ID: 923755237

View in Genome Browser
Species Human (GRCh38)
Location 1:236785731-236785753
Sequence ACAGCTGGGTGCTGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923755228_923755237 15 Left 923755228 1:236785693-236785715 CCAACAAGCATGGGAGGGAGGCT No data
Right 923755237 1:236785731-236785753 ACAGCTGGGTGCTGGCCTGCAGG No data
923755222_923755237 29 Left 923755222 1:236785679-236785701 CCAGACTTTGGGCACCAACAAGC No data
Right 923755237 1:236785731-236785753 ACAGCTGGGTGCTGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923755237 Original CRISPR ACAGCTGGGTGCTGGCCTGC AGG Intergenic
No off target data available for this crispr