ID: 923737661

View in Genome Browser
Species Human (GRCh38)
Location 1:236626601-236626623
Sequence ACTGATATGCAGAATATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923737659_923737661 22 Left 923737659 1:236626556-236626578 CCACGATACCAAATTAGCACAGC No data
Right 923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG No data
923737660_923737661 14 Left 923737660 1:236626564-236626586 CCAAATTAGCACAGCTGACATGT No data
Right 923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923737661 Original CRISPR ACTGATATGCAGAATATTTA AGG Intergenic
No off target data available for this crispr