ID: 923746372

View in Genome Browser
Species Human (GRCh38)
Location 1:236704490-236704512
Sequence CTGGAGGCCTGGACTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923746372_923746381 24 Left 923746372 1:236704490-236704512 CCATCTCAAGTCCAGGCCTCCAG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 923746381 1:236704537-236704559 TTGGGGTTCTCATGCCTCTTTGG No data
923746372_923746377 6 Left 923746372 1:236704490-236704512 CCATCTCAAGTCCAGGCCTCCAG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 923746377 1:236704519-236704541 TGACCAACCAACTTAAAATTGGG 0: 1
1: 0
2: 8
3: 56
4: 347
923746372_923746382 25 Left 923746372 1:236704490-236704512 CCATCTCAAGTCCAGGCCTCCAG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 923746382 1:236704538-236704560 TGGGGTTCTCATGCCTCTTTGGG 0: 1
1: 0
2: 1
3: 18
4: 165
923746372_923746378 7 Left 923746372 1:236704490-236704512 CCATCTCAAGTCCAGGCCTCCAG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 923746378 1:236704520-236704542 GACCAACCAACTTAAAATTGGGG 0: 1
1: 0
2: 6
3: 57
4: 217
923746372_923746376 5 Left 923746372 1:236704490-236704512 CCATCTCAAGTCCAGGCCTCCAG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 923746376 1:236704518-236704540 ATGACCAACCAACTTAAAATTGG 0: 1
1: 0
2: 1
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923746372 Original CRISPR CTGGAGGCCTGGACTTGAGA TGG (reversed) Intronic
900142966 1:1146180-1146202 CTGGAGGCCTCGACTTGGTGCGG - Intergenic
900346814 1:2214122-2214144 GTGGTGGCCTTGACTGGAGAGGG + Intergenic
900610099 1:3541073-3541095 CTGGGGCCCTGGACTTCAAAGGG + Intronic
900786404 1:4653273-4653295 CTGGAGGCCTGGGGGTGAAAGGG + Intergenic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
901455725 1:9361760-9361782 CTGGAGGGCAGGAGTGGAGATGG + Intronic
901628609 1:10637581-10637603 CTGGTGGCCTGGAGTAGGGAAGG + Exonic
901837726 1:11934939-11934961 TGGGAGGCCTGGGCTGGAGAGGG + Intronic
905205505 1:36340833-36340855 CTGCAGGCCTGGCCGTGAGCGGG - Exonic
906090498 1:43175468-43175490 CTGGAAGGATGGAGTTGAGATGG - Intronic
906321227 1:44818150-44818172 GTGGAGGACTGGAATTGAGAAGG + Intergenic
907188685 1:52631766-52631788 CTGGAGGCCTGGAGATCAGCTGG - Intergenic
907329548 1:53662115-53662137 TGTGAGGCCTGGACTTAAGAGGG - Intronic
907401496 1:54227483-54227505 CTGGAGGCCTGCACTGGGCAAGG - Intronic
907790943 1:57662752-57662774 CTGGAGGCAAGCACTTGAGCTGG - Intronic
907849964 1:58247110-58247132 CTGGAGGCCAGGAGATGAGCTGG + Intronic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
913022360 1:114800827-114800849 CTGTAGTCCTGACCTTGAGAGGG + Intergenic
913275357 1:117132440-117132462 CTGGAGCACTGGACTGGGGAGGG + Intergenic
913605627 1:120463122-120463144 CTGGAAGCCTAGACATGAAATGG + Intergenic
913989411 1:143596636-143596658 CTGGAAGCCCAGACATGAGATGG - Intergenic
914210788 1:145577043-145577065 CTGGAAGCCTAGACATGAAATGG - Intergenic
914269549 1:146067825-146067847 CTGGAAGCCTAGACATGAAATGG - Intronic
914366836 1:146986680-146986702 CTGGAAGCCTAGACATGAAATGG + Intronic
914367372 1:146991441-146991463 CTGGAAGCCTAGACATGAAATGG + Intronic
914485610 1:148106764-148106786 CTGGAAGCCTAGACATGAAATGG - Intronic
914532383 1:148534506-148534528 CTGGAAGCCTAGACATGAAATGG - Intronic
914533994 1:148548654-148548676 CTGGAAGCCTAGACATGAAATGG - Intronic
914534530 1:148553362-148553384 CTGGAAGCCTAGACATGAAATGG - Intronic
914585943 1:149061915-149061937 CTGGAAGCCTAGACATGAAATGG - Intronic
914754118 1:150553417-150553439 CTCGAAGCCGGGACCTGAGAAGG - Exonic
915484166 1:156208558-156208580 CTGGAGGCATGGGCATGTGATGG - Intronic
917284768 1:173412268-173412290 TTGTAGGGCTGGCCTTGAGATGG - Intergenic
917499757 1:175575649-175575671 GTGGAGGTTTGGACTTGAGATGG + Intronic
917683408 1:177391547-177391569 CTGGAGGCCTGGTTAGGAGAAGG + Intergenic
918464636 1:184808663-184808685 CTGGACTCCTGGACTTTGGAAGG + Intronic
918736604 1:188071830-188071852 CTGCGGGCCTGAACTTGGGAAGG + Intergenic
921482123 1:215675495-215675517 CTGGAGGCCTGCACCAGAGCAGG - Exonic
922475621 1:225905276-225905298 CTGGAGACCTGGATTTGGCAGGG + Intronic
922865085 1:228852754-228852776 CTGGGGGCCATGAGTTGAGATGG + Intergenic
923746372 1:236704490-236704512 CTGGAGGCCTGGACTTGAGATGG - Intronic
1064271712 10:13871659-13871681 CTGCAGGCCAGGTCTGGAGAAGG - Intronic
1067542540 10:47166279-47166301 CTGGAGGCCTAGACAAGAGGAGG + Intergenic
1067552649 10:47246372-47246394 CTTGGGGACTGGACTTGGGAAGG - Intergenic
1068684316 10:59854074-59854096 CTGGAGGCCTGGAATTCATGTGG - Intronic
1069739695 10:70679561-70679583 CTGGTGGCCTGGATTCTAGATGG - Intronic
1071254822 10:83862643-83862665 AGGGAGGTCTGGATTTGAGATGG + Intergenic
1072466636 10:95669501-95669523 CTGAAGGCCTGAACTTGGGTGGG - Intronic
1074193265 10:111156509-111156531 CTGAAGGCCAGGAGTTGGGAGGG - Intergenic
1075420303 10:122295460-122295482 CAGGAAGCCTGGGCTTGGGAGGG + Intronic
1075972335 10:126665238-126665260 TTGGAGGCCGGGACTTCAGGGGG + Intronic
1075980797 10:126737426-126737448 CTGGTGGACTGGACATGAGGTGG - Intergenic
1076265982 10:129110356-129110378 CTGGAGGTCTGGGCAGGAGAAGG - Intergenic
1077142991 11:1033038-1033060 CTGGAGGCCTGGGCTGGTGTAGG + Exonic
1077369764 11:2176006-2176028 CAGCAGGCCTGGATTTGGGAAGG - Intergenic
1079253070 11:18801775-18801797 CTGGAAGCCAGAACTAGAGAGGG - Intergenic
1080240295 11:30119876-30119898 GTGGTGGTCTGGACCTGAGAGGG + Intergenic
1083327418 11:61879836-61879858 CTGGAGCCCTGGACTTCTCAGGG + Intronic
1083864452 11:65446022-65446044 CCTGAGGCCTGGGCTGGAGATGG + Intergenic
1084544893 11:69810339-69810361 CTCGAAGCCTGAACGTGAGAGGG + Exonic
1084956654 11:72695201-72695223 CTGGAGTCCTGGGATAGAGAGGG + Intronic
1086747708 11:90451097-90451119 CTGAAGGCCTGTCCTTGACAGGG + Intergenic
1089659037 11:119974009-119974031 CTGGAGGCCTTGGCTTGAGCAGG + Intergenic
1089898006 11:121951332-121951354 CTAGAGGCCTGGAGCTGAAATGG - Intergenic
1090461535 11:126895603-126895625 CTGAAGGCCAGAACCTGAGAGGG + Intronic
1091807149 12:3365015-3365037 CTGGAGACCTGGATTTGAATTGG - Intergenic
1091823619 12:3493432-3493454 CTGGAGCCCTGGAAGCGAGAAGG + Intronic
1092744853 12:11663590-11663612 TTGGAGGCCTGGCTTTGTGATGG + Intronic
1093006158 12:14053557-14053579 CTTGAGGCCTAGGCTTGGGAGGG - Intergenic
1093908084 12:24715327-24715349 CTGAAGGCCTGGCCTTGTCAAGG - Intergenic
1093990486 12:25584547-25584569 CTGGAGTTCTGGACTAGAGCTGG - Intronic
1094382552 12:29858727-29858749 CTGCAAGCCTGGAAGTGAGAGGG - Intergenic
1095972377 12:47911260-47911282 CTGGGGGCCTGGTCTTTAGCTGG + Intronic
1097350845 12:58547051-58547073 CTGGAGGGCTGGGATAGAGAGGG + Intronic
1100271454 12:93029237-93029259 CTGGAGCCCTGGGGGTGAGAGGG - Intergenic
1100480433 12:94972793-94972815 CTGGATACCTGGAGTTGAAAGGG + Intronic
1100976053 12:100123610-100123632 CTGGAGGCCCAGACTTGCAATGG - Intronic
1101183644 12:102249765-102249787 CAGGATGCCTGGTCTTTAGAGGG - Intergenic
1101777341 12:107806523-107806545 CTGGAGGCCTGGAGCAGAGCAGG + Intergenic
1102543699 12:113639805-113639827 CTAGAGGACTGGCCTTGAGTGGG - Intergenic
1102812606 12:115837531-115837553 ATACAGGCCTGGACTAGAGAAGG + Intergenic
1104549726 12:129745447-129745469 CTGGAGGCCTGGTCATGAGAAGG - Intronic
1105242744 13:18622190-18622212 CTGGTGGCCTGGAGTTGGGGAGG - Intergenic
1106037130 13:26052954-26052976 CTGAAGTCATGGACTTGAAAGGG - Intergenic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1109845463 13:67983926-67983948 CAGGAGGCCTGGAAGTGGGAGGG + Intergenic
1112764283 13:102724215-102724237 ATGGAGGCATTGACTTGAGATGG + Intergenic
1113594813 13:111523691-111523713 CTTGAAGCCTGGACTGGACATGG + Intergenic
1118496624 14:66313944-66313966 ATGGAGACCTGGTATTGAGATGG + Intergenic
1118989019 14:70781303-70781325 CTGGAGGCCAGGACTGCTGATGG - Intronic
1119080509 14:71688940-71688962 CTGGAGGAGTAGACTTGAGATGG - Intronic
1119474731 14:74920468-74920490 CTGGTGGCCAGGCCTTGAGGTGG - Intronic
1120631159 14:86892168-86892190 CTGGAAGGCTGGACTTCAGTGGG + Intergenic
1121245149 14:92456683-92456705 ATGGAGGCATGGACTTGTAAGGG + Intronic
1121554897 14:94829109-94829131 CTGGGGGCCTGGAGCTGGGAGGG - Intergenic
1121732739 14:96197784-96197806 CTGGAGGCCTGGTCAGGTGAAGG + Intergenic
1122427926 14:101622561-101622583 CTTGGGGCCGGGCCTTGAGAGGG - Intergenic
1122637980 14:103139075-103139097 CTGGAGGCCCGGTCTTGAGGAGG + Intergenic
1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG + Intronic
1122789921 14:104179829-104179851 CTGGAGGACGGGACGTGGGACGG + Intronic
1123149535 14:106167526-106167548 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1123173042 14:106391873-106391895 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1123488556 15:20762415-20762437 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1123545052 15:21331488-21331510 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1123629793 15:22253740-22253762 CTGGAGGCCAGGACAGGAGCAGG - Intergenic
1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG + Intergenic
1126491434 15:49241215-49241237 GAGGAGATCTGGACTTGAGATGG + Intronic
1127653261 15:61029887-61029909 GGAGAGGCCTGGGCTTGAGATGG + Intronic
1127661050 15:61100515-61100537 CTGGAGCCCTGAAGTGGAGAAGG - Intronic
1128575968 15:68775454-68775476 ATGGAGGCCTGGAGTTGAGGAGG - Intergenic
1129184765 15:73899379-73899401 CCGGAGGACTGGATTTGAGGAGG - Intergenic
1129904031 15:79173327-79173349 CTGGAGGCCAGGACACGGGATGG + Intergenic
1131867870 15:96731314-96731336 CTGACGGCCGGGAGTTGAGATGG - Intergenic
1132329860 15:101004742-101004764 CTGGAGCCCTGAACTGCAGAAGG - Intronic
1132338093 15:101061502-101061524 CTGGAGGCCGGGATTTGCGATGG + Intronic
1202953398 15_KI270727v1_random:58759-58781 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1132698794 16:1213515-1213537 CAGGAGGCCTGGGCTGGAGCAGG - Intronic
1135912339 16:26572514-26572536 CTAGAGCCCTGGGCTTGTGATGG + Intergenic
1136680522 16:31959259-31959281 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136780863 16:32900805-32900827 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136889552 16:33958864-33958886 CTGGAGGGGTGGACTAGAAAAGG - Intergenic
1137653172 16:50137576-50137598 CTGTAGGCCTGGCCTTTCGATGG - Intergenic
1137716637 16:50602140-50602162 CTGGGGGCCTGGGAATGAGAGGG + Intronic
1138331667 16:56220381-56220403 CTGGAAGCCTGGACTTACCAGGG - Intronic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138882977 16:61038659-61038681 GTAGAAGCATGGACTTGAGATGG - Intergenic
1139478843 16:67217118-67217140 CTGGAGGCCAGGACCTGATAAGG - Intronic
1140250279 16:73289093-73289115 CTGAAGGCCAGGACTGAAGAGGG + Intergenic
1141687334 16:85577821-85577843 CTGGAGGACTGGAGTGGAAAAGG - Intergenic
1142229877 16:88895161-88895183 CTGCAGGCCTGGACTGGAAGGGG + Intronic
1203083515 16_KI270728v1_random:1164834-1164856 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1142469965 17:157803-157825 CTGGAGGCTTGTACTAGTGAAGG + Intronic
1143374133 17:6457555-6457577 CTGGAGGCGGGGAGTTGTGAGGG - Intronic
1144961172 17:19044963-19044985 ATGGAGGCCTGGGCTGGAGGAGG + Intronic
1144973989 17:19129561-19129583 ATGGAGGCCTGGGCTGGAGGAGG - Intronic
1147326480 17:39672183-39672205 CTGGAGCCCTGGCCCTGAAAGGG + Exonic
1149527482 17:57367871-57367893 CTGGAGGCCTGGGTAGGAGACGG + Intronic
1150836151 17:68565803-68565825 ATGGAGGCCTGGAGTGGAGAAGG - Intronic
1151138906 17:71973108-71973130 CTGTAGGCTTAGACTTTAGAGGG + Intergenic
1151425340 17:74027624-74027646 TTGGAGGCCTGGACTCTAGGAGG + Intergenic
1152637580 17:81436394-81436416 CTGGAGGCCTGGACCTCTGGAGG + Intronic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1154446194 18:14437687-14437709 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1155350279 18:24899558-24899580 CAGGAGGCAAGGAGTTGAGATGG - Intergenic
1155874206 18:31064836-31064858 CTGGAGTCCAGGAATGGAGATGG + Exonic
1156463855 18:37336511-37336533 CTGGGGGCCTGGGCTTGTGGAGG - Intronic
1156769840 18:40706875-40706897 CTGAAGGCATAGACTTGGGATGG - Intergenic
1160568865 18:79803243-79803265 CTGGGGGCCTGGAGATGAGGGGG - Intergenic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1164532612 19:29059785-29059807 GCGGAGGCCTGGCGTTGAGATGG - Intergenic
1164813829 19:31178989-31179011 CAGGAGACCTGGACTGCAGAAGG + Intergenic
1165419850 19:35717487-35717509 CAGGAGGCGTGGGCTGGAGAAGG - Intergenic
1165596317 19:37013481-37013503 CTGGATGCCCGGATTTGAGGAGG + Intronic
1166121514 19:40690107-40690129 CTGGAGGCCTTGGTTTGATACGG + Intronic
1166282961 19:41807460-41807482 CTGAGTCCCTGGACTTGAGAGGG - Intronic
1166297498 19:41896295-41896317 CTGGGGGCCTGGAATTGCGGGGG - Intronic
1167406289 19:49310718-49310740 CTGGAGGCCTGGGCCCAAGATGG - Intronic
1167792482 19:51690488-51690510 CTGGAGGGCTGGACTCCAGCTGG - Intergenic
1168354508 19:55692875-55692897 GTGGACGCCTGGACTGGAGGTGG + Intronic
1202676206 1_KI270711v1_random:9187-9209 CTGGAAGCCTAGACATGAAATGG - Intergenic
925742712 2:7019892-7019914 CTCGTGGCTTGGATTTGAGAAGG + Intronic
927746163 2:25623413-25623435 ATGGAGGCTTGGACTTGCCAAGG + Intronic
928173113 2:29016129-29016151 CTGGAAGGCTGGAGTTGAGTGGG - Intronic
930424441 2:51194722-51194744 CTGATGGCCTGGGCTTAAGAGGG + Intergenic
931804455 2:65790486-65790508 CTGGAGGGCTGGGCTGGGGACGG + Intergenic
935041131 2:99428251-99428273 ATGGTGGCCTGGACTTCAGATGG - Intronic
935788660 2:106571174-106571196 CTGGAGGCCTGTCCTTGAGATGG + Intergenic
936473152 2:112816486-112816508 CAGGAGGCCTGGTATTCAGAGGG + Intergenic
936911909 2:117602265-117602287 TTGGTGGCCTGGACTTGGGTGGG - Intergenic
937906856 2:127056668-127056690 CTTGAGGGCTGGACTTGAGGAGG + Intronic
943027098 2:182643059-182643081 CTGGAGGGCTGCACTAGACAGGG - Intergenic
943441605 2:187933473-187933495 GTGGATGCCAGGACTTGGGAAGG - Intergenic
944583401 2:201152680-201152702 ATGGAGGCCATAACTTGAGAGGG + Intronic
945428477 2:209736827-209736849 CTGGAAGCCAGGACTTTTGAGGG - Intergenic
946152847 2:217787812-217787834 CTGGGGTCCAGGTCTTGAGATGG - Intergenic
946353334 2:219169572-219169594 CTGGAGGCCAGGAGCTGAGAAGG + Exonic
947209859 2:227698675-227698697 CTGGAGGAATGGACTTAAGCGGG + Intronic
947989477 2:234475426-234475448 TTGGAGGCCTGGCCTTAAGGAGG - Intergenic
948160311 2:235818026-235818048 CAGGAGGACTAGACTTGGGACGG - Intronic
1170393721 20:15903461-15903483 CTGGAGGCCTATCCTGGAGAGGG + Intronic
1170574500 20:17652422-17652444 CAGGAGGCCTTGACTTGGGCAGG - Intronic
1170722668 20:18897636-18897658 GTGGAAGCCTGGGCTTGAGATGG + Intergenic
1172611960 20:36259267-36259289 CATGAGGCCTGCATTTGAGAGGG - Intronic
1172763455 20:37337715-37337737 CTGGAGACCTGGCCTTGGGGAGG + Intergenic
1172981647 20:38947328-38947350 CAGCAGGCCTGTACTAGAGAAGG + Intronic
1173100850 20:40086886-40086908 CTGGAGGACTGGAATAGAGGGGG + Intergenic
1173803565 20:45910146-45910168 CCCCAGGCCTGGACTTGAAAGGG - Intronic
1174060991 20:47833015-47833037 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174070906 20:47898355-47898377 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1174100197 20:48121427-48121449 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174153154 20:48500304-48500326 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174327948 20:49794442-49794464 CTGGAGGCCAGGACTTGGGGCGG + Intergenic
1174450257 20:50615690-50615712 CAGGTGACCTGGACTTGGGATGG - Intronic
1175377218 20:58536447-58536469 ATGTTGGCCTGGACCTGAGATGG - Intergenic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1176449788 21:6852159-6852181 CTGGTGGCCTGGAGTTGGGGAGG - Intergenic
1176827960 21:13717183-13717205 CTGGTGGCCTGGAGTTGGGGAGG - Intergenic
1178489048 21:33036346-33036368 CAGCAGGCCTGGCCCTGAGAGGG - Intergenic
1180103001 21:45598634-45598656 CTGGAGTCCTGGACTGGATTGGG - Intergenic
1180726809 22:17952441-17952463 CTACAGGCCTGGAGTTGAGGAGG + Intronic
1180981153 22:19878616-19878638 CTGGCTGCCTGCACGTGAGAGGG - Intronic
1181390384 22:22576419-22576441 CAGGAGGCCTGGTCCTGAGCTGG + Intergenic
1181875916 22:25940719-25940741 CTGGAAGCCTGGAGTTCACAGGG - Intronic
1184010560 22:41744964-41744986 CTGGAGGCATGGCCCTGAGGTGG - Exonic
1184019216 22:41809317-41809339 CTTGAGGCCTGGCCTGGAGCAGG - Intronic
1184248745 22:43248656-43248678 AGGGAGGCCACGACTTGAGAGGG + Intronic
1184477358 22:44728902-44728924 CTGGAGGAGTGGCCTTGAGGTGG + Intronic
1184499121 22:44861387-44861409 CTGGGGGCCTCGGCTTGAGGAGG + Intronic
1184992717 22:48181735-48181757 CTGGAGGCCTGGTCTTAGGCTGG - Intergenic
951864879 3:27297145-27297167 ATGGAGACCTGACCTTGAGAAGG + Intronic
952513138 3:34076941-34076963 ATGGTGGCCTGGACTAGGGATGG + Intergenic
952966369 3:38623501-38623523 CTGGAGGCCTGGCCTAGAGCAGG + Intronic
953015451 3:39071382-39071404 CTGCAAGGCTGCACTTGAGATGG + Intronic
953406856 3:42664033-42664055 ACGGAGGCCCAGACTTGAGAAGG - Intronic
953676851 3:45009405-45009427 CAGGATGCCAGGACTTGAGAGGG - Intronic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954378458 3:50206853-50206875 CTGGAGCCCTGGACTGGTGTGGG - Intronic
954612794 3:51955194-51955216 CTTGGAGCCTAGACTTGAGAGGG - Intergenic
954659806 3:52221037-52221059 CTGGAGGCATGGACAGGAGGAGG - Intergenic
955157793 3:56434431-56434453 CTGGAGTCCTGAGCTTAAGAAGG - Exonic
959063047 3:101633188-101633210 CTGGAGACCTGAACGAGAGAAGG - Intergenic
961360499 3:126364365-126364387 CTGGGGGCCTGGCCTTGTGCTGG - Intergenic
962826813 3:139106491-139106513 CTGGAGGTCTTGGCCTGAGAGGG - Intronic
963266756 3:143247350-143247372 CTGGTGGCCTGGAAATGACAGGG - Intergenic
965514302 3:169604528-169604550 CTGGAGGACTGGACTTGTGCAGG + Intronic
966925214 3:184640154-184640176 CTGGAGGTCTGGTTTTGAGTGGG + Intronic
967131894 3:186478224-186478246 CTGGAGGCCTGGATTGGATCAGG - Intergenic
968500726 4:948602-948624 CTGCAGGCCTGGAGGTGAGCGGG + Intronic
968709349 4:2101862-2101884 GTGGAGGCTTGGTCTTGAGCTGG + Intronic
969317690 4:6391767-6391789 CTGGAGGCCTGGAGGTGCCATGG + Intronic
970216658 4:13765880-13765902 CTGGTGACATGGTCTTGAGAGGG - Intergenic
970384009 4:15537979-15538001 CTGGAGGGCTGGGCTTCACAAGG - Exonic
971147181 4:23991106-23991128 TTTGAGGACTGGACTTGGGAAGG - Intergenic
972703324 4:41515342-41515364 ATGGAGGCCTGTCCTTCAGAAGG + Intronic
973081204 4:45996092-45996114 CTGGAGGATAGCACTTGAGAAGG + Intergenic
977400330 4:96523612-96523634 GTGGAGGTCTAGAATTGAGATGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
982173046 4:152680164-152680186 CTGGAGGCCGGGACTCCAAAGGG - Exonic
985267284 4:188161861-188161883 CTGGAGACCAGGACTTCAGGAGG + Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
989657493 5:43760297-43760319 CTGGTGGCATGGACTTATGAGGG + Intergenic
990539408 5:56757245-56757267 CCGGAGGTCTGGACTGGACAGGG + Intergenic
992861223 5:80912474-80912496 CTGGAGTCCTGGAGATGATATGG + Intergenic
994657362 5:102610068-102610090 GAGGAGGCCAGGAGTTGAGAAGG - Intergenic
997524036 5:134541124-134541146 CTAGAGCCCAGGACTTGAGGTGG - Intronic
998205390 5:140153814-140153836 CTGCAGACCAGGGCTTGAGAAGG - Intergenic
999187672 5:149724823-149724845 CTGGAAGCCAGGGCTTCAGATGG - Intergenic
1001054312 5:168436482-168436504 CTGGAGCCCTGCACTTGGGATGG - Intronic
1003020543 6:2505260-2505282 CTGATGGCCTGGACTGGGGAAGG - Intergenic
1003622661 6:7714863-7714885 CTGGTGGCCTGGGCTGGGGAAGG + Intergenic
1004785996 6:18967959-18967981 CTGGAAGACTGTCCTTGAGAAGG + Intergenic
1004980968 6:21023337-21023359 CTGAAGGTCTGAACTTGAGAAGG + Intronic
1006170489 6:32089166-32089188 GTGGAGATCTGGACTAGAGAGGG - Intronic
1006360376 6:33584129-33584151 GAAGAGGCCTGGACATGAGATGG + Intergenic
1006736060 6:36273427-36273449 CTGAAGGCCTGGAGTTCAGTGGG - Intronic
1007284998 6:40741242-40741264 CTGGAGGACAGGACCTCAGAGGG - Intergenic
1007674810 6:43584697-43584719 CTAAAGGCCTGGACTTGTGATGG - Intronic
1007736126 6:43983333-43983355 CTGGAGGCCTGGCCTGGGGGTGG + Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG + Intronic
1010049223 6:71483539-71483561 TTGGAGGGCAGGATTTGAGAGGG + Intergenic
1011767869 6:90643399-90643421 CTGGAAGACAGGACTTGAGTTGG - Intergenic
1014758556 6:125329077-125329099 CAGAAGTCCTGGACTTGAGCTGG + Intergenic
1016291916 6:142536529-142536551 CTTTGGGACTGGACTTGAGAGGG - Intergenic
1018417024 6:163610666-163610688 CTGGTGGCCAGGCCTTCAGAGGG - Intergenic
1018537472 6:164836701-164836723 CTGGAGGCATGGACAGGAGGTGG - Intergenic
1018927277 6:168215127-168215149 CTGGAGCCATGGAAATGAGAGGG - Intergenic
1020223537 7:6261100-6261122 CTGGAGGCCAGGATTCCAGAGGG + Intronic
1022643115 7:32206576-32206598 GTTGAGGCCTGGACCTGAGCAGG + Intronic
1022822767 7:33977376-33977398 CTGGAGGCATGGAGTTTAGGAGG + Intronic
1025233943 7:57221001-57221023 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1025976781 7:66376729-66376751 CTGGAGAGCTGGACTGGAGGAGG + Intronic
1026498289 7:70921950-70921972 CTGTAAGCCAGGACTTGAGAAGG - Intergenic
1026994596 7:74607050-74607072 CTGGAGGCCTGGGCTTTGGGAGG + Intergenic
1027202993 7:76074496-76074518 CTGGAGAGCTGGACTGGAGCAGG + Intergenic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1032083467 7:128871279-128871301 CAGGAGGCCTGGGAGTGAGAAGG + Intronic
1032547258 7:132754299-132754321 CTGGAGGCCAGGACATCAGCAGG + Intergenic
1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG + Intronic
1033213213 7:139475798-139475820 CCAGAGGCCTGGACTTGCGACGG + Intronic
1033562358 7:142544764-142544786 ATGGAGGCCTGGACTTCCAAGGG - Intergenic
1034293200 7:149948528-149948550 CTGGAGGGCTGGGATGGAGAGGG - Intergenic
1034717916 7:153260745-153260767 CTGGAGACATGGACTTGGGGTGG - Intergenic
1034812874 7:154148351-154148373 CTGGAGGGCTGGGATGGAGAGGG + Intronic
1035015571 7:155762866-155762888 ATGGATGCTTGGACTTGAAAAGG - Intronic
1035523708 8:295125-295147 CTGGAGGCCGGACCTTGTGAAGG - Intergenic
1036671995 8:10796264-10796286 CTGGAGTCTTTGACTTCAGATGG - Intronic
1037944078 8:22975499-22975521 CTGGAGGCCTGAGGCTGAGAAGG + Intronic
1038625674 8:29190669-29190691 CTAGAGGCCTGGACCTGCGCTGG + Intronic
1039792407 8:40886365-40886387 CTGGAGGCCTGGAGGAGCGAGGG - Intronic
1040594335 8:48822909-48822931 GTGGAGTCCTGTACCTGAGAAGG - Intergenic
1043589816 8:81816922-81816944 CTAGAGGCCATGACTAGAGAGGG - Intronic
1045684249 8:104694846-104694868 CTGGAGGCCTGGACTTGCTTGGG + Intronic
1047576277 8:126159209-126159231 CTGCAGGGCTGGACGTCAGAAGG - Intergenic
1048553710 8:135456519-135456541 ATTGAGGCCGGGACTTGAGCTGG + Intergenic
1049004724 8:139847524-139847546 CTGGAGGCCCGGCCTGGGGATGG + Intronic
1049165036 8:141120348-141120370 CTGGAGGCCTGATGGTGAGAAGG - Intronic
1049294812 8:141826843-141826865 CTGGAGGCTCGGAGATGAGAGGG + Intergenic
1049358850 8:142202313-142202335 CTGGAGGCCTGGGCATGGGAGGG - Intergenic
1049605623 8:143527987-143528009 CTGGAGGCCTGGACCTTTGCCGG - Intronic
1056748169 9:89323261-89323283 ATGGAGGCCTGGACTAGGGAAGG + Intronic
1057052516 9:91936304-91936326 CTGGAGGCCAGGAGTTGGCAGGG + Intronic
1060967779 9:127721264-127721286 CTGGAGGCCAGAGCCTGAGAAGG + Intronic
1061034399 9:128105720-128105742 CGGGAGGCATGGACCTGGGAGGG - Exonic
1061045676 9:128163698-128163720 CTGAAGGCCAGCCCTTGAGAAGG - Exonic
1203519396 Un_GL000213v1:32358-32380 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187946002 X:24427028-24427050 CTGTAGCCCTGGACTTGAGGTGG + Intergenic
1190154246 X:47974947-47974969 CTGGGGGGATGGAATTGAGAGGG - Exonic
1192439426 X:71163883-71163905 CTGGAGGCATGCACTTCAAATGG + Intronic
1195942573 X:110178074-110178096 CTGGAGGACTGAGCTGGAGAAGG + Intronic
1198519802 X:137441339-137441361 CTTGAGGCCTCGCCTTGTGAGGG + Intergenic
1200042030 X:153377919-153377941 CTGGAGGTGTGAACTGGAGAAGG + Intergenic