ID: 923737345

View in Genome Browser
Species Human (GRCh38)
Location 1:236623291-236623313
Sequence CTGGAGGCTCTCAGTTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923737345_923737350 16 Left 923737345 1:236623291-236623313 CCATCAAAACTGAGAGCCTCCAG No data
Right 923737350 1:236623330-236623352 GTCTTTCAGCCCTCTCATCAGGG No data
923737345_923737349 15 Left 923737345 1:236623291-236623313 CCATCAAAACTGAGAGCCTCCAG No data
Right 923737349 1:236623329-236623351 TGTCTTTCAGCCCTCTCATCAGG No data
923737345_923737353 30 Left 923737345 1:236623291-236623313 CCATCAAAACTGAGAGCCTCCAG No data
Right 923737353 1:236623344-236623366 TCATCAGGGACCTACAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923737345 Original CRISPR CTGGAGGCTCTCAGTTTTGA TGG (reversed) Intergenic
No off target data available for this crispr