ID: 923759724

View in Genome Browser
Species Human (GRCh38)
Location 1:236830743-236830765
Sequence CTGCGACTAGCTTGGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923759717_923759724 7 Left 923759717 1:236830713-236830735 CCTCAGGGTCAGACTAGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 923759724 1:236830743-236830765 CTGCGACTAGCTTGGAAGGCTGG No data
923759711_923759724 28 Left 923759711 1:236830692-236830714 CCTGCTTGCCTGTCCTGGGAACC 0: 1
1: 0
2: 0
3: 24
4: 276
Right 923759724 1:236830743-236830765 CTGCGACTAGCTTGGAAGGCTGG No data
923759710_923759724 29 Left 923759710 1:236830691-236830713 CCCTGCTTGCCTGTCCTGGGAAC 0: 1
1: 0
2: 1
3: 23
4: 226
Right 923759724 1:236830743-236830765 CTGCGACTAGCTTGGAAGGCTGG No data
923759715_923759724 15 Left 923759715 1:236830705-236830727 CCTGGGAACCTCAGGGTCAGACT 0: 1
1: 0
2: 1
3: 22
4: 184
Right 923759724 1:236830743-236830765 CTGCGACTAGCTTGGAAGGCTGG No data
923759714_923759724 20 Left 923759714 1:236830700-236830722 CCTGTCCTGGGAACCTCAGGGTC 0: 1
1: 0
2: 6
3: 25
4: 212
Right 923759724 1:236830743-236830765 CTGCGACTAGCTTGGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923759724 Original CRISPR CTGCGACTAGCTTGGAAGGC TGG Intronic
No off target data available for this crispr