ID: 923744360

View in Genome Browser
Species Human (GRCh38)
Location 1:236686638-236686660
Sequence CTCGCGCCCCGCCGCAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 390}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923744350_923744360 20 Left 923744350 1:236686595-236686617 CCTCCGTGGGTCCGTTTGCCAGT 0: 1
1: 0
2: 0
3: 3
4: 33
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744347_923744360 27 Left 923744347 1:236686588-236686610 CCCGCCGCCTCCGTGGGTCCGTT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744352_923744360 9 Left 923744352 1:236686606-236686628 CCGTTTGCCAGTCAGCCCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744355_923744360 -7 Left 923744355 1:236686622-236686644 CCGTGCGTCCGAGCCCCTCGCGC 0: 1
1: 0
2: 1
3: 8
4: 108
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744351_923744360 17 Left 923744351 1:236686598-236686620 CCGTGGGTCCGTTTGCCAGTCAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744346_923744360 30 Left 923744346 1:236686585-236686607 CCGCCCGCCGCCTCCGTGGGTCC 0: 1
1: 0
2: 0
3: 53
4: 451
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744349_923744360 23 Left 923744349 1:236686592-236686614 CCGCCTCCGTGGGTCCGTTTGCC 0: 1
1: 0
2: 0
3: 2
4: 128
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744353_923744360 2 Left 923744353 1:236686613-236686635 CCAGTCAGCCCGTGCGTCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744354_923744360 -6 Left 923744354 1:236686621-236686643 CCCGTGCGTCCGAGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390
923744348_923744360 26 Left 923744348 1:236686589-236686611 CCGCCGCCTCCGTGGGTCCGTTT 0: 1
1: 0
2: 0
3: 28
4: 127
Right 923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923744360 Original CRISPR CTCGCGCCCCGCCGCAGCCC CGG Exonic
900031700 1:377388-377410 CACGCTCCCCGACCCAGCCCCGG - Intergenic
900226364 1:1535221-1535243 CTCCCGGCCGGCCACAGCCCCGG + Exonic
900414008 1:2526778-2526800 CGCCCGCCCGCCCGCAGCCCCGG - Intergenic
900629327 1:3625286-3625308 CTCGGCCCCCGCCCCGGCCCTGG - Intronic
901198557 1:7453872-7453894 CCGGCCCCCCGCAGCAGCCCGGG + Intronic
901433995 1:9235079-9235101 CGCCGGCCCCGCCGCCGCCCCGG + Intronic
901434013 1:9235117-9235139 CTCGGGCCCGGCGGCAGCGCGGG - Intronic
903514779 1:23902974-23902996 CTCGCGCCGCGCCGGGGCCTCGG + Intronic
903573259 1:24321896-24321918 CTTGCGCCCTGCGGTAGCCCGGG - Intronic
903652442 1:24930152-24930174 CGCGGGCCCCGCCGCGGCCCAGG - Intronic
903969113 1:27107618-27107640 CCCCCACCCCGCCCCAGCCCTGG + Intronic
904384332 1:30131672-30131694 ATCCCGCCCTGCAGCAGCCCAGG - Intergenic
904500113 1:30908509-30908531 CCCGGGCCCGGCCGCGGCCCCGG + Exonic
904608582 1:31712734-31712756 CTCCTGCCCAGCCCCAGCCCAGG - Intergenic
904699863 1:32351763-32351785 CCCGCCGCCCGCCGCAGCCTGGG - Intronic
905639107 1:39576478-39576500 CCCGCGCCCCGCGCCTGCCCCGG - Intronic
907160967 1:52368627-52368649 CGCGCCCCCCGCCGCGGCTCGGG + Intergenic
907237732 1:53063082-53063104 CTCGTCCCCCGCCCCAGGCCGGG - Intronic
910251464 1:85201802-85201824 CGCGCGCCCCGTCGCGGCCCGGG - Intergenic
912879131 1:113390958-113390980 CTCCGGCCCCGTCTCAGCCCGGG - Exonic
912911166 1:113759976-113759998 CTCCCGCCCCTCAGCAGCTCTGG + Intergenic
914753144 1:150549300-150549322 CCCGCGCCCCTCGGCGGCCCCGG - Intergenic
915936410 1:160092575-160092597 CTGGCGGCCAGCCGCAGTCCTGG + Exonic
916694449 1:167221481-167221503 CTCCGGCCCCGCCGCCTCCCCGG - Intronic
919712040 1:200738764-200738786 CTCGCTCCCCGCCCGCGCCCGGG - Intergenic
919826483 1:201506971-201506993 TGCCAGCCCCGCCGCAGCCCCGG - Intronic
922440682 1:225653141-225653163 CGCGCGCCCCGCCTCCTCCCGGG - Exonic
922744866 1:228038100-228038122 CCCGCGCCCCACCGCGGCCACGG - Intronic
922766243 1:228158092-228158114 CGCGCCCTCCGCCGCCGCCCGGG + Exonic
922792708 1:228318927-228318949 CTTGCCCCCCGAGGCAGCCCAGG + Exonic
922925481 1:229343331-229343353 GTCGCCCCCGGCCGCAGCCTGGG - Intergenic
922958494 1:229625648-229625670 CACGCCGCCGGCCGCAGCCCGGG + Intronic
923126682 1:231039986-231040008 CCCGGGCCCCGCCGCCGCCCGGG + Exonic
923299672 1:232629939-232629961 CTCGCCGCCCGCCGCTGCCCGGG + Intergenic
923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG + Exonic
924198943 1:241640139-241640161 CCCGCGCCCCTCTTCAGCCCCGG - Exonic
924524733 1:244835761-244835783 CGCGCGCCCCGCCGACCCCCAGG - Intronic
924527237 1:244863612-244863634 CTCACCCGCCGCCGGAGCCCCGG + Exonic
924539794 1:244970474-244970496 CTCGCCGCCCGCCGCGACCCCGG + Exonic
1063418204 10:5890185-5890207 GCTCCGCCCCGCCGCAGCCCCGG - Intronic
1063547986 10:7000766-7000788 CTAGCGCCCCCCAGCAGCACAGG - Intergenic
1063664087 10:8051482-8051504 CTTGCGCCCTGCAGAAGCCCCGG + Intergenic
1064067544 10:12195641-12195663 CGCGTGCCCAGCCGCAGCCTGGG + Intronic
1064859827 10:19815754-19815776 ATCGCGCCCCGCCCCGACCCTGG - Intergenic
1067099274 10:43322905-43322927 GTCTGGCCCCGCCCCAGCCCAGG - Intergenic
1067474470 10:46556753-46556775 CCACCGCCCCGCCGCGGCCCGGG + Intergenic
1070566130 10:77605140-77605162 ACCGCGCCCAGCCGCAGCCCAGG + Intronic
1070599118 10:77853579-77853601 CTCACACCCCGCCCCACCCCAGG + Intronic
1072994278 10:100229498-100229520 CCCGCGCCCGGCCGCAGCCCCGG + Exonic
1073403445 10:103277083-103277105 CCAGCGCGCCGCCCCAGCCCCGG + Intergenic
1073466434 10:103697007-103697029 CTCCCACCCCGCCCCATCCCCGG + Intronic
1075040483 10:119103934-119103956 CTCCCGCCCCGCCCCATCACAGG - Intergenic
1075334409 10:121598123-121598145 CCCGCGCTCCTCCGCAGCCTGGG - Exonic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1075999802 10:126905602-126905624 CACCCGCCCCGCCGGAGCCTGGG - Intronic
1076372536 10:129964530-129964552 CTCGCGTCCAGCCGCGGCCAAGG + Intergenic
1076683744 10:132187527-132187549 CCCGCGCCCCGGACCAGCCCGGG - Intronic
1076853293 10:133103471-133103493 CTCGCCCTCCCCCGCCGCCCCGG + Intronic
1076878799 10:133230265-133230287 CGCGCGCCGCGCCCCAGCCCCGG + Exonic
1076879069 10:133231125-133231147 CGCGCGCCCGTCCGCGGCCCCGG + Exonic
1077008448 11:369720-369742 CCCGCCCCGCGCCGCATCCCCGG - Intergenic
1077143520 11:1035105-1035127 CTCCCGGCCCACCGCGGCCCAGG + Intronic
1077233148 11:1467670-1467692 CTCGCCCCCAGCTGCAGCCATGG - Intergenic
1077240907 11:1510070-1510092 CCGGGTCCCCGCCGCAGCCCTGG - Intergenic
1077241076 11:1510487-1510509 CCCGGGTCCCCCCGCAGCCCTGG - Intergenic
1077241089 11:1510519-1510541 CCCGGGTCCCCCCGCAGCCCTGG - Intergenic
1077360962 11:2139886-2139908 TGCGCGCCCCGCCCGAGCCCAGG - Intronic
1077495791 11:2885964-2885986 CGCGCGCCCCGCCCCGCCCCCGG - Intergenic
1078164564 11:8871072-8871094 CTGCAGCCCGGCCGCAGCCCGGG - Intronic
1079035306 11:17014740-17014762 CGCGCGCCCCGAAGCTGCCCAGG - Intergenic
1080012328 11:27472003-27472025 ACCCCGCCCCGCCGCCGCCCGGG - Intronic
1080503691 11:32892917-32892939 CTCGCCGCCCGCCGCGGCCCGGG + Intergenic
1081549092 11:44095867-44095889 CGCCCGCCCGGCCGCCGCCCTGG - Intronic
1081938139 11:46918596-46918618 CGCCCCCCGCGCCGCAGCCCCGG + Exonic
1082986154 11:59172566-59172588 GCCGCGCAGCGCCGCAGCCCCGG + Exonic
1083920995 11:65781301-65781323 CGCGCCCCCCGCCGGCGCCCGGG + Intergenic
1083940021 11:65890736-65890758 CCCGCCCGCCGCCGCGGCCCAGG - Exonic
1084188992 11:67490471-67490493 CTCGCAGCCCCCGGCAGCCCAGG - Intronic
1084621107 11:70270780-70270802 CCCGCCCCACGCCGCGGCCCCGG - Exonic
1084937735 11:72596009-72596031 CTTCCGCCCAGCCTCAGCCCTGG + Intronic
1085044004 11:73343091-73343113 CCCCCGCCCCGCCGCCACCCCGG + Intronic
1085318764 11:75562019-75562041 CTCCCGGCGCCCCGCAGCCCGGG + Intergenic
1085524484 11:77156511-77156533 CTTGAGCCCTGCCCCAGCCCTGG + Intronic
1086322443 11:85664747-85664769 CTCCTCCCCCGCTGCAGCCCGGG + Exonic
1087175127 11:95089482-95089504 CGCGCGCCCCACGGCCGCCCTGG - Intergenic
1087832183 11:102831537-102831559 CTGGCGCCCCTCCGCGGCCACGG - Intergenic
1088607221 11:111543077-111543099 CTAGCTCCCCGCTGCACCCCAGG - Intronic
1089993414 11:122882871-122882893 CGCCCGCCCCGGCGCTGCCCTGG - Exonic
1091588262 12:1828152-1828174 CTGGCGCCGGGCAGCAGCCCTGG + Exonic
1091973727 12:4809409-4809431 CTCGGGCGCCGGGGCAGCCCCGG + Exonic
1092143582 12:6200229-6200251 CCCGCCCCCCGCCCCCGCCCAGG - Intronic
1092502293 12:9060309-9060331 ATCGCACCCGGCCCCAGCCCTGG + Intergenic
1092727617 12:11500416-11500438 CGCGCTCCCCACCGCCGCCCAGG + Intronic
1092906099 12:13101557-13101579 CTAGCGCCCCGGCCCAGCTCCGG - Intronic
1093547654 12:20368132-20368154 CGCGCAGCCCACCGCAGCCCCGG - Intergenic
1096214234 12:49790910-49790932 CTCGCGCCGTGCCCAAGCCCTGG + Intergenic
1096529255 12:52233088-52233110 CGCCCGCCCCGCCGAAGCCCAGG - Intronic
1096668223 12:53181018-53181040 CGCGCGTCCCGCCGCGTCCCCGG + Intronic
1096716119 12:53492770-53492792 CTCCCACTCCGCCGCAACCCCGG + Intronic
1096777626 12:53973813-53973835 CTCGGCACCCGCCTCAGCCCGGG - Exonic
1096781417 12:53994415-53994437 CTCGCCGCCGGCCACAGCCCGGG - Intronic
1100309232 12:93378486-93378508 CTCGCTCCCCGCCCCTGCGCAGG + Intronic
1100329826 12:93572165-93572187 CTCCCGCACCTCCGCACCCCGGG + Exonic
1100581250 12:95942694-95942716 CTCGCGGCCCTCCGCGTCCCGGG + Exonic
1101482156 12:105108147-105108169 GGCGCGCCCCGCCCAAGCCCCGG - Intronic
1101910512 12:108857493-108857515 CTCGCACCGCGCCGCAGCCATGG - Exonic
1103764616 12:123271492-123271514 CGCGCGCCCGGCCCCGGCCCGGG - Intronic
1103779361 12:123389022-123389044 CCCGCGCACCGCGGCAGCCCCGG - Intronic
1103800419 12:123533964-123533986 CGCGCGCCCCGCCCCAATCCCGG + Intergenic
1103990757 12:124797760-124797782 CTCGGCCCCGGCCCCAGCCCTGG - Intronic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1104857714 12:131909726-131909748 GTCCCGCTCGGCCGCAGCCCTGG + Intronic
1104860166 12:131919395-131919417 CACCCGCCCCACCCCAGCCCTGG - Intronic
1104860287 12:131919861-131919883 CTCCCTCCCTGCCACAGCCCTGG - Intronic
1104961523 12:132490429-132490451 CCCGCCGCCCGCCGCCGCCCAGG + Exonic
1104975608 12:132550672-132550694 CTCTCGCTCCGCTGCAGCCCAGG - Intronic
1104981417 12:132574574-132574596 CAAGCGCCCTGCCCCAGCCCAGG - Intronic
1104983225 12:132583078-132583100 CTCGCGCTCCGCGGGGGCCCCGG - Exonic
1105217450 13:18297508-18297530 CCCGCGCACCGCGGCAGCCCCGG - Intergenic
1105699577 13:22926355-22926377 CACCCGCCCCGCCCCGGCCCAGG - Intergenic
1106036899 13:26051704-26051726 CGCGCCCCCAGCCGCAGTCCCGG + Intergenic
1108364148 13:49693133-49693155 CTCCCGCCCCGCCCCACCCCTGG - Intergenic
1111975928 13:94967693-94967715 CACGGGCGCCGCCGCAGACCCGG + Intergenic
1113660766 13:112105132-112105154 CTCGCGCCCTGCCGAGGCCTCGG + Intergenic
1115592279 14:34875224-34875246 CTCCGGCCCCGCCGCGCCCCTGG + Exonic
1118220685 14:63852844-63852866 AGCAGGCCCCGCCGCAGCCCGGG - Intergenic
1119262540 14:73245994-73246016 CTCCCGCCCCGCCCGAGCCCAGG - Intronic
1119743537 14:77028569-77028591 CTCGCGCGGCGCCTCGGCCCGGG + Exonic
1121127471 14:91417517-91417539 CTCGCGCCCCGGAGCCACCCGGG + Intronic
1122719653 14:103715224-103715246 CGGGAGCCCCGCCGCAGCTCGGG - Intronic
1122993246 14:105248790-105248812 CTCGCGCCGCGCCGGGGCCTCGG - Exonic
1123105789 14:105840503-105840525 CACGCCCCCCTCCACAGCCCAGG - Intergenic
1123110504 14:105864892-105864914 CCAGCGCCCAGCCCCAGCCCAGG + Intergenic
1202930251 14_KI270725v1_random:28686-28708 CTCTGGCCCTGCCCCAGCCCTGG + Intergenic
1123630800 15:22258321-22258343 CCCGCGCCGCGCCGCGCCCCGGG - Intergenic
1123710073 15:22980448-22980470 CTCCCTCCCGGCCGCGGCCCCGG + Intronic
1124626654 15:31311695-31311717 CTCTCACCCTGCTGCAGCCCCGG + Intergenic
1126163510 15:45634916-45634938 CCCGCCCGGCGCCGCAGCCCAGG - Exonic
1126344587 15:47679516-47679538 CTCTGGCCCCTCGGCAGCCCTGG + Intronic
1126724976 15:51622728-51622750 CTCGACCGCCGCCGCCGCCCGGG + Intronic
1126837080 15:52678783-52678805 CTTCCGTCCCGCCGCGGCCCCGG + Intronic
1128139074 15:65286379-65286401 GTCGCGGCCCGCCGCCTCCCTGG + Exonic
1128675041 15:69602440-69602462 CTCATGCCTCGCCCCAGCCCAGG + Intergenic
1129539305 15:76338042-76338064 CGCGCGCCCCGGCCCTGCCCAGG + Intronic
1129710651 15:77818970-77818992 CTCCCGGCCCGCCGCGCCCCAGG + Intronic
1129777532 15:78246480-78246502 CAAGCGCCTCGCCGTAGCCCCGG + Intergenic
1131060088 15:89399392-89399414 CACTCGCCCCCCAGCAGCCCGGG + Intergenic
1131261350 15:90889655-90889677 TGGGAGCCCCGCCGCAGCCCAGG - Intronic
1131268957 15:90935159-90935181 CAAGCGCCCCGCCCCTGCCCGGG + Intronic
1131526748 15:93158774-93158796 CCCCCGCCCTGCCCCAGCCCTGG - Intergenic
1132111467 15:99105093-99105115 CTCCGGCCTCGCCGCTGCCCCGG - Exonic
1132163630 15:99565322-99565344 CTCGCGCCCCGCCCCCGCCCCGG + Intergenic
1132685056 16:1158783-1158805 CTCCTGCCCCGCCGCACCCCCGG + Intronic
1134419402 16:14071588-14071610 CTCGCGCCCGGGCGCGACCCCGG + Intronic
1135016511 16:18928275-18928297 CTCCCTACCCTCCGCAGCCCAGG - Intergenic
1136333628 16:29597255-29597277 CTCCCTACCCTCCGCAGCCCAGG - Intergenic
1136554774 16:31001378-31001400 CCACCGCCCAGCCGCAGCCCCGG - Intronic
1136586714 16:31191021-31191043 CACGGTCCCCGCCGCGGCCCCGG - Exonic
1138289248 16:55832883-55832905 GTCGTGCCCCGCCGCAGAGCCGG + Intronic
1139489596 16:67279300-67279322 GCCCCGCCCCGCCGCACCCCCGG - Exonic
1139496931 16:67326762-67326784 CGCGCGCGCCGCCGCGACCCCGG - Exonic
1139615358 16:68085357-68085379 CTCGCGCCCTGCCGCGCGCCCGG - Intronic
1141620848 16:85235879-85235901 CCCGCGCCCCGCCCCCGCGCTGG + Intergenic
1141972242 16:87492246-87492268 CCCGCGCCGCGCCGCGACCCGGG + Intergenic
1142251309 16:88993277-88993299 CTCCTGCCCAGCTGCAGCCCGGG - Intergenic
1142395377 16:89828685-89828707 CCCGCAGCCCGCGGCAGCCCTGG - Exonic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1142638165 17:1270527-1270549 CTCGCCCTCTGCCCCAGCCCCGG - Intergenic
1142672021 17:1491754-1491776 GCCCCGCCCCGCCTCAGCCCCGG + Intronic
1143596272 17:7916086-7916108 CGCGCGCCCCGCCGCCTGCCCGG - Intergenic
1143632454 17:8146910-8146932 CTCGGGCCCGGCCTCAGTCCCGG - Exonic
1144656927 17:17042726-17042748 CGCCGGCCCCGCCGCAGGCCCGG - Intronic
1145217315 17:21061724-21061746 CTCGCTCCCCACCACATCCCGGG - Intergenic
1145889754 17:28406138-28406160 CGCGCGCCCCGCCGCCCGCCTGG - Exonic
1146095835 17:29929830-29929852 CACGCGCCGCGCCGCTTCCCAGG - Intronic
1146398483 17:32486699-32486721 CGCGTGTCCCGCCGCAGCCGCGG + Exonic
1146403697 17:32519597-32519619 CTTGCAGCCCCCCGCAGCCCCGG + Intronic
1147184387 17:38705593-38705615 CCGGCCCCCCGCCCCAGCCCCGG + Exonic
1147312685 17:39604560-39604582 CTCGCGGCCCGGCCCGGCCCCGG - Intronic
1147312937 17:39605810-39605832 CGTGCGCCGCGCCGCCGCCCAGG + Exonic
1147620727 17:41865058-41865080 CTCCAGCCCCGCCGAAGCACAGG + Exonic
1147792409 17:43021843-43021865 CTCCCGCCCTGCCACACCCCCGG + Intronic
1147987506 17:44315020-44315042 CCCCCGCCCCGCCGCAGTCATGG - Intronic
1148183110 17:45620683-45620705 CGCGCCCCCGGCCGCGGCCCCGG - Intergenic
1148265741 17:46225008-46225030 CGCGCCCCCGGCCGCGGCCCCGG + Intronic
1148370972 17:47099941-47099963 CGCGCCCCCGGCCGCGGCCCCGG + Intergenic
1148759696 17:49993361-49993383 CCCGCGCGCCCCCGCGGCCCTGG + Intronic
1149430669 17:56593933-56593955 CCCGCGCCCCGCGGTCGCCCTGG + Exonic
1150069258 17:62138196-62138218 CCCGCGCCACGTCGCTGCCCAGG + Intergenic
1150108559 17:62479015-62479037 CGCGCCCCCCGCGGCCGCCCGGG + Exonic
1152356513 17:79810170-79810192 CGCTCGCCCGGCCGCGGCCCCGG - Intergenic
1152697326 17:81803782-81803804 CGCGCGCCCCTCCGCGTCCCAGG + Intergenic
1152716245 17:81902169-81902191 CTCCCGGCCCTCCGCAGCCTCGG + Exonic
1152751788 17:82065691-82065713 CTCCGGCCTCGCCGCCGCCCGGG + Intronic
1152753696 17:82078174-82078196 CTCACTCCCCGGCCCAGCCCCGG + Intergenic
1155297399 18:24397815-24397837 CTCGCGCTCCGCCGTGGTCCCGG - Exonic
1157222740 18:45839074-45839096 CGCGCTGCCCGCCGCCGCCCAGG + Exonic
1157260935 18:46174697-46174719 GTCGCTTCCCCCCGCAGCCCGGG - Intronic
1157674977 18:49562126-49562148 CTCGCTCCCTGCCACCGCCCGGG + Exonic
1158266405 18:55664909-55664931 CAAGCGCGCCCCCGCAGCCCCGG - Intergenic
1158478787 18:57803080-57803102 CGCCCGCCCGGCCCCAGCCCTGG + Exonic
1160256206 18:77250511-77250533 CGCGCGCCCCGCCGCTCGCCGGG + Intergenic
1160594509 18:79964583-79964605 CTCCGGCCCCGCCTCCGCCCTGG + Exonic
1160726868 19:621231-621253 CCCGCGCCACGTCGCTGCCCAGG + Exonic
1160747998 19:720517-720539 CTCTCGCCCCTCCCCAGACCCGG - Intronic
1160763712 19:797985-798007 CTCTGCCCCCGGCGCAGCCCCGG + Intronic
1160909877 19:1469485-1469507 CCCGCGGCCCGACCCAGCCCTGG + Exonic
1160930292 19:1567109-1567131 CCCCCGCCCGGCCGGAGCCCCGG + Intronic
1160944793 19:1636651-1636673 CTCGCGCACTGCAGCCGCCCTGG + Intronic
1160991857 19:1863374-1863396 CGCGGGCCCCGCCGCCGGCCTGG - Exonic
1161048853 19:2151461-2151483 CTTGGACCCCGCCGCCGCCCTGG - Exonic
1161150079 19:2702805-2702827 CCCGCGCCCCGCCCCCGCTCCGG - Intergenic
1161208257 19:3053493-3053515 CTCGCGAAGCGCAGCAGCCCCGG - Exonic
1161210531 19:3062971-3062993 CCCCCGCCCCGCCCCACCCCAGG - Exonic
1161476909 19:4491276-4491298 CACCCCCCCCGGCGCAGCCCTGG + Intronic
1161574877 19:5049645-5049667 CTGGGGCCCCGCCTCAGCCCTGG - Intronic
1161779166 19:6279787-6279809 CTGGCGCCCCGCCCCGCCCCCGG + Exonic
1161797166 19:6393749-6393771 GTCGCGCCCCGACCCCGCCCAGG - Intronic
1162046819 19:8005515-8005537 CGCCCGCCCCGGAGCAGCCCCGG - Exonic
1162402171 19:10453076-10453098 CGCGCTCCCAGCAGCAGCCCTGG - Intronic
1162959478 19:14117574-14117596 CACCCGCCGCGCCGCAGCTCCGG - Exonic
1163002385 19:14376213-14376235 CTGACCCCCCGCCTCAGCCCAGG + Intergenic
1163157875 19:15449248-15449270 CTGGCGCCCCGGCCCCGCCCCGG - Intronic
1163708621 19:18832368-18832390 CTCCCGCGCCGCCACCGCCCGGG - Exonic
1163845818 19:19637620-19637642 CTCAAGCCCCGCCCCAGCTCTGG - Intronic
1165160207 19:33811570-33811592 CCCCCTCCCCGCCGCACCCCCGG + Intronic
1165255974 19:34577501-34577523 CCCGGGCCGCGCTGCAGCCCCGG - Intergenic
1165349484 19:35268404-35268426 CTCGCGCCCCGCGGAGCCCCGGG + Intergenic
1165422627 19:35729913-35729935 CTGGCGCCCAGCCCCAGCCCTGG + Intronic
1166039045 19:40191430-40191452 CTCGGGCCCCGCCGGTGGCCCGG + Intergenic
1166100848 19:40570600-40570622 CTCGCGCTCCGCCCCGGCCCAGG + Exonic
1166857986 19:45792708-45792730 CTCGGGCCCCGGCGCCGCCATGG - Exonic
1167074984 19:47243219-47243241 CTCGGCCCGCGCCGCAGCCGCGG + Intergenic
1167159265 19:47756616-47756638 CCCTCGCCCCACAGCAGCCCCGG - Intronic
1167648913 19:50719341-50719363 CTCGCCCCCTCCCGCGGCCCCGG + Intronic
1168064045 19:53909389-53909411 CGCGCCCCCCGCCCCCGCCCCGG - Exonic
1168702822 19:58451806-58451828 CTCCCGCCCCGCGGAAGCCCAGG + Intronic
926035108 2:9630466-9630488 CTCGCCCTCCGCCCCGGCCCCGG - Exonic
926293674 2:11551730-11551752 CGCTCCCACCGCCGCAGCCCGGG + Intronic
927125994 2:20012709-20012731 CTCGGGCCCCGCCCCGCCCCGGG + Intergenic
927714279 2:25342100-25342122 CTCGCCCCCCGCGGCCGCGCTGG + Intronic
927787130 2:25981941-25981963 CCCGAGCCCCTCCGCAGCCTGGG + Exonic
932316939 2:70790697-70790719 CCCCCGCCCCGCCCCCGCCCGGG - Intergenic
932624055 2:73284265-73284287 CTCGTTCCCCTCCGCAGCCTTGG + Exonic
932765211 2:74464971-74464993 CTCCAGCCCCGCCGTGGCCCCGG - Exonic
933751262 2:85603133-85603155 CTCTGGACCCACCGCAGCCCTGG - Intronic
935112379 2:100105024-100105046 CGCCCGCCCCTCAGCAGCCCTGG + Intronic
937283480 2:120736045-120736067 CGCGCGGCGCGCCGCAGCCTCGG + Intronic
938299205 2:130198320-130198342 CTCCCGCCCCGCAGATGCCCAGG - Intronic
938457516 2:131476218-131476240 CTCCCGCCCCGCAGATGCCCAGG + Intronic
940129250 2:150362792-150362814 CACTCTCACCGCCGCAGCCCGGG + Intergenic
940774911 2:157875796-157875818 CTCGGGTCCCGCCGCGGCCGGGG + Intronic
942278243 2:174337652-174337674 CTCGCGCCCAGCCCGGGCCCTGG - Exonic
942463818 2:176188443-176188465 CTCTCGCCCCGCCCTTGCCCAGG + Intergenic
944154283 2:196593724-196593746 CTCAGGCTCCGCCGCAGCCTCGG - Intergenic
944540009 2:200745776-200745798 CTCGCTCCCAGGCTCAGCCCCGG + Intergenic
946311271 2:218883738-218883760 CTCCCGCCCCACCGCCGCCCGGG + Intronic
946747559 2:222861169-222861191 CACGCCCCGCGCCGCCGCCCGGG - Exonic
948202854 2:236142360-236142382 CCCTCGCCCCGCCCCCGCCCCGG + Intergenic
948216585 2:236237417-236237439 CTCGCCCCGCGCCCCGGCCCCGG - Intronic
1169858853 20:10131438-10131460 CTCGGGCCCCACCCCAGACCTGG + Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171780084 20:29410322-29410344 GTCCCGCCCCGCCCCAACCCCGG + Intergenic
1172146620 20:32762320-32762342 CTCTTGCCCCGCCCCCGCCCGGG - Intergenic
1172688276 20:36773532-36773554 AGCTCGACCCGCCGCAGCCCCGG - Exonic
1173322258 20:41998695-41998717 CCTGCGCGGCGCCGCAGCCCTGG + Intergenic
1174196243 20:48774785-48774807 CTCCGGCCCCTCCGCTGCCCTGG + Intronic
1174204476 20:48828485-48828507 CACGCGCGCCTCCGCGGCCCCGG + Intergenic
1176179369 20:63742225-63742247 CCCAGGCCCCGCCGCACCCCAGG - Exonic
1176179376 20:63742242-63742264 CGCAGGCCCCGCCGCACCCCAGG - Intronic
1176376910 21:6091402-6091424 CTCCCGCCGCGCCACCGCCCCGG - Intergenic
1176549147 21:8214011-8214033 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176557040 21:8258232-8258254 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176568079 21:8397049-8397071 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176575982 21:8441269-8441291 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176592263 21:8657268-8657290 CTCTGGCCCTGCCCCAGCCCTGG + Intergenic
1178417021 21:32412521-32412543 CGCGCGCCCCGCGGCTGCCCAGG - Exonic
1178544281 21:33480041-33480063 CTCGCGTCCCGCCCCGCCCCCGG - Intergenic
1178581597 21:33843021-33843043 CCTGCGCTCCACCGCAGCCCAGG - Intronic
1178914468 21:36698992-36699014 CTCCGACCCCGCCGCGGCCCTGG - Intergenic
1179243834 21:39613075-39613097 CGCGCCCCGCGCCCCAGCCCCGG - Intronic
1179746565 21:43446842-43446864 CTCCCGCCGCGCCACCGCCCCGG + Intergenic
1179783809 21:43718818-43718840 CCCGCGCCCCGCCGCACGCAGGG - Intergenic
1180057502 21:45366562-45366584 CACCCGCCCCGCCGCTGACCCGG - Intergenic
1180141811 21:45897770-45897792 CTCGGGACCCACAGCAGCCCAGG - Intronic
1180275114 22:10634397-10634419 CTCTGGCCCTGCCCCAGCCCTGG + Intergenic
1181057757 22:20268024-20268046 TCCGCGCCCCGCCGCCGGCCGGG + Intronic
1181539712 22:23566695-23566717 CTCGCGCCCACCCGGAGCCGGGG - Intergenic
1182903854 22:33920448-33920470 CTCCTGCCCCGCCGCCGCGCCGG - Intronic
1183401752 22:37609001-37609023 CTCACGCCCCGCCCCCGGCCCGG + Intronic
1183427375 22:37746818-37746840 CGAGCGCCCCTCCCCAGCCCAGG - Intronic
1183437728 22:37805046-37805068 CCTGCTCCCCGCCGCCGCCCTGG - Intergenic
1183586585 22:38756207-38756229 GTCGCGTCCTCCCGCAGCCCGGG - Intronic
1183601650 22:38843699-38843721 CTCGGGCGCCGCCGCGTCCCCGG - Exonic
1183601804 22:38844179-38844201 CTCGCTCCTCGCCGCATCCCCGG - Intergenic
1184152983 22:42649254-42649276 CTCGCGACGCCCCGCGGCCCCGG + Intronic
1184449066 22:44572232-44572254 CTCCAGCACTGCCGCAGCCCAGG + Intergenic
1185229079 22:49670272-49670294 CTCGGGCCGCGCAGGAGCCCAGG + Intergenic
1185272382 22:49935319-49935341 CCCGCGCCCCGCCGCCCGCCCGG - Intergenic
1185285869 22:49999699-49999721 CCCGCGCCCCGCCCCCGGCCAGG - Intronic
1203254032 22_KI270733v1_random:130327-130349 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203262088 22_KI270733v1_random:175406-175428 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
950400965 3:12768917-12768939 CCCCCGCCCCGCCCCGGCCCCGG - Intronic
953714662 3:45306978-45307000 CTCGGGCCGCGCAGGAGCCCAGG - Intergenic
956675037 3:71725325-71725347 CGCGCCCCCCGCCGGGGCCCGGG - Exonic
956675084 3:71725457-71725479 CGCGCGCCCCGCCCCGCCCCGGG + Intronic
959085815 3:101849742-101849764 GTCGCCGCCCGCCGCCGCCCCGG + Exonic
960024340 3:112991009-112991031 CCCGCTCCCAGCCGCAGCCCGGG - Exonic
960577120 3:119240735-119240757 CGCCCGCCCCGCTACAGCCCTGG + Intronic
960937723 3:122913527-122913549 CCCTCACCACGCCGCAGCCCAGG + Exonic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968545609 4:1196152-1196174 CTAGCGCCCCGCCTCAGTCAGGG + Intronic
968631767 4:1655568-1655590 CCCGCGCCCAGGCGCAGGCCTGG - Exonic
968653844 4:1770351-1770373 CCTGGGCCCCGCGGCAGCCCGGG + Intergenic
968820239 4:2844212-2844234 CTCGCTCCCCGGCTCGGCCCAGG - Intronic
968965083 4:3765740-3765762 CGCGCCCCGCGCCGCCGCCCCGG + Intergenic
969368662 4:6716430-6716452 CTCGGGCCGCGCCCCGGCCCCGG - Exonic
969691578 4:8706907-8706929 CTCCAGCCCCGCCGGGGCCCGGG + Intergenic
969912156 4:10457056-10457078 CGCGCGCCAAGCCGCGGCCCGGG + Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
973867130 4:55125384-55125406 CTCGCGGCACCCCGCAGCGCAGG + Exonic
979224234 4:118265844-118265866 CTCCCGCCGCGCAGGAGCCCAGG - Intergenic
982745595 4:159102630-159102652 CTGGCGCCACGCCGCCGCCCAGG - Intergenic
984999727 4:185471392-185471414 GCCGCGCCCCGCCCCAGGCCCGG - Intronic
985616686 5:927074-927096 CTCGGGCCCCGCCCCAGGCCAGG + Intergenic
987355827 5:17062251-17062273 CAGGCGCCCCGCGGCAGTCCCGG - Intergenic
987862688 5:23507252-23507274 CTCACGTCCCTCCGCAGGCCTGG - Intronic
988999338 5:36744666-36744688 CCCGCGCCCCGCTGCTTCCCGGG + Intergenic
990243226 5:53836990-53837012 CAAGCGCCCAGGCGCAGCCCTGG - Intergenic
990347425 5:54884061-54884083 CTAGCGCCCCGCAGAACCCCAGG + Intergenic
990382949 5:55233559-55233581 TTTGCTGCCCGCCGCAGCCCGGG - Exonic
992726554 5:79612812-79612834 CCCGTGCCCCGCCGCCGACCTGG - Exonic
992910737 5:81393954-81393976 CCCGCGCCTCCCCGCAGCCCCGG + Intronic
994043579 5:95284546-95284568 CTCGCCCGCCGCGGCAGCCCGGG + Exonic
997583980 5:135034037-135034059 CCCGCCCGGCGCCGCAGCCCCGG - Exonic
997653011 5:135536030-135536052 CTCCGCCCCCGCGGCAGCCCGGG + Intergenic
998138695 5:139688102-139688124 CCCCCGCCCACCCGCAGCCCTGG + Intergenic
999322736 5:150625166-150625188 CTGGAGCCCCCACGCAGCCCAGG - Intronic
999374987 5:151080791-151080813 CTCGCTCCCCGCCGCCACCGAGG + Intronic
1002742120 5:181441480-181441502 CACGCTCCCCGACCCAGCCCCGG + Intergenic
1003107349 6:3226959-3226981 CTCGCCTCCTGCCGCAGCCTGGG - Intronic
1003290747 6:4776497-4776519 ATCGCGCCCCGCCGCGGGGCCGG - Exonic
1003477500 6:6497725-6497747 CGCGGGCCCTGCCGCAGCCGTGG - Intergenic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004720646 6:18264895-18264917 GCCGCGCCCCTCCGCGGCCCGGG - Intergenic
1006514822 6:34539833-34539855 CCAGTGCCCCGCCCCAGCCCAGG - Intronic
1007625380 6:43243618-43243640 CCCCCGCCCCGCCCCGGCCCCGG + Intergenic
1007724757 6:43908599-43908621 CTCCCACCCCGCCCCAACCCAGG - Intergenic
1007781619 6:44257659-44257681 CCCGCGCCCAGGGGCAGCCCAGG - Intronic
1011449047 6:87473306-87473328 CTCCGGGTCCGCCGCAGCCCCGG - Intronic
1015965513 6:138692850-138692872 TCGGCGCCCCGCCGCTGCCCGGG - Intergenic
1016386733 6:143537005-143537027 CTGGCGCCCCGCGGCGTCCCCGG + Intronic
1016863780 6:148747130-148747152 CCCGCGCCCCGCCGCGCCTCGGG - Intergenic
1016863960 6:148747768-148747790 ACCGCGCGCCGCCGCCGCCCCGG + Intronic
1016937257 6:149456618-149456640 CCCCCGCCCCGCCGCCCCCCAGG + Intronic
1017793636 6:157823069-157823091 CCCGCGCCGCGCCGCCGCCCCGG - Intronic
1018156664 6:160991745-160991767 CTCGCCGCCCACCGTAGCCCCGG + Intronic
1019335554 7:480961-480983 CTCGGGCTCCTCAGCAGCCCTGG - Intergenic
1019395760 7:816840-816862 CCCGCGCCCCGCAGCTACCCCGG + Intronic
1019473471 7:1233197-1233219 CTCGTGCGCCGCCGCCGCCTCGG + Exonic
1019648297 7:2142581-2142603 CGCGTGCCCTGCCACAGCCCTGG + Intronic
1019765099 7:2844178-2844200 GCCGCGCCCCGCCGGCGCCCGGG + Exonic
1020274367 7:6615690-6615712 CGCCCGCCCCGCCCCCGCCCCGG + Exonic
1022715166 7:32891918-32891940 CTCGCCCCCGCCCGCGGCCCGGG + Intronic
1023984153 7:45085528-45085550 CTCGCCCCCCGCCTCACCCTCGG - Exonic
1026909478 7:74083909-74083931 CTCGCCCACCGCCGCCGGCCCGG - Intronic
1026935771 7:74254448-74254470 CTCGCGCCCGGCGGAAGCCAGGG - Intronic
1027111397 7:75442623-75442645 CGGCCGGCCCGCCGCAGCCCCGG + Intronic
1027311935 7:76959995-76960017 CCCGCGCCCCCCCGCGCCCCTGG - Intergenic
1031025203 7:116672266-116672288 CGCGCGGCCCGCGGCGGCCCGGG - Intergenic
1032033113 7:128501144-128501166 CTCGGGCCCCCAGGCAGCCCTGG + Intronic
1033661978 7:143408671-143408693 CCCGCGCCCCGCCCCTTCCCGGG - Intronic
1034455466 7:151167659-151167681 CCCGCGCCCCGCCGCCACCTCGG - Intronic
1035475830 7:159143917-159143939 CTCGAGCCCCGCTGCAGACCGGG + Intronic
1035580787 8:738079-738101 CTCCCGCACCCCCGGAGCCCAGG - Intronic
1035640109 8:1178338-1178360 CTGCCGCCCCTCCGCAACCCCGG - Intergenic
1035751656 8:2001239-2001261 CTCGCTCTCCCCGGCAGCCCCGG - Exonic
1036614719 8:10379449-10379471 CTCCAGCCCAGCCTCAGCCCGGG - Intronic
1037273757 8:17156606-17156628 AGCGCACCCCGCCGCCGCCCAGG + Exonic
1037305150 8:17497031-17497053 CCCGCGCCCCGCCCCCGCCCCGG + Intergenic
1037529230 8:19757378-19757400 CTGGCGCCCCGCCGCAGGGTAGG + Intronic
1039608480 8:38901408-38901430 AACGCGCCCCGCCCGAGCCCCGG + Exonic
1040581836 8:48704632-48704654 CTCCCTCCCGGCCGCAGGCCAGG + Intergenic
1041167369 8:55102743-55102765 AGCCCGCCCCGCCGCCGCCCGGG - Exonic
1042337224 8:67640918-67640940 CTCACTCCCTGCCGCATCCCAGG - Intronic
1042850744 8:73213645-73213667 CTCCAGCCCCACTGCAGCCCAGG + Intergenic
1043620995 8:82192326-82192348 CTCGGGCCACTCGGCAGCCCAGG + Intergenic
1044242434 8:89902650-89902672 CTCGCGCCTCGCCGTTGCCGCGG - Exonic
1045098841 8:98825713-98825735 CTCCCGCCCCGCCCCGCCCCCGG + Intronic
1046654063 8:116874253-116874275 CTCCCCTCCCTCCGCAGCCCAGG + Intronic
1047393723 8:124475032-124475054 CCCGCCCCCGGCCGCGGCCCCGG + Exonic
1047998615 8:130358719-130358741 CCCGCGCCCCGCCCCCGGCCCGG + Intronic
1049447414 8:142637765-142637787 TTCGCGCCCAGCCTGAGCCCTGG + Intergenic
1049615629 8:143574709-143574731 CTCCAGCCCAGCCGCAGCCCGGG + Intergenic
1049682389 8:143925339-143925361 CTCGCGCGCCGCCTCGGCCTCGG + Exonic
1050536136 9:6632670-6632692 CACGCGCCCCGGTTCAGCCCGGG + Intronic
1054891795 9:70259318-70259340 CCCGCGCGCTGCCGGAGCCCCGG - Intronic
1055321613 9:75088263-75088285 CGCGCGCCCCTGCGCAGCTCCGG + Intergenic
1056992350 9:91423730-91423752 CCCGCCTCCCGCCGCGGCCCCGG - Exonic
1057193103 9:93098120-93098142 CTCACTCCCCGGCACAGCCCAGG - Intronic
1057605460 9:96495398-96495420 CCCGCCCCCCGCCCCTGCCCAGG + Intronic
1059633914 9:116154283-116154305 CCCGCGCCCCGCCGCCGGCCCGG + Exonic
1060952287 9:127612088-127612110 CTGGCGCCCAGCCGCATCTCGGG + Intergenic
1062037849 9:134390654-134390676 GTTGAGCTCCGCCGCAGCCCTGG + Intronic
1062103301 9:134739342-134739364 CTCCCGCCCCGCCGGACACCAGG - Intronic
1062121317 9:134835480-134835502 CTCACTCCACGCCACAGCCCTGG - Intronic
1062325408 9:136010346-136010368 CTCTCGCCCTGGCCCAGCCCTGG + Exonic
1062388210 9:136323364-136323386 CTCGCCTCCCACCGCAGACCCGG + Intergenic
1062426905 9:136510338-136510360 ATCGGGCCCCGCTGCAGGCCAGG - Intronic
1062499492 9:136846184-136846206 CTCGCGACCCACCGCCGGCCAGG + Exonic
1062547461 9:137070122-137070144 CGCGCGCCCCGGCCCGGCCCGGG - Exonic
1062658962 9:137618577-137618599 CCCGCGCCAGGCCGCGGCCCAGG + Exonic
1062699478 9:137891446-137891468 CTCGCGAGCCGCCACAGGCCTGG - Intronic
1203470433 Un_GL000220v1:113471-113493 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203478254 Un_GL000220v1:157443-157465 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203622317 Un_KI270749v1:136115-136137 CTCTGGCCCTGCCCCAGCCCTGG + Intergenic
1185468753 X:370406-370428 CTCACGCCTCGCTGCAGCCGTGG - Intronic
1185471533 X:386724-386746 CCCGCGCCCCGCCCCGCCCCGGG + Intronic
1185877743 X:3713721-3713743 CCCCCGCCCCGACCCAGCCCAGG + Intergenic
1189354229 X:40299095-40299117 CCCGCGCCCCGCCCCCGCCCGGG - Intergenic
1191184198 X:57592421-57592443 CTCTCGCCCCCCTGGAGCCCCGG - Exonic
1198382594 X:136098535-136098557 CACGCGCCACGGCCCAGCCCGGG + Intergenic
1198388038 X:136147388-136147410 CGCGCGCCCCGCCCCGCCCCTGG + Exonic
1200086643 X:153610330-153610352 ACCGCCCCCCGCCGCAACCCCGG - Intergenic
1202368635 Y:24183061-24183083 CTGAGGCCCCGCCCCAGCCCCGG + Intergenic
1202502150 Y:25487056-25487078 CTGAGGCCCCGCCCCAGCCCCGG - Intergenic
1202583289 Y:26403289-26403311 CTCTGGCCCTGCCCCAGCCCTGG - Intergenic