGCCAGGCCAAAGTAGG + Intronic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147398141 17:40161262-40161284 CCACTGTGCCAGGCCAAAATAGG + Intronic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147532027 17:41288379-41288401 CCACTGTGCCAGGCCAAAATGGG - Intergenic
1147766301 17:42838603-42838625 CCACCATGCCTGGCCAGACTAGG + Intronic
1147780859 17:42940894-42940916 CCACCATGCCCGGCCGAAATCGG - Intergenic
1147789073 17:43001802-43001824 CCACTGTGCCCGGCCAAATTAGG - Intronic
1148137517 17:45303867-45303889 CCACCGTGCCTGGCCTAGTTTGG + Intronic
1148288323 17:46416571-46416593 CCACCGTGCCTGGCCATTCTAGG + Intergenic
1148310491 17:46634156-46634178 CCACCGTGCCTGGCCATTCTAGG + Intronic
1148471897 17:47899472-47899494 CCACTGTGCCTAGCCAACATGGG + Intronic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148580998 17:48743669-48743691 CTACCGCGCCCGGCCAATCTGGG + Intergenic
1148594760 17:48844803-48844825 CTACCGCGCCCGGCCAATCTGGG + Intronic
1148800608 17:50222751-50222773 CCACCGTGCCTGGCAAATCTTGG - Intergenic
1148849065 17:50545746-50545768 CCACCGTGCCTGGCCAGAGAAGG - Intronic
1148878986 17:50710946-50710968 CCACCGTGCCTGGCCAGCACTGG - Intergenic
1149707256 17:58706139-58706161 CCACCGTGCCTGGCCAGCAAAGG - Intronic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1150175826 17:63054666-63054688 CCACCGTGCCCGGCCATAAGTGG + Intronic
1150254372 17:63732290-63732312 CTACCGCACCTGGCCAATAGTGG + Intronic
1150385065 17:64752532-64752554 CCACCGCGCCTGGCCAACGTGGG + Intergenic
1151169683 17:72236353-72236375 CCACCCTATCTGGCCAAAATGGG - Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151477033 17:74350084-74350106 CTACTGTGCCTGGCCACAGACGG + Intronic
1151640204 17:75386886-75386908 CCACCGCGCCTGGCCAAGATCGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151907706 17:77059735-77059757 CCACCGTGCCTGGCCCAAGAGGG + Intergenic
1151941131 17:77292644-77292666 CCACCATGCCTGGCCAATTTTGG + Intronic
1152422096 17:80199105-80199127 CTACCGTGCCCGGCTAATTTGGG + Intronic
1152511558 17:80793102-80793124 TGGCCGTGCCAGGCCAAAATCGG + Intronic
1152770368 17:82164086-82164108 CCACCGTGCCTGGCCCTATTTGG - Intronic
1152863233 17:82708385-82708407 TCACCGCGCCCGGCCAAAATAGG - Intergenic
1152874550 17:82779289-82779311 CCACTGCGCCTGGCCAAGATGGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154165967 18:12014727-12014749 CAGCAGTGCCTGGGCAAAATCGG - Intronic
1154174045 18:12071765-12071787 CCACCGTGCCTGGCCACAAAAGG - Intergenic
1154179364 18:12118318-12118340 CCACCGTGCCCGGCCTAAAAAGG - Intronic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1155305676 18:24475718-24475740 CTACCGCACCTGGCCCAAAAAGG - Intronic
1155456144 18:26016433-26016455 CCACCGTGCCTGGCCAGAATAGG - Exonic
1155470100 18:26182801-26182823 CTACCGTGCCCAGCCAATGTTGG - Intronic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155973430 18:32102916-32102938 CCACCATGCCTGGCCAATTTGGG + Intronic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156356421 18:36346076-36346098 CCACTGTGCCCAGCCAAAATTGG - Intronic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156466794 18:37352932-37352954 CTACCGCGCCCGGCCAAGAAAGG - Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1156667203 18:39422973-39422995 CTACCGTGCCCGGCCTAATTTGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157373374 18:47139169-47139191 CCACCGTGCCCGGCCAACAAAGG - Intronic
1157588004 18:48817486-48817508 CCACCGTGCCTGGCCCGGATGGG - Intronic
1157835102 18:50894274-50894296 CCACCGCGCCCGGCCAAAAAGGG - Intronic
1157835154 18:50894581-50894603 CCACCGTTCCCGGCCAAAATAGG - Intronic
1157962230 18:52168006-52168028 CCACCGTGCCCAGCCCAAATTGG - Intergenic
1158580428 18:58676240-58676262 CTACCACGCCTGGCCACAATAGG - Intronic
1158770882 18:60515527-60515549 CCACCGTGCCCGGCCTAAGTTGG - Intergenic
1158828648 18:61253653-61253675 CCACCGTGCCTGGCCACCTTAGG - Intergenic
1158849956 18:61485784-61485806 CCACCGCACCTGGCCAAAATGGG - Intronic
1159032689 18:63247483-63247505 CCACCGCGCCCGGCCACAATAGG + Intronic
1160754277 19:749541-749563 CCACGGCGCCTGGCCAAGATGGG - Intergenic
1161020336 19:2007546-2007568 CTACCGTCCCTGGCCTAAGGCGG - Intronic
1161134718 19:2612977-2612999 CAACGGTGCCTGGCCAACGTCGG + Intronic
1161138731 19:2635868-2635890 CCACCGTGCCTGGCCAACTTGGG + Intronic
1161192107 19:2963514-2963536 CCACCGTGCCTGGCCAGAGTGGG - Intergenic
1161259727 19:3330955-3330977 CCACTGTGCCCGGCCAAGATGGG - Intergenic
1161406939 19:4096060-4096082 CCACCGTGCCCGGCCAAACTGGG + Intronic
1161610665 19:5240550-5240572 CCACCGTGCCCGGCCGAAAGGGG - Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161751756 19:6102835-6102857 CCACTGTGCCTGGCCATAAGAGG - Intronic
1161899668 19:7109192-7109214 CCACTGTGCCCGGCCAAAAGTGG + Intergenic
1161942211 19:7412453-7412475 CCACCGTTCCTGGCCTAAAATGG - Intronic
1162165255 19:8748473-8748495 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162166320 19:8755927-8755949 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162167386 19:8763383-8763405 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162168327 19:8769683-8769705 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162170074 19:8782448-8782470 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162171155 19:8790101-8790123 CTACTGTGCGTGGCCAGAAATGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162397579 19:10426050-10426072 CCACCTCGCCTGGCCAAAAGTGG - Intronic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162645881 19:12049935-12049957 CCACCGCACCCGGCCAAAATTGG - Intronic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162733314 19:12731833-12731855 CCACCGCGCCTGGTCAAAAAGGG - Intronic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162989152 19:14291140-14291162 CCACCGCGCCCGGCCAGAATTGG + Intergenic
1163037846 19:14581617-14581639 CCACCGCGCCTGGCCAGAAATGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163497775 19:17656562-17656584 CCACCGCACCTGGCCAAAAGCGG - Intronic
1163908779 19:20170182-20170204 CCACCGCGCCCGGCCAAAATGGG + Intronic
1163983190 19:20921126-20921148 CCACCGTGCCTGGCCTAATATGG - Intergenic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164795656 19:31025528-31025550 CCACCGTGCCTGGCCACAGATGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1164955545 19:32380201-32380223 CTACCATACCCGGCCTAAATAGG - Intronic
1165029976 19:32991032-32991054 CCACTGTGCCTGGCCAATTTTGG - Intronic
1165047346 19:33115780-33115802 CCACCGCGCCTGGCTAAAGTGGG + Intronic
1165502854 19:36203864-36203886 CTACTGTGCCTGGCCTAACAAGG + Intronic
1165653267 19:37510071-37510093 CCACTGTGCCTGGCCAAACAAGG - Intronic
1165889098 19:39100019-39100041 CCACTGTGCCGGGCCAAGATGGG - Intronic
1165954058 19:39490675-39490697 CTACTGTGCCCAGCTAAAATAGG + Exonic
1165996960 19:39850443-39850465 CCACCGCGCCAAGCCAAAATGGG - Intergenic
1166021692 19:40037065-40037087 CCACCGTGCCTGGCTAATTTTGG + Intronic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166074142 19:40404089-40404111 CCACCGCGCCCGGCCAAAAGCGG + Intronic
1166239067 19:41477420-41477442 CCACCCTGCCTGGCCATCATGGG + Intergenic
1166386638 19:42385999-42386021 CCACCGCGCCTGGCCTAAAAAGG - Intergenic
1166829797 19:45632464-45632486 CCACCATGCCCAGCCAAAATAGG + Intronic
1166838642 19:45682828-45682850 CCACCATGCCCGGCCCAAATGGG + Exonic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167236036 19:48316089-48316111 CCACCGTGCCTGGCCCAGTTTGG - Intronic
1167628024 19:50605338-50605360 CCACCGTGCCTGGCCAATTTTGG + Intergenic
1167898908 19:52603589-52603611 CCATCGTGCCTGGCCAGAACTGG - Intronic
1168060883 19:53891567-53891589 CCGCCGTGCCTGGCCAAGCTTGG + Intronic
1168278243 19:55288870-55288892 CCACCGTGTCTGGCCAGAAGTGG + Intronic
1168334678 19:55591124-55591146 AGACCGTGCCTGGCCAACATGGG - Intergenic
1168478419 19:56695573-56695595 CTACCGTGCCCTGCCAAAATGGG - Intergenic
924961405 2:37911-37933 CCACTGTGCCCGGCCAAGATGGG - Intergenic
925668719 2:6289596-6289618 CCACTGTGCCAGGCCAAGATTGG - Intergenic
925819917 2:7790153-7790175 CCACCATGCCTGGCCCAGATTGG - Intergenic
925923584 2:8654546-8654568 CCACCATGCCTGGCCATGATGGG - Intergenic
925923591 2:8654579-8654601 CCACCATGCCTGGCCATGATGGG - Intergenic
926035855 2:9635101-9635123 CCACTGTGCCTGGCCTAAATCGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926187554 2:10703014-10703036 CCACCGTGCCTGGCCCGAAAAGG + Intergenic
926194637 2:10755321-10755343 CCACCGTGCCTGGCCACACCTGG + Intronic
926243960 2:11108360-11108382 CTACCGCGCCTGGCCAATAAAGG - Intergenic
927406360 2:22773857-22773879 CCACCGTGCCCGGCCCAGATCGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927522805 2:23710659-23710681 CAACCGTGCATGGAAAAAATTGG + Intergenic
927556247 2:24034860-24034882 CCACTGTGCCTGGCCAAACATGG + Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927915278 2:26931719-26931741 GCACCGTGCCTGGCCAAGGTTGG - Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928237857 2:29560722-29560744 CTACCATGCCTGGCTAATTTTGG + Intronic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929104976 2:38355982-38356004 CCACCATGCCTGGCCACATTTGG + Intronic
929464698 2:42133984-42134006 CCACCGCGCCTGGCCACAATAGG - Intergenic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
930840305 2:55837959-55837981 CTACCATGCCTGGCCTAGAATGG + Intergenic
931544273 2:63363886-63363908 ACACTGTGCCTGGCAAAAATTGG - Intronic
931544962 2:63372834-63372856 CTACCGTGCCCAGCCTATATTGG - Intronic
931775773 2:65539270-65539292 CCACCGCGCCCGGCCAGAATTGG + Intergenic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
933706590 2:85295486-85295508 CCACCGTGCCTGGCCACTTTTGG + Intronic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934535901 2:95133179-95133201 CCATCTTGCCTGGCCAAGATTGG - Intronic
934544410 2:95202913-95202935 CCACCGCGCCTGGCCAGAAAAGG + Intergenic
934670731 2:96210685-96210707 CCACCGTGCCTGGCCTTAAAAGG + Intergenic
934684969 2:96314340-96314362 CCACCATGCCTGGCCTGAATGGG + Intergenic
934852478 2:97710322-97710344 CCACCGCGCCAGGCCAAAAATGG - Intergenic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
935230158 2:101089059-101089081 CCACCACGCCTGGCCAACATTGG - Intronic
935235476 2:101134884-101134906 CCACCGTGCCCGGCCAAATATGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
936013234 2:108939063-108939085 CCACCGTGCCTGGCCACTCTAGG + Intronic
936247745 2:110843305-110843327 CCACCATGCCTGGCCAATGTAGG + Intronic
936540388 2:113345144-113345166 CCACCATGCCTGGCCTAATTAGG + Intergenic
936697239 2:114965421-114965443 CCACCGTGCCTGGCCAGTTTGGG + Intronic
936789985 2:116140134-116140156 CCACCGCGCCTGGCCTAGATGGG - Intergenic
937364450 2:121250890-121250912 CCACCATGCCTGGCCAGTATTGG + Intronic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
938007875 2:127803290-127803312 CCACTGTGCCTGGCCTACATTGG - Intronic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938571815 2:132568416-132568438 CCACCGTGCCTGGCCAACCTAGG - Intronic
938904914 2:135828308-135828330 CCACTGTGCCTAGCCAAACTTGG + Intronic
938924773 2:136028998-136029020 CCACCATGCCTGGCCTTAATTGG + Intergenic
938967298 2:136399798-136399820 CCACCGTGCCCGGCCAGAACTGG + Intergenic
938997783 2:136698821-136698843 CCACCGTGCCCGGCCAGTATGGG + Intergenic
939492393 2:142892198-142892220 CCGCCATGCCTGGCCAATATTGG + Intronic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942138598 2:172954919-172954941 ATAAGGTACCTGGCCAAAATGGG - Intronic
942331551 2:174829987-174830009 CCACCGCGCCCGGCCAAATTAGG - Intronic
942724979 2:178996363-178996385 CCACCGCACCTGGCCAAAATTGG + Intronic
942884785 2:180910138-180910160 CCACCGCGCCCGGCCCAAATCGG - Intergenic
943757265 2:191569622-191569644 CTACCGTGCCTGGCCTAGCAAGG + Intergenic
943764751 2:191648568-191648590 CTACTGTGCTTGGCCAAAGTTGG + Intergenic
944394740 2:199253867-199253889 CCACCGTGCCTGGCCTGAAGAGG - Intergenic
944725098 2:202462998-202463020 CCACTGTGCCTGGCCAACATTGG + Intronic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945757244 2:213862377-213862399 CTATCCTGCCTTGCTAAAATCGG + Intronic
946768381 2:223061483-223061505 CTACTGTGCCTGGCCGTGATAGG + Intronic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947434207 2:230058918-230058940 TCACCGTGCCTGGCCTAAAATGG + Intronic
947697160 2:232201060-232201082 CCACCGTGCCTGGCCCCAAAAGG + Intronic
947738840 2:232475556-232475578 CCACCGTGCCTGGCCGAAGGGGG - Intergenic
947766511 2:232641318-232641340 CCACCGCACCTGGCCACAATCGG + Intronic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948193685 2:236079230-236079252 CCACCGTGCCTGGCCAGCATGGG - Intronic
1168796911 20:616597-616619 CCACCGCGCCTGGCCACAAGGGG + Intergenic
1169385220 20:5143129-5143151 CTACCATGCCCAGCCAAAAATGG + Intronic
1169393313 20:5207870-5207892 CTCCCTTGCCTGGCCTAGATCGG + Intergenic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1170699173 20:18687809-18687831 CCACTGTGCCTAGCCAAAATAGG + Intronic
1170774629 20:19364740-19364762 CCACCGTACCTGGCCAAGAGTGG + Intronic
1171441807 20:25170187-25170209 CCACCGTGCCTGGCGATGATGGG - Intergenic
1171871750 20:30532902-30532924 CTACTGTGCCCGGCCTGAATAGG + Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172357072 20:34287677-34287699 CCACCGTGCCTGGCCAGAAGGGG + Intronic
1172366590 20:34354685-34354707 CCACCGTGCCTGGCCTAGGTGGG + Intergenic
1172505992 20:35463113-35463135 CCACCGTGCCTGGCCTTATTTGG - Intronic
1172538058 20:35689479-35689501 CCACCGTGCCCGGCCACACTTGG - Intronic
1172559101 20:35870015-35870037 CTACCGCGCCTGGCCACACCCGG - Intronic
1172618883 20:36306940-36306962 CTCCCGTGCCCGGCCAACCTTGG + Intronic
1172637272 20:36418398-36418420 CCACCGTGCCTGGCCCATTTGGG + Intronic
1172810471 20:37644080-37644102 CCTCCGTACCTGGCCAAAAGAGG + Intergenic
1172828970 20:37815603-37815625 CCACCATGCCTGGCCCACATTGG + Intronic
1172934757 20:38611859-38611881 CCACCGTGCCTGGCCACACCCGG + Intronic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173065131 20:39703402-39703424 CCACAGTGCCTGGCCCAACTTGG - Intergenic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173299633 20:41790360-41790382 CTACCATGCCTGGCCATCAATGG + Intergenic
1173978336 20:47204168-47204190 CCACCATGCCTGGCCAATGTGGG + Intergenic
1174007411 20:47421439-47421461 CCACTGTGCCTGGCCACAAATGG + Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174256285 20:49257997-49258019 CCACCGTGCCTGGCCAGAGATGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1174393505 20:50232553-50232575 CCACTGTGCCTGGCCATCATTGG + Intergenic
1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG + Intergenic
1174522564 20:51142973-51142995 CCACCGCGCCTGGCCAGCATGGG - Intergenic
1174914165 20:54637833-54637855 CCACCGCGCCCGGCCAAAGTAGG - Intronic
1175244183 20:57571671-57571693 CCACCGTGCCCGGCCAGAAATGG + Intergenic
1175383790 20:58581295-58581317 CCACCATGCCTGGCCTTAATTGG + Intergenic
1175442152 20:58999780-58999802 CCACCGTGCCCGGCCATAACTGG - Intronic
1175559397 20:59907957-59907979 CCACCGTGCCTGGCCAGGAATGG - Intronic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1176155111 20:63615611-63615633 CCACCAGGCCTGGCCAACATAGG + Intronic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178011182 21:28289017-28289039 CCACCGTGCCTGGCCAGGATAGG + Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178789156 21:35682622-35682644 CCACCGCGCCTGGCCTAAATTGG + Intronic
1178800810 21:35793590-35793612 CCACCGTGCCAGGCCACAACAGG + Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179767866 21:43587376-43587398 CTACCGTGCCTGGCCATCCCAGG - Intronic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180638528 22:17279682-17279704 CCACCGTGCCCGGCCAGAAGTGG - Intergenic
1180691159 22:17717178-17717200 CCACTGTGCCTGGCCAAAGTTGG - Intronic
1181302683 22:21892682-21892704 CCACCATGCCCGGCCAATATTGG - Intergenic
1181557466 22:23679628-23679650 CCACCGTGCCTGGCCACAAATGG - Intergenic
1181718124 22:24750289-24750311 CTGCCCTGGCTGGCCAAAAGTGG + Intronic
1182049488 22:27301935-27301957 CCACCACGCCTGGCCAATATCGG + Intergenic
1182631313 22:31687754-31687776 CCACCGCGCCCGGCCAATATTGG - Intronic
1182888547 22:33797049-33797071 CCACCATGCCTGGCCAGACTTGG + Intronic
1183157038 22:36083642-36083664 CTACCGAGTCCGGCCCAAATTGG - Intergenic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183559449 22:38559454-38559476 CCACCGTGCCCTGCCAAAACAGG + Intronic
1183621056 22:38972978-38973000 CCACCGTGGCTGGCCAAAGGTGG - Intronic
1183680086 22:39323248-39323270 CCACTGTGCCTAGCCAACATAGG - Intergenic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184847245 22:47096532-47096554 CCACCGTGCCCGGCCAACAAAGG - Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
1184984940 22:48124785-48124807 CTACTGTGCCTGGCCGGAGTAGG + Intergenic
1185155371 22:49190562-49190584 CCACCATGCCCGGCCAAACTGGG + Intergenic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949540745 3:5030333-5030355 CTATCTTGCCTGGCCAAAGTGGG + Intergenic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
949584117 3:5421264-5421286 CCACCGTGCCCGGCCAAGAAAGG - Intergenic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
950066839 3:10118773-10118795 CCACTGTGCCTGGCCATAAGTGG + Intronic
950275828 3:11659873-11659895 CCACCGCGCCCGGCCAAGATGGG - Intronic
950805358 3:15598306-15598328 CCACCGCGCCTGGCCATAACTGG + Intronic
950963924 3:17132931-17132953 CCACCGTGCCTGGCCCTGATTGG - Intergenic
951215373 3:20019574-20019596 CCACCGCGCCTGGCCTAAATTGG - Intergenic
951809656 3:26685238-26685260 GTACTGTGCCTGGCCCACATGGG + Intronic
952371395 3:32726405-32726427 CCACCGCCCCTGGCCTAAATAGG - Intronic
952388352 3:32859543-32859565 CCACTGTGCCTGGCCAACTTTGG + Intronic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953476346 3:43209027-43209049 CTACCGCACCTGGCCAAAATGGG - Intergenic
954051442 3:47981995-47982017 CCACTGTGCCCGGCCAACATAGG - Intronic
954071801 3:48148437-48148459 CTACCATGCCCGGCCAAGAAAGG - Intergenic
954191516 3:48965671-48965693 CCACCGTGCCTGGCCGGACTGGG - Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954246287 3:49334467-49334489 CCACTGTGCCTGGCCTAACTTGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
954775017 3:53009157-53009179 CCACCGTGCCCAGCCAAAAGTGG - Intronic
954804684 3:53210583-53210605 CCACCATGCCCGGCCAGAATGGG - Intergenic
955079102 3:55641260-55641282 CCACCATGCCTGGCCTATATTGG - Intronic
955273289 3:57523093-57523115 CCACTGTGCCCGGCCAATATGGG - Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
956117182 3:65930442-65930464 CCACCGTGCCTGGCCACAAGTGG - Intronic
956132318 3:66065983-66066005 CCACCGAGCCTGGCCATAAGGGG + Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959085164 3:101844978-101845000 CCACCGTGCCCGGCCAGAATTGG - Intronic
959143295 3:102512451-102512473 CCACCGCGCCTGGCCGTAATAGG + Intergenic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960110666 3:113841577-113841599 CCACCGTGCCTGGCTGAAGTAGG + Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960802099 3:121550199-121550221 CCACTGTGCCTGGCCTAATTTGG - Intergenic
960907017 3:122611624-122611646 CTACTGTGCCTGGCCTTAAGAGG + Intronic
961031138 3:123605026-123605048 CCACCACGCCCGGCCAAAATGGG - Intergenic
961031614 3:123609794-123609816 CCACCGCGCCTGGCCAGAACTGG + Intergenic
961736741 3:129006601-129006623 CCACTGTGCCCGGCCAAAAGTGG + Intronic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963090203 3:141476944-141476966 CCACCGTGCCTGGCCAATCTTGG + Intergenic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
963194470 3:142511366-142511388 CCACCACACCTGGCCAAAATGGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963829860 3:149994629-149994651 CCACCGTGCCCAGCCAAAAAAGG + Intronic
964293101 3:155203533-155203555 CCACCGTGCCCTGCCAGAATTGG + Intergenic
964539593 3:157764844-157764866 CCACCGCGCCTGGCCAGTATTGG - Intergenic
964589541 3:158344929-158344951 CCACCGTGCCTGGCCTAGATTGG - Intronic
964787560 3:160415082-160415104 CCATTGTGCCTGGCCAACATTGG - Intronic
965010189 3:163077766-163077788 CCACCGTGCCCGGCCAAAATGGG + Intergenic
965069009 3:163892519-163892541 CCACTGTGCCTGGCCATAAATGG + Intergenic
965579205 3:170249133-170249155 CTACCGCGCCCGGCCAGAATTGG + Intronic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
965673410 3:171170761-171170783 CTACCGCACCTGGCCAGAAGTGG - Intronic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
966804573 3:183796979-183797001 CTACCGCGCCTGGCCAGCACTGG - Intronic
966896872 3:184451637-184451659 CCACAGTGCCTGGCCAACAGTGG + Intronic
966970476 3:185040913-185040935 CCACCGCGCCTGGCCAACCTTGG - Intronic
967914226 3:194566311-194566333 CCACTGTACCTGGCCAGAATGGG - Intergenic
968013891 3:195309252-195309274 CCACCGTGCCTGGCCACAAGTGG - Intronic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968118241 3:196106104-196106126 CCACCGGGCCTGGCCGAGATGGG + Intergenic
968149441 3:196325485-196325507 CCACCGTGCCCGGCCCATATTGG + Intronic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
971105087 4:23515888-23515910 CCACCGTGCCTGGCGTAAAATGG - Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972099173 4:35390967-35390989 CCACCATGCCTGGCCACCATTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972431446 4:38986519-38986541 CCACCGTGCCTGGCCATGAATGG - Intronic
972487430 4:39555518-39555540 CCACAGTGCCTGGCCAACAGAGG + Intronic
972567074 4:40279305-40279327 CCACCGTGCCCGGCCAGCATTGG - Intergenic
972614751 4:40687306-40687328 CCACTGTGCCTGGCCAGAGTTGG - Intergenic
973272334 4:48274240-48274262 CCACCATGCCTGACCAACATAGG - Intergenic
973323897 4:48837576-48837598 CCACTGTGCCTGGCCAGAATGGG + Intronic
973812111 4:54581571-54581593 CCACCGTGCCTGGCCATGAAAGG - Intergenic
973946448 4:55961475-55961497 CCACCGTGCCCGGCCAAAGATGG - Intronic
974901769 4:68008352-68008374 CCACTGTGCCCGGCCAAAAGAGG - Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
977129220 4:93213058-93213080 CCACCGTGCCTGGCCAGTTTGGG + Intronic
977696031 4:99967475-99967497 CCACTGTGCCTGGCCCACATTGG + Intergenic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978391495 4:108230911-108230933 GCACCGTGCCTGGCCCCAATAGG + Intergenic
978481682 4:109199430-109199452 CCACCGTGCCCAGTCAAAATTGG + Intronic
978506626 4:109464505-109464527 CTACTGTGCCTGGCCCAATGTGG + Intronic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
979574097 4:122265979-122266001 CCACCGTGCCCGGCCTAGATAGG + Intronic
979683375 4:123485214-123485236 CCACTGTGCCTGGCCAATTTGGG - Intergenic
979695172 4:123605002-123605024 CCACCGTGCCTGGCCAGTTTTGG - Intergenic
979916140 4:126436583-126436605 CCACTGCGCCTGGCCAATATGGG - Intergenic
980936005 4:139226567-139226589 CCACTGCACCTGGCCAAAATTGG - Intergenic
981327070 4:143461965-143461987 CCACTGTGCCTGGCTAAATTTGG - Intronic
981511654 4:145565030-145565052 CCACTATGCCTGGCCAAATTTGG - Intergenic
981550181 4:145936111-145936133 CTGCCGTGCTTGGACAAAATGGG - Intronic
982051424 4:151506193-151506215 CCACTGTGCCTGGCCTAAATGGG + Intronic
982224704 4:153154850-153154872 CCACTGTGCCTGGCCAATTTGGG - Intronic
982229564 4:153196095-153196117 CCACTGTGCCTGGCCAGAAAAGG + Intronic
982880796 4:160712200-160712222 CCACAGTGCCTGGCCTTAATAGG + Intergenic
982920506 4:161267816-161267838 CCACCGTGCCCGGCCGAAAATGG + Intergenic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
983934131 4:173487813-173487835 CCACCATGCCCAGCCAAAATAGG - Intergenic
985241653 4:187937143-187937165 CCACCTTGCCTGGCCTAAAATGG + Intergenic
985665017 5:1177550-1177572 CCACCGCGCCCGGCCAAAACTGG - Intergenic
986352749 5:6895579-6895601 CTACTGTGCCTGGCCAAATTAGG + Intergenic
987139459 5:14930370-14930392 CTACCGGGCCCGGCCAAAATAGG + Intergenic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988596044 5:32591983-32592005 CCACCATGCCTTGCCAAAGTTGG + Intronic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
988663685 5:33301617-33301639 CCACCGTGCCTGGCCATATTTGG - Intergenic
989037649 5:37192575-37192597 CCACCGTGCCTGGCCAGATGAGG - Intronic
989173901 5:38501464-38501486 CCACTGTGCCCGGCCGAAATAGG - Intronic
989529144 5:42486558-42486580 CCACCGTGCCCGGCCAAACTTGG - Intronic
990248916 5:53892890-53892912 CTACTGTGCCTGGCCTATACTGG + Intronic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990326751 5:54684553-54684575 CTACCATGCCTGGCCACTGTAGG + Intergenic
990332906 5:54745160-54745182 CCACCATGCCTGGCCAGACTAGG + Intergenic
991113567 5:62928502-62928524 CTACTGAGCCTGCCCACAATGGG - Intergenic
991222090 5:64228225-64228247 CCACCGTGCCTGACCAAATTTGG - Intronic
991354777 5:65756788-65756810 CCACGGTGCCTGGCCAAGGTTGG + Intronic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
991716476 5:69455338-69455360 CCACCGTGCCTGGCCTCAAATGG + Intergenic
992085238 5:73272240-73272262 CCACCGTGCCTGGCCACCACAGG + Intergenic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
992682509 5:79167123-79167145 CCACCGCGCCTGGCCAGACTGGG - Intronic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
992938472 5:81737493-81737515 CCACCGCGCCTGGCCAAACAGGG - Intronic
993638814 5:90377922-90377944 CTACCATGCCTGGCCAAGTACGG + Intergenic
993710893 5:91223684-91223706 CTACTGTGCCTGGCCACATCAGG + Intergenic
994506547 5:100649898-100649920 CCACCGTGCCCAGCCAATATAGG - Intergenic
994839599 5:104905736-104905758 CCACCGTGCCTGGCCAGGAAAGG + Intergenic
995192897 5:109338350-109338372 CCACCGTGCCTGGCCTGAAATGG - Intronic
996105029 5:119490853-119490875 CTACCGCACCTGGCCTAGATAGG + Intronic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
996842361 5:127861293-127861315 CCACCGTGCCTGGCCCATCTTGG + Intergenic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997155744 5:131554802-131554824 CCACTGTGCCTGGCCTAAGTAGG + Intronic
997177289 5:131792446-131792468 CCACCGTGCCCAGCCACAATTGG + Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
997608800 5:135195893-135195915 CCACCGTGCCTGGCTAATTTTGG + Intronic
997894184 5:137701333-137701355 CCACCGTGCCCGGCCAAAATTGG + Intronic
998087436 5:139337994-139338016 CCACCGCGCCTGGCCAAGTTTGG + Intergenic
998110002 5:139493983-139494005 CCACCGTGCCTGGCCTCAAAAGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998450121 5:142227783-142227805 CCACCGTGCCCGGCCGATATTGG - Intergenic
998944170 5:147319427-147319449 CCACTGTGCCTGGCCACAATGGG + Intronic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999218903 5:149958957-149958979 CCACCATGCCCGGCCAAATTTGG + Intergenic
999453333 5:151694746-151694768 CTACCGTGTCTGGCCCACAAAGG + Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1000002156 5:157149326-157149348 CCACCGTGCCCGGCCGTAATGGG - Intronic
1000011331 5:157236084-157236106 CCACCGTGCCTGGCCTTAAAAGG - Intronic
1000037864 5:157462363-157462385 CCACCGTGCCTGGCCCTAAGAGG - Intronic
1000079813 5:157834052-157834074 CCTCCGTGCCTGGCCAGAACTGG - Intronic
1000092342 5:157940680-157940702 CCACCGTGCCTGGCCCCAAGTGG - Intergenic
1000331949 5:160212754-160212776 CCACCGTGCCCGGCCACAACTGG + Intronic
1000622370 5:163500603-163500625 CCACTGCGCCTGGCCAGAATAGG + Intergenic
1000971263 5:167717241-167717263 CTACCATGCCCGGCCAACTTTGG + Intronic
1001636946 5:173217109-173217131 CCACCGTGCCTGGCCAACCATGG + Intergenic
1002109424 5:176898268-176898290 CTAATGTGCCTTTCCAAAATTGG + Intronic
1002208209 5:177578958-177578980 CCACCGTGCCCGGCCAATAGAGG - Intergenic
1002390016 5:178903258-178903280 CTACCATCACTGGCCAATATGGG - Intronic
1002399005 5:178980919-178980941 CCACCATGCCTGGCCAAGGTTGG + Exonic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002515079 5:179751722-179751744 CTACTGTGCCTGGCCATAATCGG - Intronic
1002803932 6:553202-553224 CAACCGTGCCTGGCCAGAAAGGG + Intronic
1002922427 6:1581947-1581969 CCACCGTGCCTGGCCAACGTGGG - Intergenic
1003046594 6:2739164-2739186 CCACTGTGCCTGGCCGAAGTTGG - Intronic
1003145724 6:3508720-3508742 CCACTGTGCCTGGCCACATTTGG + Intergenic
1003244246 6:4370765-4370787 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1003546272 6:7061609-7061631 CCACCGTGCCCGGCCTAAAATGG + Intergenic
1003650000 6:7950700-7950722 CCACCGTGCCTGGCCTCATTGGG + Intronic
1003916821 6:10794703-10794725 CCACCGCACCTGGCCAGAATAGG - Intronic
1004101466 6:12616491-12616513 CTACCGTGCCAGGCCCATAAAGG + Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004371173 6:15053740-15053762 CCGCCGTGCCTGGCCAAGAATGG - Intergenic
1004384202 6:15158406-15158428 CCACGGTGCCTGGCCCAAAATGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004485839 6:16065645-16065667 CCACCGCGCCTGGCTGAAATTGG + Intergenic
1004615477 6:17283702-17283724 CCACCGCGCCTGGCCCAAAATGG + Intronic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1004623277 6:17350125-17350147 CCACCGTGCCCGGCCAGAAGAGG + Intergenic
1005326854 6:24710549-24710571 CAACCGCGCCCGGCCCAAATTGG + Intronic
1005341115 6:24844762-24844784 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005393630 6:25359192-25359214 CTTCCTTTCCTGGCCAGAATGGG - Intronic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1005700781 6:28398628-28398650 CCACTGTGCCCGGCCTAAATCGG - Intronic
1006080928 6:31566023-31566045 CCACCGTGCCTGGCTAATTTTGG - Intergenic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006451094 6:34106125-34106147 CCACCATGCCTGGCCATGATGGG - Intronic
1006559131 6:34894362-34894384 CCACTGTGCCTGGCCATGATTGG - Intronic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006660738 6:35641715-35641737 CCACCGTGCCCGGCCCAAAGGGG - Intronic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007714084 6:43844333-43844355 CCACCATGCCTGGCCTCAATAGG + Intergenic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008069753 6:47087354-47087376 CCACCGTGCCTGGACAATTTTGG + Intergenic
1008302721 6:49861594-49861616 TTACCGTGCCTGGCCGAGCTAGG - Intronic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1008866221 6:56213796-56213818 CTCCCATGCCTGGCGCAAATAGG - Intronic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009790525 6:68395656-68395678 CTCCATTGCCTGGCAAAAATAGG + Intergenic
1009887539 6:69641561-69641583 CCACCGTTCCTGGCCAGAATGGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010433128 6:75801008-75801030 CCACCGTGCCTGGCCACATGGGG + Intronic
1010604551 6:77872290-77872312 CCACTGTGCCTGGCCACAGTAGG - Intronic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011615595 6:89195171-89195193 CCACCATGCCCGGCCCAAATTGG - Intronic
1011630648 6:89320751-89320773 CCACCATGCCTGGCCTCAATAGG - Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011690271 6:89860555-89860577 CCACTGTGCCTGGCCTATATTGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1011695190 6:89906158-89906180 CCACCGTGCCCGGCCAAAGTTGG + Intergenic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012282435 6:97344570-97344592 CCACCGTGCCTGGCCTGATTTGG + Intergenic
1012469270 6:99552753-99552775 CCACTGTGCCTGGCCAGAAATGG - Intronic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013100985 6:106986638-106986660 CCACCATGCCTGGCCACACTTGG - Intergenic
1013244569 6:108274402-108274424 CCACTGCGCCTGGCCAAAGTGGG - Intergenic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1013598359 6:111681446-111681468 CCACCGTGCCTGACCTAACTTGG + Intronic
1013885317 6:114958174-114958196 CCACTGTGCTTGGCCTAAATTGG - Intergenic
1014111954 6:117628285-117628307 CCACCATGCCTGGCCTACATAGG - Intergenic
1014333122 6:120096152-120096174 CCACCGCGCCCGGCCAAAAGTGG - Intergenic
1014686491 6:124507963-124507985 CTATTGTGCCTGGCCTAATTGGG - Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015314310 6:131800686-131800708 CCACCATGCCTTGCCACAATAGG + Intergenic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1016458605 6:144258322-144258344 CCACCGAGCCTGGCCTAAATAGG - Intergenic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1017581776 6:155872705-155872727 CCACCGTGCCTGGCTAATTTTGG + Intergenic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1018904333 6:168066209-168066231 CCACCGTGCCCGGCCTAAAGTGG - Intronic
1019456934 7:1133461-1133483 CCACCGTGCCTGGCCGCACTTGG - Intronic
1019855366 7:3600833-3600855 CCACCGTGCCTGGCCAATGTAGG + Intronic
1020095691 7:5367713-5367735 CCACCGTGCCTGGCCAACCAAGG + Intronic
1020195122 7:6031884-6031906 CTACTGCGTCTGGCCAAAAAAGG - Intronic
1020390509 7:7652685-7652707 CCACAGTGCCTGGCCAATTTTGG + Intronic
1020419550 7:7986223-7986245 CCACTGTGCCTGGCCACACTAGG - Intronic
1020724917 7:11800259-11800281 CCACCGCGCCTGGCTCAAATAGG - Intronic
1020912101 7:14143632-14143654 CCACCGCGCCTGGCCAACAGTGG + Intergenic
1020954711 7:14726418-14726440 CCACCGTGCCCGGCCAGAATCGG + Intronic
1021002853 7:15355213-15355235 CCACCGTGCCCAGCCAATATTGG - Intronic
1021714844 7:23452289-23452311 CCACCGCACCTGGCCAGAATAGG + Intronic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1022255055 7:28647791-28647813 CCACTATGCCTGGCCCAAATTGG - Intronic
1022570169 7:31444868-31444890 TCACCGTGCCTGGCCAGAAATGG + Intergenic
1022598086 7:31731673-31731695 CCACTGCGCCTGGCCAGAATTGG + Intergenic
1023252763 7:38283462-38283484 CCAGCGTGCCTGGCCAATGTAGG - Intergenic
1023943854 7:44787768-44787790 CCACCGCACCTGGCCTAAATAGG - Intergenic
1024012733 7:45283890-45283912 CCACCGTGCCTGGCCTACAGTGG - Intergenic
1024334432 7:48191693-48191715 CCACCGTGCCCGGCCAAAGAGGG + Intronic
1024586327 7:50845042-50845064 CCACCGCGCCTGGCCATCATAGG - Intergenic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025622126 7:63183045-63183067 CCACCGTGCCTGTCCAAGGTAGG + Intergenic
1025638081 7:63341296-63341318 CCACTATGCCTGGCCAAGATTGG - Intergenic
1025644615 7:63406803-63406825 CCACTATGCCTGGCCAAGATTGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025790481 7:64683024-64683046 CTGCCTTGGCTGGCGAAAATTGG - Intronic
1025934747 7:66026550-66026572 CCACCGTGCCCGGCCAATGTCGG - Intergenic
1025987955 7:66472538-66472560 CCACCGTGCCTGGCCACTAATGG + Intergenic
1025994646 7:66520275-66520297 CTGCCGCGCCTGGCCACACTTGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026248895 7:68649282-68649304 CCACCGTGCCAGGCAACAATGGG + Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1026920108 7:74149208-74149230 CCACCGTGCCCAGCCAAAAGAGG + Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1027218217 7:76197760-76197782 CCACCGTGCCCAGCCAAAGTTGG - Intergenic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027465987 7:78515611-78515633 CTACAGCGCCTGGCCAAACAAGG - Intronic
1027671392 7:81104135-81104157 CCACCATGCCTGGCCATGATTGG - Intergenic
1027710565 7:81595490-81595512 CCACCGCGCCTGGCCAAATTTGG + Intergenic
1028046593 7:86128028-86128050 CCACCGTGCCTGGCCATTCTTGG + Intergenic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1028664241 7:93322310-93322332 CCACCGCGCCCGGCCTAAATTGG - Intronic
1028978743 7:96943336-96943358 GTACCGTGCCTGGCCCAAATTGG - Intergenic
1029135882 7:98370786-98370808 CCACCGCGCCTGGCCAATTTTGG + Intronic
1029231313 7:99071345-99071367 CCACCGCGCCCGGCCAAAAACGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030118696 7:106084693-106084715 CCAGCGTGCCTGGCCAGAATTGG - Intergenic
1030206442 7:106956773-106956795 CCACCATACCTGGCCAACATAGG - Intergenic
1030872837 7:114778448-114778470 CTATCGCGCCTGGCCAAAAATGG + Intergenic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1031196653 7:118623677-118623699 CCACCGTGACTGGCCCATATAGG + Intergenic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032904651 7:136350036-136350058 CCACCGTGCCTAGCCAAGGTTGG + Intergenic
1033059859 7:138095811-138095833 CCACTGCGCCTGGCCAAATTAGG + Intronic
1033130002 7:138737732-138737754 CTACCATGCCTGGCTAATTTTGG + Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033337381 7:140465208-140465230 CTACCGTGCCTGGCCTGGTTTGG - Intronic
1033349512 7:140550745-140550767 CCACCGCGCCTGGCCTCAATGGG + Intronic
1033573651 7:142658639-142658661 ATACAGTGTGTGGCCAAAATGGG - Intergenic
1033588359 7:142790921-142790943 CAACCCTGCCTGGCCAGGATTGG - Intergenic
1033787236 7:144747496-144747518 CCACCGCGCCTGGCCTAAAGTGG - Intronic
1034171151 7:149064384-149064406 CCACCGCGCCCGGCCATAATTGG + Intergenic
1034175699 7:149097984-149098006 CCACCGCGCCCGGCCAAAATGGG + Intergenic
1034261621 7:149760322-149760344 CCACCGCGCCTGGCCAACCTGGG - Intergenic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034865942 7:154642303-154642325 CCACCATGCCAGGCCAAAGTGGG - Intronic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1035349343 7:158235047-158235069 CCACCGGGCCTGGCCCAAAATGG + Intronic
1035433932 7:158843680-158843702 CCACCGTGCCCAGCCAAGATTGG + Intergenic
1035713151 8:1733843-1733865 CCACCGCGCCTGGCCCAATTAGG - Intergenic
1036206563 8:6809821-6809843 CCACCGTGCCCAGCCAGAATGGG - Exonic
1036525972 8:9535200-9535222 CCACCGCGCCCGGCCAAAATGGG - Intergenic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037322508 8:17657230-17657252 CCACCGTGCCTGGCCTATGTGGG - Intronic
1038164488 8:25072015-25072037 CCACTGTGCCTGGCCAAGGTGGG + Intergenic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038818843 8:30933522-30933544 CCACCGCGCCTGGCCCAAAGTGG + Intergenic
1039043695 8:33431257-33431279 CCACCGTGCCTGGCCAACTAGGG - Intronic
1039543837 8:38393355-38393377 CCATCGTGCCCAGCCAAAATTGG - Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039814383 8:41080158-41080180 CCACCGTGCCTGGCCGCAAGAGG - Intergenic
1039878878 8:41610937-41610959 CCACCGTGCCTGGCCACCACTGG - Intronic
1039960136 8:42239924-42239946 CCACCGTGCCTGGCCGTAAAAGG + Intergenic
1040043904 8:42941970-42941992 TCACCGTACCTGGCCAAGATTGG - Intronic
1040441474 8:47447499-47447521 CCACCGCGCCTGGCCAGAAACGG + Intronic
1040464708 8:47683837-47683859 CCACCATGCCCGGCCAAATTGGG - Intronic
1040513815 8:48118253-48118275 CTACCATGCCTGGCCAGCACTGG + Intergenic
1040870216 8:52092851-52092873 CCACCATGCCTGGCCGAGATAGG + Intergenic
1040890777 8:52314093-52314115 CCACCATTCCTGCCCAAAATGGG + Intronic
1040934411 8:52767612-52767634 CCCCCGTGCCTGGCCGATATTGG + Intergenic
1041227022 8:55711001-55711023 CCACGGTGCCTGGCCAACAGTGG - Intronic
1041922562 8:63198552-63198574 CCACCGTGCCTGGCCAAGTTGGG + Intronic
1042222526 8:66487401-66487423 CTACCGTGCCTGGCCACAGTGGG - Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042876179 8:73442065-73442087 CCACTGCGCCTGGCCTAAATGGG - Intronic
1042892734 8:73631066-73631088 CCACTGTGCCTGGCCTAGATTGG - Intronic
1043613287 8:82092569-82092591 CCACCATGCCTGGCCTGAATGGG - Intergenic
1043872319 8:85447607-85447629 CCATCGTGCCTGGCCAATACTGG - Intronic
1043882587 8:85562267-85562289 CCACGGTGCCTTGCCAAACTGGG + Intergenic
1043988396 8:86721260-86721282 CCACCGCACCTGGCCAGAATTGG + Intronic
1044112313 8:88290263-88290285 CCACCGTGCCTGGCCCAATAAGG - Intronic
1044667798 8:94648931-94648953 CCACCGTGCCCAGCCAAAAATGG - Intronic
1045229460 8:100288771-100288793 CCACCGCGCCTGGCCTATATGGG - Intronic
1045336639 8:101209960-101209982 CCACTGTGCCAGGCCAAAAAAGG + Intergenic
1045470316 8:102506578-102506600 CCACTGTGCCTGGCCAGACTGGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045632793 8:104146075-104146097 CCACCGAGCCTGGCCCAAAAGGG - Intronic
1045782284 8:105881098-105881120 CCACCGCGCCTGGCCACAAAAGG + Intergenic
1045808572 8:106194404-106194426 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1046004863 8:108466739-108466761 CCACTGCACCTGGCCAAAATTGG + Intronic
1047371264 8:124257940-124257962 CCACTGTGCCTGGCCAATGTGGG - Intergenic
1047959474 8:130000403-130000425 CCCCTGTGCCTGGCCTAAATTGG - Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049155540 8:141064153-141064175 CCACTGTGCCTGGCCCGAATTGG + Intergenic
1049186205 8:141255365-141255387 CCACCGTGCCCAGCCAAAAAGGG + Intronic
1049866268 8:144939316-144939338 CAACCGTGCCTGGCCCACAATGG - Intronic
1049914117 9:299732-299754 CCACCGCGCCCGGCCATAATGGG - Intronic
1050052102 9:1613216-1613238 CCACTATGCCTGGCCATAATGGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050557907 9:6806205-6806227 CCACCATGCCTGGCCAATTTGGG - Intronic
1050765571 9:9129235-9129257 CTACCATGCCTGGCTAATTTTGG - Intronic
1051275524 9:15394583-15394605 CCACCGTGCCTGGCCATATTGGG - Intergenic
1051444464 9:17125726-17125748 CCACCGTGCCTGGCCTCAAAGGG + Intergenic
1051741782 9:20259484-20259506 CTACCCTGCCCAGCCAAGATAGG + Intergenic
1051833314 9:21306357-21306379 CCACCGCGCCTGGCCTAATTTGG - Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052832215 9:33225238-33225260 CTACTGTGCCTGGCCATAAGAGG + Intronic
1052886254 9:33651018-33651040 ATACAGTGTGTGGCCAAAATGGG - Intergenic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053176373 9:35927721-35927743 CCACCGTGCCCGGCCCAATTTGG + Intergenic
1053301426 9:36953783-36953805 CTACTGCACCTGGCCAAGATAGG - Intronic
1053322709 9:37114412-37114434 CCACTGTGCCAGGCCAAAAGTGG + Intergenic
1053348662 9:37396771-37396793 CCACCGTGCCCAGCCACAATCGG - Intergenic
1053640031 9:40064244-40064266 CCACCGCGCCCGGCCAAATTTGG + Intergenic
1053766101 9:41401238-41401260 CCACCGCGCCCGGCCAAATTTGG - Intergenic
1053882432 9:42609768-42609790 CCACCGTGCCTGGCCAAGTGAGG - Intergenic
1053890237 9:42684534-42684556 CCACCGTGCCTGGCCAAGTGAGG + Intergenic
1054221457 9:62417236-62417258 CCACCGTGCCTGGCCAAGTGAGG - Intergenic
1054229257 9:62491937-62491959 CCACCGTGCCTGGCCAAGTGAGG + Intergenic
1054544716 9:66312391-66312413 CCACCGCGCCCGGCCAAATTTGG - Intergenic
1054781780 9:69172858-69172880 CCACCGTGCCTGGCCAGATTTGG + Intronic
1054796888 9:69310566-69310588 CCACCGTGCCTGGTCTCAATAGG + Intergenic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1055382434 9:75723872-75723894 CCACCATGCCCAGCCAAAATAGG - Intergenic
1056172362 9:83998082-83998104 CTACCATGCCCAGCCAAGATAGG + Intronic
1056557364 9:87700786-87700808 CCACCATGCCTGGCCAATTTTGG + Intronic
1056638493 9:88350433-88350455 CCACTGTGCCTGGCCACAAAAGG - Intergenic
1057009332 9:91587973-91587995 CCACTGTACCTGGCCAAAAATGG - Intronic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057078354 9:92153194-92153216 CCACCATGCCAGGCCATAATTGG + Intergenic
1057093005 9:92277193-92277215 CCACCGTGCCTGGCCAAGCTGGG - Intronic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057454436 9:95194910-95194932 CCACCAAGCCTGGCCAAACTAGG - Intronic
1057544010 9:96002719-96002741 CCACTGTGCCTGGCCTAATTTGG + Intronic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057890014 9:98862901-98862923 CCACCGTGCCTGGCCACCAACGG + Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058313587 9:103535949-103535971 CCACCGCGCCTGGCCGCAATGGG - Intergenic
1058680115 9:107433482-107433504 CCACCGTGCCCGGCCAAGAGTGG - Intergenic
1059050612 9:110920833-110920855 CCACTGTGCCTGGCCACATTTGG - Intronic
1059073014 9:111159452-111159474 CTACTGTGCCAGGCCAACATAGG - Intergenic
1059134381 9:111790831-111790853 CCACCGTGCCCAGCCAAAAGTGG + Intronic
1059207443 9:112479986-112480008 CCACCGTGCCCGGCCAACATGGG + Intronic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1060121612 9:120996104-120996126 CCACTGTGCCTGGCCAGAAGTGG + Intronic
1060123398 9:121018284-121018306 CCACCGTGCCCAGCCAAAATTGG - Intronic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060299133 9:122363872-122363894 CCCCCGTGCCTGGCCAACGTAGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060460332 9:123847127-123847149 CCACTGTGCCTGGCCATAAATGG + Intronic
1060471550 9:123952319-123952341 CCACCGTGCCTGGCCTACTTAGG + Intergenic
1060710491 9:125858911-125858933 CCACCGCGCCTGGCCAACTTTGG + Intronic
1060730326 9:126033126-126033148 CCACCGTGCCAGGCCAACCTTGG + Intergenic
1060732135 9:126045486-126045508 CCACCGTGCCTGGCCACAGATGG - Intergenic
1060733293 9:126051091-126051113 CCACCGCACCTGGCCAAAATGGG - Intergenic
1060847054 9:126845802-126845824 CCACCGTGCCCGGCCTAACTGGG + Intergenic
1061274865 9:129564157-129564179 CCACCGTGCCTGGCCTAGTTAGG - Intergenic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061501168 9:131003188-131003210 CCACCGTGCCCGGCCGAGATGGG - Intergenic
1061567945 9:131456342-131456364 CCACCGTGCCTGGCCATTGTGGG - Intronic
1061982373 9:134113578-134113600 CCACCGCGCCCGGCCAAAAGTGG + Intergenic
1062472134 9:136710910-136710932 CCACCGTGCCTGGCCACACCAGG - Intergenic
1185498924 X:583192-583214 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1186327260 X:8493279-8493301 CCACCGTGCCCGGCCAAGATAGG + Intergenic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1186647943 X:11527324-11527346 CCACTGTGCCTGGCAACAATTGG - Intronic
1186865121 X:13712953-13712975 CCACCGTGCCCGGCCCAGATAGG - Intronic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187387005 X:18858046-18858068 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1187587458 X:20679268-20679290 CCACCATGCCTGGCCTCAATTGG + Intergenic
1187895852 X:23978840-23978862 CCACCGTGCCCGGCCAGAGTTGG - Intergenic
1188008255 X:25032714-25032736 CCACCGCGCCTGGCCTAACTTGG + Intergenic
1188033654 X:25292589-25292611 CCACCGTGCCTGGCCTTAAATGG + Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1188378005 X:29456720-29456742 CTCCCTTTCCTAGCCAAAATGGG - Intronic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1189295668 X:39915793-39915815 CCACCGCGCCTGGCCAACATAGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189841277 X:45081217-45081239 CTACCGTGCCCTGCCAGCATGGG + Intronic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1190769985 X:53506143-53506165 CTACCTTGCCTGGCAAGAATAGG - Intergenic
1192017021 X:67342078-67342100 CCACCGCACCTGGCCATAATTGG + Intergenic
1192120906 X:68454800-68454822 CCACCGAGCCTGGCCTAAAAAGG + Intergenic
1192989344 X:76431929-76431951 CCACCGTGCCCAGCCAAGATGGG + Intergenic
1193593166 X:83414684-83414706 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1194213634 X:91100060-91100082 CCACCGTGCCTGGCCATATTTGG + Intergenic
1194345292 X:92756282-92756304 CCACCGTGCTGGGCCAACATTGG - Intergenic
1194587096 X:95748708-95748730 CCACCGTGCCTGGCCCCAAATGG + Intergenic
1194659486 X:96614130-96614152 CCACCGTGCCTGGCCAGTAGTGG - Intergenic
1195081818 X:101378369-101378391 CCACCGTGCCTGGCCAGTAAAGG + Intronic
1195413119 X:104590330-104590352 CCACTGTGCCTGGCCTAAGTTGG + Intronic
1195873809 X:109516840-109516862 CCACCGCGCCTGGCCAACATAGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197974808 X:132155467-132155489 CCACCATGCCTGGCCAATTTAGG + Intergenic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198385920 X:136129345-136129367 CCTCTGTGCCTGGCCAAATTTGG - Intergenic
1198456148 X:136819839-136819861 CCACCGTGCCTGGCCTATCTTGG + Intergenic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198711626 X:139510335-139510357 CCACAGTGCCTGGCCATATTGGG - Intergenic
1198745501 X:139886301-139886323 CCACCGCGCCTGGCCACAACTGG - Intronic
1199588973 X:149448060-149448082 CCACCGTGCCTGGCCTCAGTAGG + Intergenic
1200113238 X:153754820-153754842 CCACCGAGCCTGGCCTAATTTGG - Intergenic
1201265723 Y:12204730-12204752 CTGCCATGCCTGGATAAAATTGG - Intergenic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1202023698 Y:20496096-20496118 CTACTGTGCCTGTCCTAAATAGG - Intergenic
1202262176 Y:22981415-22981437 CCACAGTGCCTGGCCAGAGTTGG + Intronic
1202415166 Y:24615156-24615178 CCACAGTGCCTGGCCAGAGTTGG + Intronic
1202455621 Y:25054930-25054952 CCACAGTGCCTGGCCAGAGTTGG - Intronic
1202575956 Y:26324995-26325017 CTACCATACCTGGCCAAGAAGGG + Intergenic