ID: 923744759

View in Genome Browser
Species Human (GRCh38)
Location 1:236690010-236690032
Sequence ATCAAGCCACGGACTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923744759 Original CRISPR ATCAAGCCACGGACTGATTA TGG (reversed) Intronic
902104234 1:14020270-14020292 AACAGGCCACGGACTGATATTGG + Intergenic
905451131 1:38057337-38057359 ATCAAGCCATGGACATTTTAGGG + Intergenic
917031910 1:170702242-170702264 ATCAGGCCACGGACTGTTACCGG + Intronic
923744759 1:236690010-236690032 ATCAAGCCACGGACTGATTATGG - Intronic
1065529946 10:26658792-26658814 ATCAAGCCACGAAAAGATAATGG - Intergenic
1066462414 10:35623448-35623470 AGCAAGCCAAGGGTTGATTAAGG - Intergenic
1073587824 10:104727685-104727707 AACAGGCCACGGACTGATACTGG - Intronic
1087993141 11:104770674-104770696 ATCAAGCTAGGAACTGTTTAGGG - Intergenic
1090548917 11:127797499-127797521 TTCAAGCCAAGGACTGTCTAAGG + Intergenic
1091228001 11:133969508-133969530 AGCTAGTCACGGACTGACTAAGG - Intergenic
1091691040 12:2597716-2597738 TCCAGGCCACGGACTGCTTAGGG - Intronic
1100479992 12:94968739-94968761 ATCTAGCCAGTGACTGGTTACGG + Intronic
1101861080 12:108483020-108483042 AACAGGCCACGGACTGATACCGG - Intergenic
1103503231 12:121421621-121421643 ATCAAGCCACGGAACATTTATGG + Intronic
1104168375 12:126255970-126255992 AGCAAGCCTCAAACTGATTATGG + Intergenic
1107869841 13:44736265-44736287 AACAAGACAAGGAGTGATTATGG + Intergenic
1110545668 13:76752474-76752496 ATCTAGCCCCAGACTGATTCTGG + Intergenic
1114261442 14:21039472-21039494 ATCAGGCCAGGGACTGGTTCAGG - Intronic
1127054441 15:55117131-55117153 ATCAAGCTACAGACTGAGAATGG + Intergenic
1127060081 15:55173426-55173448 ATAAAGTTAAGGACTGATTAAGG - Intergenic
1128929594 15:71692170-71692192 ATCTAGGCACAGACTGATAAAGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134186946 16:12091889-12091911 ATCAAGGCACCGACAGATTCGGG - Intronic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1144431931 17:15200060-15200082 ATCAAACCTGTGACTGATTAGGG + Intergenic
1145009692 17:19360878-19360900 AACAGGCCACGGACTGGTTGAGG - Intronic
1148819565 17:50352813-50352835 TTCAAGCCAGGGACTGAGTGTGG + Intronic
1154253268 18:12762168-12762190 GTCAAGCCAGGAACTGCTTAGGG + Intergenic
1160125063 18:76164346-76164368 ATTGAGCCACTGACTGATTGTGG - Intergenic
1167976189 19:53227880-53227902 ACCAAGCCACGCGCTGATTGTGG + Intergenic
926702496 2:15813131-15813153 ACCCAGCCATGGACTGGTTAGGG + Intergenic
933718311 2:85378679-85378701 GTCAAGCCAGGAACTGCTTAGGG - Intronic
937579333 2:123464771-123464793 AGCAAGCCCAGGAATGATTAAGG - Intergenic
942761205 2:179400181-179400203 ATCAAGCCACGTTGTGATTCAGG - Intergenic
945292884 2:208143302-208143324 GTCAAGCCAGGAACTGCTTAGGG + Intronic
946628468 2:221640969-221640991 ATCAAGGCACTGTCTGATAATGG + Intergenic
1179489769 21:41733844-41733866 ATCCAGCCACAGCCTCATTAGGG + Intergenic
949777855 3:7652310-7652332 CTCAGGCCAAGGACTGGTTAGGG + Intronic
951226604 3:20127986-20128008 AACAGGCCACGGACTGGTAATGG + Intronic
954510787 3:51123117-51123139 ATGAAGCTACGGACTGGTTATGG - Intronic
958735943 3:98009860-98009882 ATCAAGCCAAGGATTCATTTTGG + Intronic
967152861 3:186665648-186665670 ATCAGTCCACTGACTGATGATGG + Intronic
975497810 4:75053932-75053954 ATCAAGCCAAGGGCTGAGAATGG - Intergenic
975879190 4:78882816-78882838 ATGAAGCCACAGAATGATAATGG + Intronic
977623291 4:99162301-99162323 ATCAAGGCACGGTCAGGTTAGGG + Intergenic
981510651 4:145553590-145553612 AACAGGCCACGGACTGATACTGG + Intronic
984408838 4:179369927-179369949 TTCCAGCCACGGAATGATTCTGG + Intergenic
984864176 4:184267050-184267072 ATCAAACCAGGGGCTGATTGGGG + Intergenic
988135290 5:27162408-27162430 ATTATGCTACGGTCTGATTAAGG - Intergenic
990646280 5:57848192-57848214 CTCAAGCCGGGAACTGATTAGGG + Intergenic
990724210 5:58735649-58735671 AACAAGCCAAGGACTGCTTGAGG - Intronic
990970708 5:61502652-61502674 AACAGGCCACGGACTGATACTGG - Intronic
994323642 5:98423204-98423226 AACAGGCCACGGACTGATACTGG + Intergenic
994912998 5:105937369-105937391 GTCAAGCCAGGAACTGCTTAGGG + Intergenic
995922874 5:117334520-117334542 AACAGGCCACGGACTGATACTGG + Intergenic
1005199821 6:23331532-23331554 GTCAAGCCACTCACTCATTATGG + Intergenic
1005613976 6:27555367-27555389 ATCAAACCAAGGACTACTTAAGG + Intergenic
1010142747 6:72630361-72630383 ATCCAGCCACTGACTGAAGAAGG - Intronic
1010355636 6:74929420-74929442 ATCATGACACTGACTTATTAAGG - Intergenic
1010741342 6:79508805-79508827 GTCAAACCACTAACTGATTAAGG - Intronic
1015117534 6:129666136-129666158 ATCACGCCATGGACTGATCCAGG + Intronic
1020972940 7:14969465-14969487 AACAAGCCACAGACTGATACTGG - Intronic
1023535009 7:41199490-41199512 TTCCAGCCACGTACTGAATATGG - Intergenic
1028054570 7:86226166-86226188 TTCAAGCCAGGGACTGCCTAAGG - Intergenic
1037614889 8:20510117-20510139 ATCAAGCCAGGGACTTCTTATGG + Intergenic
1042192162 8:66198050-66198072 AGCAAGCCACAGATTGATTCTGG + Intergenic
1045852465 8:106718918-106718940 ATCAAGGCACAAAATGATTAAGG + Intronic
1046062710 8:109158212-109158234 AACAGGCCACGGACTGATATCGG + Intergenic
1057644122 9:96856917-96856939 ATCAAGCCAACAACTGACTATGG + Intronic
1058334937 9:103814749-103814771 ACTAATCCACTGACTGATTAAGG + Intergenic
1058911868 9:109527822-109527844 GCCAAGCCACAGACTGATAAGGG + Intergenic
1061661713 9:132134683-132134705 TTGAAGCCATGGACTGAGTAAGG + Intergenic
1186175395 X:6921052-6921074 CTCAAGCCAAGGACTTATTCAGG - Intergenic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1187487712 X:19720307-19720329 GTCAAGCCAGGGACACATTAGGG - Intronic
1188619103 X:32197371-32197393 ATCAAACAACGGGATGATTATGG - Intronic
1199266982 X:145839655-145839677 ATCAAACCAAGTAATGATTATGG + Intergenic