ID: 923737661 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:236626601-236626623 |
| Sequence | ACTGATATGCAGAATATTTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923737659_923737661 | 22 | Left | 923737659 | 1:236626556-236626578 | CCACGATACCAAATTAGCACAGC | No data | ||
| Right | 923737661 | 1:236626601-236626623 | ACTGATATGCAGAATATTTAAGG | No data | ||||
| 923737660_923737661 | 14 | Left | 923737660 | 1:236626564-236626586 | CCAAATTAGCACAGCTGACATGT | No data | ||
| Right | 923737661 | 1:236626601-236626623 | ACTGATATGCAGAATATTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923737661 | Original CRISPR | ACTGATATGCAGAATATTTA AGG | Intergenic | ||
| No off target data available for this crispr | |||||