ID: 923758122

View in Genome Browser
Species Human (GRCh38)
Location 1:236812491-236812513
Sequence CACTTCCCATGTATGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923758122_923758126 1 Left 923758122 1:236812491-236812513 CCTCAGCTCATACATGGGAAGTG 0: 1
1: 0
2: 1
3: 7
4: 151
Right 923758126 1:236812515-236812537 AAGTTACGTGGCAGGTGTTTAGG 0: 1
1: 0
2: 0
3: 9
4: 88
923758122_923758125 -7 Left 923758122 1:236812491-236812513 CCTCAGCTCATACATGGGAAGTG 0: 1
1: 0
2: 1
3: 7
4: 151
Right 923758125 1:236812507-236812529 GGAAGTGGAAGTTACGTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923758122 Original CRISPR CACTTCCCATGTATGAGCTG AGG (reversed) Intronic
900206684 1:1434696-1434718 CACCTCCCAGCTCTGAGCTGAGG + Intergenic
900347541 1:2216799-2216821 CACTTCCCATGCATCACCTCAGG + Intergenic
901067843 1:6502845-6502867 CAGGTCTCATGCATGAGCTGAGG - Intronic
902118043 1:14137984-14138006 GATTTCCCATGTATGAAATGGGG + Intergenic
903254033 1:22080048-22080070 AAGTTCCCATCTATGAGTTGGGG + Intronic
904702532 1:32366442-32366464 CCCTTCCCAGGTGTGAGCAGAGG + Intronic
905000869 1:34668172-34668194 CACTTCACTTGCCTGAGCTGAGG + Intergenic
905906350 1:41621033-41621055 CACTTGCCACGTTTGAGCTTGGG + Intronic
906295861 1:44648785-44648807 CACGTCCCATGCCTGAGGTGGGG + Intronic
906667294 1:47630938-47630960 CACTTGGCATCTAGGAGCTGAGG + Intergenic
910291440 1:85603636-85603658 CACTTCTGGAGTATGAGCTGTGG - Intergenic
912043147 1:105417284-105417306 CACTTGCCTTGTATTAGATGAGG + Intergenic
917502569 1:175599197-175599219 CACTTCCCATCTGGCAGCTGGGG - Intronic
917532939 1:175853235-175853257 CACTTCCCATGCCTGACCTGGGG + Intergenic
918991720 1:191704802-191704824 CACATCCCAAAGATGAGCTGCGG + Intergenic
919396065 1:197049683-197049705 CACTTCCCATTCATGGGATGAGG + Intronic
922317565 1:224456328-224456350 CACATCTCATGTCTGAGCTATGG - Intronic
923055729 1:230425306-230425328 GACTTCCCATGCAGGGGCTGGGG + Intronic
923758122 1:236812491-236812513 CACTTCCCATGTATGAGCTGAGG - Intronic
1062820231 10:529158-529180 CAGTTCCCATCTATGAGATGGGG - Intronic
1068661677 10:59629175-59629197 CATTTCTCATGTATGAGGAGTGG - Intergenic
1071596940 10:86934847-86934869 CACTGCTCATGTTTGACCTGGGG - Intergenic
1072439859 10:95444790-95444812 TACTTATCATGTATGAGTTGAGG - Intronic
1075873115 10:125785664-125785686 CATGTCCCATCAATGAGCTGTGG + Intronic
1078328806 11:10401904-10401926 CACTTTCCATCTCCGAGCTGAGG + Intronic
1079404210 11:20130818-20130840 CACTTCCCATCTGTGGGCTCAGG + Intergenic
1082895292 11:58183640-58183662 CACTTACCAGGTAAGAGCTGTGG - Intergenic
1085299845 11:75451392-75451414 CGCTTCCCGTGTGTGAGATGAGG - Intronic
1088819595 11:113446119-113446141 TACTTCCCATGCATGAAGTGGGG - Intronic
1088946851 11:114522642-114522664 CATTTTACATGTATGAACTGGGG - Intronic
1089065138 11:115656900-115656922 CTCTTCCCATCAAGGAGCTGAGG + Intergenic
1091090278 11:132764469-132764491 TATTTTCCATGTATGAGCTGTGG + Intronic
1093680835 12:22000691-22000713 CACTTACCATGAATGAACTTTGG + Intergenic
1101950683 12:109172368-109172390 CAATTCCCATGTATCTGATGGGG - Intronic
1107606313 13:42060860-42060882 CACTTGACATGTGTGACCTGGGG - Intronic
1111666276 13:91272642-91272664 CACTTCCCATGTAGGTCCAGTGG + Intergenic
1112264325 13:97908927-97908949 CATTTCCCCAGTATTAGCTGAGG - Intergenic
1113757757 13:112825592-112825614 CACTGCCCTTGTATGATCCGAGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118953560 14:70457998-70458020 CAATTCCCAGCTATGAGATGTGG + Exonic
1119200978 14:72752830-72752852 CCCTTACCCTGTATGAGCTTTGG - Intronic
1120696976 14:87655554-87655576 CACTTCTCCTGTATTAGCTTTGG - Intergenic
1126275608 15:46875971-46875993 CTCTATACATGTATGAGCTGGGG - Intergenic
1127453280 15:59136857-59136879 CACTTCCCATGTACGTGCCAAGG - Exonic
1127613465 15:60659364-60659386 CACCTCCCATGTTAGAGATGAGG - Intronic
1127629828 15:60817699-60817721 GCCTTCCCATGTGTGGGCTGAGG + Intronic
1131158964 15:90091966-90091988 CAGTTCCCAGGCATGAGCTCAGG - Intronic
1131745860 15:95446375-95446397 CACTTACCAGGTGTGATCTGCGG + Intergenic
1132925493 16:2427236-2427258 CACTTCCCAGAGAGGAGCTGAGG - Intergenic
1133019382 16:2960471-2960493 CACTTCCCCTACATGAGGTGTGG - Intergenic
1133119121 16:3595539-3595561 CACTTGCCATGTGTGTGGTGGGG - Intronic
1134812532 16:17179921-17179943 GACTTCCCAAGTATGGCCTGTGG - Intronic
1135055059 16:19224972-19224994 CACTTAACATCTATGAACTGGGG + Intronic
1135402675 16:22177142-22177164 CACATCCCTTCTCTGAGCTGTGG + Intronic
1143541372 17:7571500-7571522 CCCTTCCCATTTATGGGCTTGGG - Exonic
1147773656 17:42885230-42885252 CAATTCCCATTGGTGAGCTGAGG + Intergenic
1147850725 17:43440523-43440545 CACTGAGCATGTCTGAGCTGGGG + Intergenic
1148506626 17:48132483-48132505 CACCTCCCAGGTAGGGGCTGAGG - Intergenic
1150437994 17:65168872-65168894 CATTTCCCAGTGATGAGCTGGGG - Intronic
1155161129 18:23196733-23196755 CACCTCCCATTTCTGAGGTGGGG - Intronic
1155435589 18:25809389-25809411 CACTTTCCATGTATGGGGTCTGG - Intergenic
1157041406 18:44043888-44043910 CACTTCCCTGGTATGTCCTGGGG + Intergenic
1158095333 18:53763721-53763743 CACTTCCCATGCATTTGCTTTGG - Intergenic
1158509676 18:58079546-58079568 CACTTCCCAGCTATGACTTGGGG - Intronic
1158545344 18:58391544-58391566 CACTCACCATGTGTGAGCTCTGG - Exonic
1161583239 19:5091994-5092016 CCCTTCCCATGTGTGGGCTTAGG + Intronic
1162725817 19:12689278-12689300 CCCTTCCCAGGTCTGTGCTGAGG - Exonic
1164576637 19:29409058-29409080 CCCTCCCGATGTATCAGCTGGGG + Intergenic
1164666885 19:30045523-30045545 GACTGCCCATGGAAGAGCTGAGG + Intergenic
1165390975 19:35538603-35538625 CACTTCCCTTGTATCGGCCGTGG - Exonic
926223556 2:10951875-10951897 CACCTCCCATGTCTGAGCCTAGG - Intergenic
930865188 2:56115665-56115687 CACTTCCTATGTGGGAGCAGTGG - Intergenic
935189011 2:100760938-100760960 GACTTCACATGAATCAGCTGGGG + Intergenic
935191571 2:100782493-100782515 AACCTCCCATGGCTGAGCTGGGG - Intergenic
935657651 2:105438632-105438654 CCCTTCCCATCTGGGAGCTGAGG - Intergenic
937052812 2:118906197-118906219 CACTTCCCCTGTGTGAGACGGGG + Intergenic
939392997 2:141592646-141592668 GACTTCCCTGGTATGAGTTGTGG + Intronic
941731917 2:168927299-168927321 CAATTCCAATGTTTGAGCGGAGG + Exonic
942815229 2:180045202-180045224 GACATTCTATGTATGAGCTGGGG + Intergenic
944179792 2:196878142-196878164 CACTTCCCTAGTACAAGCTGAGG + Intronic
948212263 2:236203522-236203544 CACTTGCCAGGTATGAGTGGAGG + Intronic
948631541 2:239306165-239306187 GACTTCCCAGGGAAGAGCTGGGG - Intronic
948886582 2:240887989-240888011 CATTTACCAAGTGTGAGCTGGGG + Intronic
1170599345 20:17828996-17829018 CACTCCCCTTGTATCATCTGTGG + Intergenic
1170713352 20:18811352-18811374 GATTTCTTATGTATGAGCTGTGG + Intronic
1170816308 20:19717353-19717375 CACGTCTCAAGTATAAGCTGTGG + Intronic
1173027609 20:39323935-39323957 CACTTCCCATCTCTGAGCCTTGG + Intergenic
1173122409 20:40305857-40305879 CACTTCCCATCTCTGAGCCACGG - Intergenic
1176262462 20:64189394-64189416 AAATTCCCATGTCTGAGCAGAGG - Intronic
1179097067 21:38325389-38325411 CCCTTCCCATTGCTGAGCTGTGG - Intergenic
1179517107 21:41916073-41916095 CACTTCCCAAACGTGAGCTGAGG + Intronic
1180042175 21:45286539-45286561 CACTTCTCATGAATGCACTGTGG - Intronic
1181144445 22:20834371-20834393 CACAGCCCATGGATGAGTTGGGG - Intronic
1182096208 22:27627682-27627704 CGCCTCCCATGTATGGGCTTGGG + Intergenic
949933957 3:9102128-9102150 CACTCCCCATGTCTGAGCTGGGG - Intronic
953063357 3:39446680-39446702 TACTTTCCATGTGGGAGCTGTGG - Intergenic
956651895 3:71512108-71512130 GACTTCCCATCTCTGAGCCGTGG - Intronic
957030111 3:75230154-75230176 CACTTCACATGCATTAGCAGAGG - Intergenic
960910435 3:122644186-122644208 CACTTCCCTTGTATGAGAGAGGG - Intergenic
962610822 3:137074682-137074704 GTCTTCCCATCTATAAGCTGGGG + Intergenic
963272362 3:143298464-143298486 CATTTCCCAAGTCTGAGGTGTGG + Intronic
965376759 3:167934353-167934375 CACATCGAATGTATGAGTTGGGG + Intergenic
967210361 3:187162840-187162862 CATTGCCCATGTCTCAGCTGAGG + Intronic
968741073 4:2332044-2332066 CATTTACCAAGCATGAGCTGCGG - Intronic
971457678 4:26860096-26860118 CATTTCCCATGAATTAGCTGTGG + Intronic
972462617 4:39319230-39319252 CACTTCCCCTGTCTGTGCTTTGG - Intronic
973366380 4:49212853-49212875 CACCTCCCCTGTGTGAGCTCGGG + Intergenic
978100167 4:104829154-104829176 CACTGCCCATGTATGGGCTCTGG + Intergenic
978217479 4:106222564-106222586 CATTTCTGATGTGTGAGCTGAGG - Intronic
982123786 4:152166841-152166863 CACATCACATCTATGAGCAGAGG + Intergenic
983297375 4:165882866-165882888 CTCTTCCCAAGTAGAAGCTGAGG - Intronic
983810311 4:172052297-172052319 CACTTCCCAGGGAAGAGCTCGGG + Intronic
984978652 4:185255822-185255844 CACTTACTATGTAGGAACTGTGG + Intronic
989529329 5:42488796-42488818 CACTACCCATATGTTAGCTGTGG - Intronic
996131159 5:119782415-119782437 AGCTTCCCTTGTTTGAGCTGAGG + Intergenic
1001140486 5:169139927-169139949 CACTTACAGTGTCTGAGCTGCGG - Intronic
1001530696 5:172459449-172459471 CACTTCCCCTGATTGAGGTGTGG + Intergenic
1001540031 5:172531456-172531478 CATTTCCCATGGATTAGATGAGG + Intergenic
1002912724 6:1502685-1502707 TACTTCCCAGGTATGCTCTGAGG + Intergenic
1008428649 6:51388886-51388908 ACCTTCCCATGACTGAGCTGTGG + Intergenic
1011633248 6:89347620-89347642 CACATACCATGTAAGAGCTAAGG + Intronic
1014001849 6:116372894-116372916 CACTTCCTAAGTTTGAGCTTGGG + Intronic
1014568822 6:122984371-122984393 CACTTCCCCTTTATGAGTTATGG - Intergenic
1016033113 6:139357925-139357947 AGCTTCCCATGGATGAACTGAGG - Intergenic
1016543845 6:145197905-145197927 TTCTTCCCTTGTATGAGCTTCGG - Intergenic
1018272381 6:162094160-162094182 CAGTGCCCATCTGTGAGCTGGGG + Intronic
1018474645 6:164128718-164128740 CACTCACCATGTATGAGTTAAGG - Intergenic
1020453647 7:8347448-8347470 CAATTCCCATGTATGATGAGAGG + Intergenic
1022521109 7:31007447-31007469 CACTTACCATGTGTGAGATAGGG - Intergenic
1023579143 7:41662988-41663010 CCCTCCCCAAGAATGAGCTGCGG + Intergenic
1023815996 7:43950426-43950448 CCCGTCCCATGTATCAGCCGAGG - Intronic
1024153869 7:46600405-46600427 CACTTCCCAGAAATGTGCTGGGG + Intergenic
1024424603 7:49211517-49211539 CACTTCCCTTGTATAAAATGAGG + Intergenic
1026117999 7:67512411-67512433 CACTTCCCACATATGCTCTGAGG + Intergenic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1034706295 7:153148132-153148154 CACTGCCCATGTGTGTGCTGAGG - Intergenic
1036582373 8:10087311-10087333 CACAAGCCATGCATGAGCTGTGG - Intronic
1036638543 8:10567696-10567718 CATTTCCCATGTTTGGGCAGGGG + Intergenic
1037956955 8:23067858-23067880 CACTTCCCCACTCTGAGCTGCGG + Intronic
1038391666 8:27207558-27207580 CTCTACCCATTTATCAGCTGTGG - Intergenic
1039779982 8:40775547-40775569 CACTGCCTCTGTTTGAGCTGTGG - Intronic
1040584058 8:48723668-48723690 CAGTTCCCCAGTATGTGCTGTGG - Exonic
1041719639 8:60964463-60964485 CACTTCCAATGTCTAAACTGGGG - Intergenic
1041887326 8:62825683-62825705 CACTGACCATGTATGATATGTGG + Intronic
1044094247 8:88042850-88042872 AACTTGACATGAATGAGCTGTGG - Intronic
1047250403 8:123177994-123178016 CACGTCCCATGTGTGTGCGGTGG - Intergenic
1047339870 8:123970696-123970718 CACTTCCCCTGGCAGAGCTGAGG - Intronic
1049098428 8:140562447-140562469 CACTTGCCATCCATGAGGTGAGG - Exonic
1053556448 9:39142831-39142853 CTCATTCCATGTATGAACTGTGG + Intronic
1055022060 9:71680628-71680650 CAGTTCTCCTGTCTGAGCTGGGG + Intergenic
1055771524 9:79721879-79721901 CACCTCCCAGGTATGATCCGTGG + Exonic
1055916663 9:81409076-81409098 CACTTCCCATCTATGTTATGAGG + Intergenic
1056817361 9:89811637-89811659 CCCTCCCCAGGTATGAGGTGTGG + Intergenic
1058835076 9:108853483-108853505 CACTTACCATGCATGTACTGTGG - Intergenic
1060918701 9:127405849-127405871 CTCTTCCCATGTAAGACCTTAGG - Intronic
1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG + Intronic
1189620426 X:42831252-42831274 TACTTCACATGTAAGAGCTCTGG - Intergenic
1194385036 X:93242346-93242368 TTCTTCCCATCTATGAGCTTGGG - Intergenic
1194853175 X:98893968-98893990 CACTACCCTTCTGTGAGCTGGGG + Intergenic
1199762152 X:150913132-150913154 GAGTTGCCATTTATGAGCTGGGG - Intergenic