ID: 923763292

View in Genome Browser
Species Human (GRCh38)
Location 1:236867986-236868008
Sequence TAGGTGATAAAGCAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1258
Summary {0: 1, 1: 4, 2: 133, 3: 466, 4: 654}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923763292 Original CRISPR TAGGTGATAAAGCAGGGGCA AGG Intronic
900508535 1:3043948-3043970 TAGTTAATAAAGCAGCAGCAGGG - Intergenic
900962244 1:5932347-5932369 TAGTTGATAAAGCAATGGCAAGG - Intronic
901261303 1:7873772-7873794 TACTTGATAAAGCATTGGCAGGG + Intergenic
902165303 1:14565653-14565675 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
903092119 1:20930361-20930383 TAGTTGATAAAACAGCGGAAGGG - Intronic
903560941 1:24226747-24226769 TGGTTGATAAAGCAGCAGCAGGG - Intergenic
903597816 1:24509399-24509421 TAGTTGATAAAGCAATGGCAGGG - Intronic
904085143 1:27901051-27901073 TAGTTGAGAAAGCAGTAGCAGGG + Intronic
904127959 1:28255429-28255451 TAGTTGACAAAGCAGCAGCAGGG + Intergenic
904160557 1:28519275-28519297 AAGATGATACAGCAGGGGCTGGG + Intronic
904227388 1:29034414-29034436 TAGATGATTTAGCAGTGGCATGG + Intronic
904664938 1:32113064-32113086 TAGTTGATAAAGCAGTGGCAGGG - Intronic
904760617 1:32801718-32801740 TCGTTGATAAAGCAGCAGCAGGG - Intronic
905260878 1:36717808-36717830 CAGTTGATAAAGCAGCAGCAGGG - Intergenic
905545767 1:38798832-38798854 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
906558683 1:46736898-46736920 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
906994645 1:50778985-50779007 TAATTGATAAAACAGTGGCAGGG - Intronic
907033482 1:51195394-51195416 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
907366856 1:53968738-53968760 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
907548235 1:55281727-55281749 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
907858890 1:58331410-58331432 TAGTAGATAAAGCAGGAACAGGG + Intronic
908091827 1:60694263-60694285 TAGTTGATAAAGCAGTGTCAGGG + Intergenic
908679297 1:66641865-66641887 TAGGAGAAAAAGCAGAGGGAAGG - Intronic
908689493 1:66761943-66761965 TAGTTGATAAAGGAGTGGCACGG - Intronic
908869906 1:68597677-68597699 TAGCTGACAAAGCAGTGGCAGGG + Intergenic
908921842 1:69204042-69204064 TAGTTAATAAAGCAGTAGCAGGG - Intergenic
909296980 1:73962947-73962969 TAGTTGATAAAGCAGAGGCAGGG + Intergenic
909487916 1:76194147-76194169 TAAGTGAACAAGCTGGGGCAAGG + Intronic
909695855 1:78466879-78466901 TAGTTGATAAAGCAGTAGCAAGG + Intronic
909735708 1:78958730-78958752 TAGTTGATAAAGCAACAGCAGGG + Intronic
909767371 1:79373053-79373075 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
909824054 1:80103487-80103509 TAGTTGATAAACCAGTGGCACGG - Intergenic
909915995 1:81320028-81320050 TACTTGATAAAGCAGCAGCAGGG - Intronic
910163109 1:84295062-84295084 TAGCTGATAAAGCAGCATCAGGG - Intergenic
910231569 1:84993063-84993085 TAGTTGATAAAACAGCAGCAAGG - Intronic
910411565 1:86951782-86951804 TAGTTGATAAAGCAGCATCAGGG - Intronic
910640196 1:89452491-89452513 TAGTTGATAAAGTAGTGGCAGGG + Intergenic
910732805 1:90416903-90416925 TAGCTGATAAAGCAGTGTCAGGG + Intergenic
910735826 1:90456284-90456306 TAGATGAAAACGCAGGGGAAAGG + Intergenic
910845053 1:91596845-91596867 TAGTTGATAAAACAGTGGCAGGG - Intergenic
910941677 1:92542157-92542179 TAGTTGATAAAGCAGTGGCAGGG - Intronic
911820414 1:102412371-102412393 TAATGGATAAAGCAGTGGCAGGG + Intergenic
912024447 1:105149896-105149918 TAGTCGATAAAGCAGAAGCAGGG + Intergenic
912131747 1:106611455-106611477 TAGTTGATAAAGCAGTGTCAGGG - Intergenic
912876875 1:113369051-113369073 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
912954248 1:114142541-114142563 TAGTTGATAAAGCAGTGGCAGGG + Intronic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
913082884 1:115405663-115405685 TAGTTGATAAGGCAGTGGCAGGG - Intergenic
913344955 1:117799270-117799292 TAGATGGTAAAGCAGTAGCAGGG - Intergenic
913351077 1:117860095-117860117 TAGTTGGTAAAGCACTGGCAGGG + Intergenic
914677222 1:149914452-149914474 TTGGTGATAAAGCAAGGGCTGGG - Intronic
914709449 1:150199551-150199573 TAGTTGTTAAAGCAGTGGCAGGG - Intergenic
914960328 1:152200032-152200054 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
915006403 1:152641606-152641628 TTTGTGATAAAGCAGCGGCAAGG - Intergenic
915021402 1:152783166-152783188 TTGGTGATAAATCAGCAGCATGG - Intronic
915656732 1:157366900-157366922 TGGGTGAAAAGGAAGGGGCAAGG + Intergenic
915695235 1:157734362-157734384 TAGTTGATAAAGCAGCGGCAAGG + Intergenic
916053618 1:161052703-161052725 CAGGTGATAAGGCAGTGGCCTGG + Exonic
916169534 1:161990827-161990849 TAGTTGATAAAACAGTGGCATGG - Intronic
916304066 1:163309390-163309412 TTGTTGATAAAGCAGTGGCAGGG - Intronic
916553016 1:165867497-165867519 TAGTTGATAAAGCAGTGGCAAGG - Intronic
916778684 1:167998560-167998582 TAGTTGATAAAGCAGCAGCAGGG - Intronic
917669577 1:177260423-177260445 TAGTTGATAAAGCAGTGGCAGGG + Intronic
917951007 1:180036300-180036322 TAATTGATAAAGCAGTGGCAGGG + Intronic
917993655 1:180411278-180411300 CAGTTGATAAAGCAGTGGCAGGG + Intronic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
918361281 1:183760790-183760812 TAGTTGATAAAGTAGCAGCAGGG - Intronic
919288175 1:195593038-195593060 TAGTTGATAAAGCAGTGGCAAGG - Intergenic
919308305 1:195873246-195873268 TAGTTAATAAAGCAGTGGTAGGG - Intergenic
919612928 1:199768630-199768652 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
919816621 1:201444892-201444914 AAGGGGAGAAAGCAGAGGCATGG + Intergenic
920120731 1:203655249-203655271 TAGTTGATAAAGCAGCTGCAGGG + Intronic
920799834 1:209175980-209176002 AAGTTGATAAAGCAGTGGCAGGG + Intergenic
921090923 1:211841789-211841811 TAGTTGATAAAGCAGCGTCAGGG - Intergenic
921121389 1:212140490-212140512 TAAGTGCTAAAGCAGGGCAAAGG - Intergenic
921210601 1:212893467-212893489 TAGCTGATGAAGCAGTGGCAGGG + Intronic
921278282 1:213540799-213540821 AAGTTGATAAAGCAGTGACAGGG - Intergenic
921282440 1:213580474-213580496 TACATGATAAAGCAGTGGTAGGG + Intergenic
921301864 1:213758934-213758956 TAGTTGATAAGGCAGTGGTAGGG + Intergenic
921303845 1:213775844-213775866 TAGTTGATAAAGCAGCAGCAAGG - Intergenic
921571854 1:216789099-216789121 TAGATGATAAAGCAGCAGCAGGG + Intronic
921829083 1:219707000-219707022 TAGTTGATAAAGCAGCTTCAGGG + Intronic
922065368 1:222133547-222133569 TAGCTGATAAAGCAGCAGCAGGG - Intergenic
922197870 1:223375560-223375582 TTGGTGATAATGCAGGGAAAAGG + Intergenic
922624025 1:227019139-227019161 AAGGTGATAGGGCAGAGGCAGGG - Intronic
922658891 1:227411642-227411664 TAGTTGTTAAAGCAGCAGCAGGG - Intergenic
922727810 1:227932170-227932192 TAGTTGATAAAGCAGTGGCAGGG - Intronic
922823282 1:228499298-228499320 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
923339724 1:232997093-232997115 TAGGGGAAAAAGGCGGGGCAGGG - Intronic
923481142 1:234385322-234385344 CAGGTGATAAAGCAGCAGCAGGG - Intergenic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
923885101 1:238146001-238146023 TAGGTGTTGAAGGTGGGGCATGG + Intergenic
924079067 1:240373471-240373493 TAGTTGATAAAGCAGCAGCAGGG - Intronic
924080806 1:240395846-240395868 TAGTTGACAAAGCAGCAGCAGGG + Intronic
924259833 1:242217963-242217985 TAGTTGATAAAGCAGTGGAAGGG + Intronic
1062777092 10:160614-160636 TAGTTGATAAAGCAGCAGTAGGG - Intronic
1062865917 10:853973-853995 TAGCTGATAAAGCAGCAGCAGGG - Intronic
1063329379 10:5141073-5141095 TAGTTGATAAAGCAGTGGCTGGG - Intergenic
1063821468 10:9841326-9841348 TAGCTGATAAAGCAGTAGTAAGG + Intergenic
1063824883 10:9884865-9884887 TAGTTGATAAAGCAGCCCCAGGG - Intergenic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064491809 10:15866025-15866047 TAGTTGATAAAGCAGCAGCTGGG - Intergenic
1064788268 10:18924051-18924073 TAGTTGATAAAGCAATGGCATGG - Intergenic
1065358280 10:24864272-24864294 TAGTTGATAAAGCAGTAGCATGG + Intronic
1065687183 10:28297822-28297844 TGGTTAATAAAGCAGTGGCAGGG - Intronic
1065899692 10:30194843-30194865 CAGTTGATAAAGCAGTGGCAGGG + Intergenic
1066051006 10:31635415-31635437 AAGTTGATAAAGCAGTGACAGGG + Intergenic
1066267014 10:33786183-33786205 TAGTTGATAACACAGTGGCAGGG + Intergenic
1066374816 10:34848331-34848353 TAGTTGATAAAGGAGTGGTAGGG - Intergenic
1067737856 10:48872456-48872478 AATGAGATAAAGCAGGTGCAGGG + Intronic
1067856460 10:49797624-49797646 TATGTGATAAAGTAGGGGTCAGG - Intergenic
1068103447 10:52584251-52584273 TAGTAGATAAAGCAGTGGCATGG + Intergenic
1068482425 10:57609613-57609635 TAGTTAATAAAGCAGTGGCAAGG + Intergenic
1068717148 10:60200912-60200934 TTGGTGAAAAAGTAGGGGGAGGG - Intronic
1069087033 10:64152592-64152614 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1069196764 10:65560713-65560735 TAGTTGATAAAGCAGTGGTAGGG - Intergenic
1069318942 10:67143529-67143551 TAGTTGAAAAAACAGTGGCAGGG - Intronic
1069334948 10:67337514-67337536 TAGTTGATAAAGCAGTAGCCGGG + Intronic
1069736566 10:70659770-70659792 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1070360944 10:75688611-75688633 TAGTTGAAAAAGCAGAAGCAGGG + Intronic
1070420670 10:76233604-76233626 TAGATGATAAAGCATAGGCAGGG - Intronic
1070606967 10:77905526-77905548 TAGTTGACACAGCAGGGACAAGG - Intronic
1070924335 10:80208125-80208147 TAGGTGAGAAAGCCGAGGCTCGG - Intergenic
1070984497 10:80677038-80677060 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1071142155 10:82521791-82521813 TAGTTGATAAAGCAGCTGCTGGG - Intronic
1071400733 10:85267456-85267478 TAGCTGATAAATCAGTGGCAGGG - Intergenic
1071438995 10:85673336-85673358 TAGTTGATGAAGAAGTGGCAAGG + Intronic
1071851532 10:89576219-89576241 CAGGTGATAAAGCATCGGCAGGG - Intergenic
1072094632 10:92165648-92165670 TAGTTGATAAAGCTGTTGCAGGG - Intronic
1072166638 10:92819845-92819867 TAGTTGATAAAGCAGTAGCAGGG - Intergenic
1072232384 10:93424708-93424730 TGGGTGCATAAGCAGGGGCAGGG + Intronic
1072259285 10:93652987-93653009 TAGGAAAAAAAGCAGGGGGAGGG - Intronic
1072473841 10:95739377-95739399 TACTTGATAAAGCAGCAGCAGGG - Intronic
1072565801 10:96615729-96615751 CAGGTGAGAAAGAAGAGGCATGG + Intronic
1072972408 10:100028690-100028712 TAGGAGGCAAAGCTGGGGCAGGG - Intergenic
1073598875 10:104826852-104826874 GAGTGGATAAAGCAGTGGCAGGG - Intronic
1073613730 10:104971424-104971446 AAGGTGAGAAAGCAGAGTCAAGG + Intronic
1073681637 10:105710860-105710882 TAGTTGACAAAGCAGTGACAGGG + Intergenic
1074284445 10:112084853-112084875 TAGGTAATTAAGGAGGGGCAGGG + Intergenic
1074474528 10:113757790-113757812 TAGTTGATAAATCAGTGTCAGGG - Intronic
1074502781 10:114041935-114041957 CAGCTGATAAATCATGGGCAGGG + Intergenic
1075034425 10:119052163-119052185 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1075225264 10:120623266-120623288 TAGTTAATAAAGCAGTGGCACGG + Intergenic
1075750968 10:124770721-124770743 TAGTTGATAAAGCAGTAGCAAGG - Intronic
1075841206 10:125505725-125505747 TAGTTGATAAGGCAGTGGCAGGG + Intergenic
1075847883 10:125560757-125560779 TAGTTGATAATGCAGTGGCAGGG + Intergenic
1076276271 10:129201514-129201536 TAGTTGATAAAGCAGTGGTAAGG - Intergenic
1076549046 10:131266017-131266039 GAGTTGATAAAGCAGCAGCAGGG - Intronic
1077347175 11:2067302-2067324 TAGTTGATAAGGCAGTGGCAGGG - Intergenic
1077616661 11:3680202-3680224 TAGTTGATAAAGCAGCAGCTGGG - Intronic
1078117610 11:8469235-8469257 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1078193537 11:9114380-9114402 TAGCTGATTAAGCAGCGGCAGGG - Intronic
1078306882 11:10197736-10197758 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1078398767 11:11004902-11004924 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1078638140 11:13071176-13071198 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1078995717 11:16696936-16696958 TAGTTAATAAAGCAGCAGCAGGG - Intronic
1079132805 11:17758084-17758106 CAGCTGATAAAGCAGCAGCAGGG - Intronic
1079613959 11:22467667-22467689 TAGGTGCAAGGGCAGGGGCAGGG + Intergenic
1079722310 11:23833136-23833158 TAGTTGATGAAGCAGCAGCAAGG - Intergenic
1079776389 11:24535423-24535445 TGGTTGATAAAGAAGTGGCAGGG - Intronic
1079869543 11:25780695-25780717 GAGGTGTTCAGGCAGGGGCAGGG - Intergenic
1080070700 11:28082196-28082218 TAGCTGATAGAGCAGTGGCAAGG + Intronic
1080171232 11:29305503-29305525 TAGTTAATAAAGCAGTGGCAGGG + Intergenic
1080884897 11:36358168-36358190 TAGTTGATAAAGCAGCGGCAGGG + Intronic
1081071431 11:38615064-38615086 TAGTTGATAAAGCAGAGGCAGGG - Intergenic
1081186146 11:40044906-40044928 TAGTTGAAAAAGTAGTGGCAGGG - Intergenic
1081233248 11:40613271-40613293 TAGTTGACAAAGCATAGGCAAGG - Intronic
1081652970 11:44837512-44837534 TAGTTGCTAAAGCAGTGGCAGGG + Intronic
1081754535 11:45535222-45535244 TAGGTGTTTGAGCAGGAGCATGG - Intergenic
1081952932 11:47061186-47061208 TTGGTGATAAAGCAGTGACTGGG + Intronic
1082230116 11:49753762-49753784 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1082686385 11:56243742-56243764 TAAGTAATAAAGCAGTGGCAGGG - Intergenic
1082922920 11:58515122-58515144 TAGTTGATAAAGCACTGGGAAGG - Intergenic
1082971510 11:59027401-59027423 TAGTTGATAAAGCAGTAGCAGGG - Intronic
1083135297 11:60668729-60668751 TAGTTGATAAAGCACTGTCAAGG + Intergenic
1084668411 11:70590367-70590389 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1084847892 11:71914901-71914923 TAGTTGATGAAGCAGTGGCTGGG + Intronic
1085233882 11:74996297-74996319 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1085367048 11:75958342-75958364 TAGTTGATAAAACAGTGGCAGGG - Intronic
1085529906 11:77185351-77185373 TAATTGATAAAGCAGCAGCAGGG - Intronic
1085724949 11:78947012-78947034 TAGTTGATAAGGCAGAAGCAGGG + Intronic
1085828588 11:79874715-79874737 TGTTTGATAAAGCAGTGGCAGGG - Intergenic
1085927865 11:81043624-81043646 TAATTGATAAAGCAATGGCAGGG - Intergenic
1086318728 11:85621845-85621867 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1086323438 11:85673775-85673797 CAGTTGATAAAGCAGCCGCAGGG - Intronic
1086481999 11:87251164-87251186 CAGGTGATAAATCTGGGTCAGGG + Intronic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1086619934 11:88875186-88875208 TAGTTAATAAAGCAGCAGCAGGG - Intronic
1087064746 11:94017436-94017458 TAGTTGATAAAGCAGGAGCAGGG + Intergenic
1087608713 11:100408486-100408508 TAGTTGATAAAGCAGTGGTAGGG - Intergenic
1088463003 11:110102606-110102628 TAGTTGACAAAGCAGTGGCAAGG + Intronic
1088802901 11:113322756-113322778 TAGGTGAGATAGCAGGGCAAGGG + Intronic
1088856130 11:113755594-113755616 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1090218096 11:124988678-124988700 TAGCTGATAAAGCAGTGGCAGGG - Intronic
1090813260 11:130266909-130266931 TTGTTGATAAAGCAGTGGCAGGG + Intronic
1091426862 12:398246-398268 TAGTCGATAAAGCAGTTGCAGGG - Intronic
1091515394 12:1175365-1175387 TAGTTGATGAAGCAGTGCCACGG - Intronic
1091539208 12:1443805-1443827 TAGCTGTTCAAGCAGGGGAAAGG + Intronic
1092152229 12:6257597-6257619 TAGTTGATAAAACAGTGGCAGGG - Intergenic
1092622786 12:10291428-10291450 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1092623465 12:10299839-10299861 TAGTTGATAAAGCAACGGCAAGG - Intergenic
1092686649 12:11056510-11056532 TAGGTGATAATACTGAGGCAGGG - Intronic
1092966038 12:13643696-13643718 TAGTTGATAAAGCAGTAGTAGGG - Intronic
1093002411 12:14012393-14012415 TAGATGATAAAGCAATGGCAGGG - Intergenic
1093252765 12:16827943-16827965 TAGTTAATGAAGCAGTGGCAGGG + Intergenic
1093435022 12:19126805-19126827 TAGTTGATAAAGTAGTGGCAGGG - Intergenic
1093528643 12:20135373-20135395 GAGGTAATCAGGCAGGGGCAAGG + Intergenic
1093575330 12:20721153-20721175 TAGTTGATAAAGCAGTGTCAGGG + Intronic
1093622662 12:21310975-21310997 TAGGTGATAAGGCAGCAGTAGGG - Intronic
1093823137 12:23646610-23646632 TAGTTGATGAAGCAGTGGCAGGG - Intronic
1094279948 12:28725613-28725635 TAGCAGATAAATCAGTGGCAGGG - Intergenic
1094465356 12:30748142-30748164 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1095168867 12:39009258-39009280 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
1095208815 12:39469343-39469365 TAGTTGATAAAGTAGCAGCAGGG + Intergenic
1095325651 12:40888858-40888880 TAGATGCTAAATCAGGGGAAAGG - Intronic
1095657942 12:44692967-44692989 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1095754481 12:45748689-45748711 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1095791099 12:46168050-46168072 TAATTGATAAAGCAGTGGCAGGG - Intergenic
1095881879 12:47146364-47146386 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1095910628 12:47423217-47423239 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1096440553 12:51639361-51639383 TAGTTGATAAAGTAGCAGCAAGG + Intronic
1097206684 12:57327926-57327948 AAGTTGATAAAGCAGTGGCAGGG + Intronic
1097260351 12:57716316-57716338 TTGGTGATAGAGGAGGGGAAGGG + Intronic
1097392369 12:59031360-59031382 TAGGTGACAAAGCTGGGGTTTGG + Intergenic
1097453698 12:59768546-59768568 TAGTTGATAAAGCAGTGGAAAGG + Intronic
1097659401 12:62412509-62412531 TAGTTGATGAAGCAGTGGCGGGG - Intronic
1097788396 12:63787141-63787163 TAGTTGATAAAGCAGCAGTAGGG - Intronic
1098344575 12:69488123-69488145 GAGTTGATAAAGCAGTGACAGGG + Intronic
1098889874 12:75999039-75999061 TAGATGATAAAGCAGTGGCAGGG - Intergenic
1098936994 12:76491219-76491241 TAGTTGATAAAACAGCGGCAGGG + Intronic
1099052405 12:77796524-77796546 TAGATGATAAGGCAGTGGCTGGG + Intergenic
1099128580 12:78797240-78797262 TAGTTGATAAAGTAGTGGCAGGG + Intergenic
1099162109 12:79255024-79255046 TATTTGATAAAGCAGTGGCAGGG + Intronic
1099252640 12:80275554-80275576 TAGTTGATAAAGCAGTGGTAGGG + Intronic
1099461527 12:82927524-82927546 TAGTTGATAAAGCAGTTGCAGGG + Intronic
1099507268 12:83494761-83494783 TAGGCAATAAAGCAGTGGCAGGG - Intergenic
1100009685 12:89938315-89938337 TAGGTGAGAAAACTGAGGCATGG + Intergenic
1100117336 12:91323206-91323228 TAATTGATAAAGCAGCAGCAGGG - Intergenic
1100169367 12:91956540-91956562 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1100516168 12:95329887-95329909 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1100618855 12:96252848-96252870 TAGTTGATAAAGCAGCGGCAGGG + Intronic
1100791009 12:98129977-98129999 TAGTTGATAAAGCAGCAACAGGG - Intergenic
1100922975 12:99510691-99510713 TCATTGATAAAGCAGTGGCAGGG + Intronic
1100927127 12:99561295-99561317 TAGTTGATAAAGTAGTGGCAGGG - Intronic
1101143588 12:101820609-101820631 TGGTTGATACAGCTGGGGCATGG - Intronic
1101684269 12:107001641-107001663 TAGGAGAGAAAGAAAGGGCAGGG - Intronic
1101685255 12:107013076-107013098 TAGTTGATGAAGCAGTGGCAGGG + Intronic
1101805084 12:108056638-108056660 GTGGAGATAAAGCAGAGGCATGG - Intergenic
1102142056 12:110623077-110623099 GAGCTCATAAAGCAGGAGCAGGG - Intronic
1102601507 12:114034534-114034556 TAGTTGATAAAGCAGTGGCAAGG + Intergenic
1102764676 12:115422473-115422495 GAGCAGAGAAAGCAGGGGCAAGG - Intergenic
1103048301 12:117757448-117757470 TAGTTGACAAAGCAGTGGCAGGG + Intronic
1104113796 12:125729349-125729371 CAGCTGATAAAGCAGGAGCAGGG + Intergenic
1104350303 12:128039412-128039434 GAGCTGATAAATCAGGGGTAGGG - Intergenic
1105393200 13:20001590-20001612 TAGTTGATAAAGGAGTTGCAGGG + Intronic
1105547756 13:21364173-21364195 CAGTTGATAAAGCAGTGGCAGGG + Intergenic
1105589758 13:21781017-21781039 TAGGTGACAAAGCAGTGACAAGG + Intergenic
1105886890 13:24649918-24649940 AGGGCGATAAGGCAGGGGCAAGG - Intergenic
1106055268 13:26231326-26231348 TAGGATATCAAGCAGGGGAAGGG - Intergenic
1106071772 13:26419182-26419204 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1106311508 13:28558735-28558757 TAGGTGAGTGAGCTGGGGCAAGG - Intergenic
1106497646 13:30295749-30295771 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1106989308 13:35398043-35398065 TAATTGATAAAGCAGCTGCAGGG - Intronic
1107257993 13:38453825-38453847 TAGTTGACAAAGCAGTGGCAGGG + Intergenic
1107689421 13:42937485-42937507 TAGCTGATAAAGTGGTGGCAGGG - Intronic
1108278207 13:48833194-48833216 TAGCTGATGAAGCAGTGGCAAGG + Intergenic
1108819953 13:54336218-54336240 TAGGTCATAAAACATGGGAAAGG + Intergenic
1109024475 13:57141220-57141242 GAGGTGACAAGGCAGGGGGATGG - Intronic
1109025462 13:57147790-57147812 GAGGTGACAAGGCAGGGGGATGG - Intronic
1109026452 13:57154363-57154385 GAGGTGACAAGGCAGGGGGATGG - Intronic
1109027444 13:57160934-57160956 GAGGTGACAAGGCAGGGGGATGG - Intronic
1109028430 13:57167499-57167521 GAGGTGACAAGGCAGGGGGATGG - Intronic
1109126066 13:58518688-58518710 TACTTAATAAAGCAGTGGCAGGG + Intergenic
1109131427 13:58591114-58591136 TACTTGATAAAGCAGTGGCAGGG + Intergenic
1109245815 13:59953537-59953559 TAGGAGATAAAGAATGGGTAAGG + Intronic
1109304296 13:60621552-60621574 TTGCTGCTAAATCAGGGGCATGG + Intergenic
1109308280 13:60663665-60663687 GAAGTGATCAAGCAGAGGCAGGG - Intergenic
1109532923 13:63676513-63676535 TAGTAGGTAAAGCAGTGGCAGGG - Intergenic
1109853416 13:68098924-68098946 AAGCTGATAAAGCAGCAGCAAGG - Intergenic
1110338566 13:74362410-74362432 TAGGTTATAAAGGAGAGGAATGG + Intergenic
1110640216 13:77815118-77815140 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1110723993 13:78798203-78798225 TAGTTGATAAAACAGGAGCAGGG - Intergenic
1110735634 13:78933167-78933189 TAATTGATAAAGCAGTGTCAGGG + Intergenic
1110735972 13:78937001-78937023 TAAGAGATAAATAAGGGGCAAGG - Intergenic
1110786246 13:79530573-79530595 TAACTGACAAAGCAGTGGCAGGG - Intronic
1110829654 13:80016128-80016150 CAATTGATAAAGCAGTGGCAGGG + Intergenic
1110865972 13:80396856-80396878 TAGCTGATAAAGCAGTGTCAGGG - Intergenic
1110946900 13:81433137-81433159 TAGCTGATAAAGCAAGAGCAGGG + Intergenic
1111172685 13:84549451-84549473 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1111211428 13:85084775-85084797 TAGTGGATAAAGCAGTGGCAGGG - Intergenic
1111233780 13:85380882-85380904 TAGTTAATAAAGCAGCAGCAGGG + Intergenic
1111324150 13:86669404-86669426 TAGTTAATAAAGCAGCAGCAGGG - Intergenic
1111366106 13:87247476-87247498 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1111437533 13:88229711-88229733 TAGTTAATAAAGCAGCAGCAGGG - Intergenic
1111787252 13:92804808-92804830 TAGTTGATAAAGCAGCAGCAAGG - Intronic
1111840063 13:93438743-93438765 TAGTTGAGAAAGCAGCAGCAGGG + Intronic
1111956490 13:94764600-94764622 TTGTTGATAAAGCAGCTGCAGGG + Intergenic
1112208659 13:97350546-97350568 TAGTTGATAAAGTAGCAGCAGGG - Intronic
1112856628 13:103778563-103778585 TAGTTGATAAAGCAGTGGCGAGG - Intergenic
1113486856 13:110660004-110660026 TAGTTGATAAAGCAATGGCAGGG - Intronic
1113649106 13:112022361-112022383 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1113695163 13:112340823-112340845 TAGTTGATAAAGCATTGGCAAGG + Intergenic
1113712922 13:112482045-112482067 CAGTTGATAAAGCAGTGGCAGGG - Intergenic
1113722553 13:112570809-112570831 TAGTTGATAAAACAGTGGCAGGG - Intronic
1113991654 14:16032295-16032317 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1114152307 14:20057080-20057102 TAGGTGATAAAGTAGCAGCAAGG - Intergenic
1114714499 14:24810382-24810404 TGGGAGGTAAAGGAGGGGCAGGG + Exonic
1114977453 14:28119601-28119623 TATTTGATAAATCAGAGGCAGGG + Intergenic
1115136425 14:30114313-30114335 TAGTTGATAAAGCAGCATCAGGG + Intronic
1115154823 14:30326297-30326319 TAGTTGATAAAGCAGTAGGATGG + Intergenic
1115258945 14:31433085-31433107 TTGTTGATAAAGCAGTGGCAGGG + Intronic
1115280357 14:31654859-31654881 TAATTGATAAAGCAGTGACAGGG - Intronic
1115293532 14:31799951-31799973 TAGTTGATAAAACAGAAGCATGG - Intronic
1115308349 14:31954992-31955014 TAGTTGATAAAGCAGTGACAAGG + Intergenic
1115379023 14:32712535-32712557 TAGTTGATAAAGCAGCGGCAGGG - Intronic
1115426725 14:33269317-33269339 TAGATGAGAAAGCAGAGGCATGG + Intronic
1115498082 14:34026726-34026748 TAGCTGATAAAGCAGCAGCAGGG - Intronic
1115542290 14:34432500-34432522 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1115740922 14:36387284-36387306 TAATTGATAAAGCAATGGCAGGG + Intergenic
1115795468 14:36930594-36930616 TAGATGATACAGCAGGGGCTGGG - Intronic
1115795508 14:36930927-36930949 TAGATGAAGAAGCAGGGGGATGG - Intronic
1115897171 14:38103734-38103756 TAGCTGATAAAGCAGAAACAGGG + Intergenic
1116028069 14:39537870-39537892 GTGGTGATCAGGCAGGGGCAGGG - Intergenic
1116101121 14:40437943-40437965 TAGTTTATAAAGCAGCAGCAGGG - Intergenic
1116387847 14:44354409-44354431 TAATTGATAAAGTAGTGGCAAGG - Intergenic
1116476035 14:45340661-45340683 TAGCTGACAAAGCAGCAGCAGGG - Intergenic
1116604975 14:46980488-46980510 TCATTGATAAAGCAGTGGCAGGG + Intronic
1116925154 14:50626945-50626967 TAGTTGATAAAGCATTGGCAGGG + Intronic
1117169367 14:53076545-53076567 TAGTTGATAAGGCAGTGGCAGGG + Intronic
1117231360 14:53722618-53722640 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1117296493 14:54384785-54384807 CAGTTGATAAAGCAGCAGCAGGG + Intergenic
1117351693 14:54887479-54887501 TCTCTGATAAAGCAGTGGCAGGG + Intronic
1117464756 14:55981812-55981834 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1117926665 14:60787644-60787666 TAGTTGATAAAGCTGTGGCAAGG - Intronic
1118037745 14:61886419-61886441 TAGTTGATAAAGAAGTGGCAAGG - Intergenic
1118176534 14:63445986-63446008 TAGTTGATCAAGCAGTGGCAGGG - Intronic
1118507860 14:66434243-66434265 TAGTTGATAAAGCTGTAGCAGGG + Intergenic
1118518203 14:66550539-66550561 TAGTTGATAAAGCAGTAGCAGGG + Intronic
1118655982 14:67949281-67949303 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1118662496 14:68029335-68029357 TAGCTGATAAAGCAGTGGCAGGG - Intronic
1118692932 14:68357130-68357152 TAGTTGACAAAGCAGTGGCAGGG - Intronic
1118803309 14:69211180-69211202 TAGTTGATAAAGCAATGGCAGGG - Intronic
1119091714 14:71788630-71788652 TAACTGATAAAGCAGCGGTAGGG + Intergenic
1119145249 14:72306869-72306891 TAGTTGATAAGGCAGCAGCAGGG + Intronic
1119991060 14:79197884-79197906 TAGTTGAAAAAGCAATGGCAGGG - Intronic
1120152357 14:81051066-81051088 TAGTTGATAAAGCAGAAGCAGGG - Intronic
1120244337 14:81988830-81988852 TAGTTGATAAAGCAATGTCAGGG + Intergenic
1120323641 14:82997952-82997974 TCATTGATAAAGCAGTGGCAGGG - Intergenic
1120329189 14:83067418-83067440 TAATTGATAACGCAGTGGCAGGG - Intergenic
1120755216 14:88237080-88237102 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1121252263 14:92508251-92508273 TAGTTGATAAAGCAGCAGCTGGG - Intergenic
1121296461 14:92829724-92829746 TAGTTGATGAAGCACTGGCAGGG + Intronic
1121461582 14:94083387-94083409 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1121910506 14:97786899-97786921 TAGTTTATAAAGCAGCAGCAGGG + Intergenic
1122001479 14:98659626-98659648 TAGTTGATAAAGCAGTGATAGGG + Intergenic
1122662327 14:103305483-103305505 CAGTTGATAAAGCAGTGGCAGGG - Intergenic
1122837894 14:104439339-104439361 TAGTTGATGGAGCAGTGGCAAGG - Intergenic
1124093472 15:26627812-26627834 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1124397287 15:29314215-29314237 TAGTTCATAAAGCAGCAGCAGGG + Intronic
1124461153 15:29893367-29893389 TAGCTGATAAAGCAGTGACAGGG + Intronic
1124639389 15:31387113-31387135 TAGTTGATAAAGCAGTGCCAGGG + Intronic
1125000395 15:34763771-34763793 TAGTTGATAAAGTAGTGGCAGGG - Intergenic
1125109088 15:36009842-36009864 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1125236586 15:37521789-37521811 TAGTTGATAAAGTCGAGGCAGGG - Intergenic
1125252601 15:37723034-37723056 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1125366710 15:38925082-38925104 TAATTGATAAAGCAGTGGCAAGG - Intergenic
1126151115 15:45524331-45524353 TAGTTGATAAAGCAGAGGCAGGG - Intergenic
1127081255 15:55382309-55382331 TAGTTAATAAAGCAGTGGCAGGG - Intronic
1127206041 15:56720176-56720198 TAGTTGATAAAGCACCAGCAAGG - Intronic
1127549702 15:60024720-60024742 TAGGTGCTCAAACAGGGCCAAGG - Intronic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127916906 15:63462125-63462147 CAGGCAATCAAGCAGGGGCAAGG + Intergenic
1128174087 15:65538617-65538639 TAGTTAATAAAGCAGTGGCAGGG + Intronic
1128395242 15:67218329-67218351 CAGGTGATAAAGCTGGGGCAGGG + Intronic
1128685525 15:69681872-69681894 TAGTTGATAAAGCGGGAGCAGGG - Intergenic
1128848814 15:70929692-70929714 TAGTTGATAAAGCACCAGCAGGG - Intronic
1128955414 15:71937203-71937225 GAGTTGATAAAGCAGTGGCAGGG + Intronic
1128969691 15:72097090-72097112 TAGTTGATAAAGCAGCTGCAGGG + Intronic
1129948937 15:79568912-79568934 TAGTTGATAAAGCTGCAGCAGGG + Intergenic
1130276264 15:82477801-82477823 AAGGTGGCAAAGTAGGGGCAGGG + Intergenic
1130468625 15:84205194-84205216 AAGGTGGCAAAGTAGGGGCAGGG + Intergenic
1130485124 15:84394568-84394590 AAGGTGGCAAAGTAGGGGCAGGG - Intergenic
1130495650 15:84468385-84468407 AAGGTGGCAAAGTAGGGGCAGGG - Intergenic
1130590918 15:85209793-85209815 AAGGTGGCAAAGTAGGGGCAGGG + Intergenic
1130867392 15:87944480-87944502 CAGGTGAGAAAACAGAGGCAGGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133684824 16:8156434-8156456 TAATTGATAAAGCAGTGGTAGGG + Intergenic
1134247687 16:12552231-12552253 TAGGAGGCAAAGCTGGGGCATGG - Intronic
1134456969 16:14401980-14402002 TAGTTCATAGAGGAGGGGCAGGG - Intergenic
1136509022 16:30724470-30724492 TGGGTGCTAAAGCTGGGGCTAGG - Exonic
1136540678 16:30926193-30926215 GGGGTGATAGAGCAGGGGCTGGG - Intronic
1136624981 16:31456851-31456873 AAGGGGATAAGGCAGGGGAAGGG + Intergenic
1136910962 16:34143866-34143888 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1137066654 16:35853326-35853348 AACGTAATAAAGCAGTGGCAGGG - Intergenic
1137261435 16:46833045-46833067 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1137337320 16:47562864-47562886 TAGCTGATAAAGCAGTGGCAGGG - Intronic
1137514193 16:49128690-49128712 GAAGTGATGAAGCTGGGGCAAGG - Intergenic
1137988869 16:53131716-53131738 GAGGCGAGAAAGCACGGGCAGGG - Intronic
1138023241 16:53503223-53503245 GCGGGGATCAAGCAGGGGCAGGG - Exonic
1138255354 16:55553332-55553354 TAGTTGATAAAGCAATGACAGGG - Intronic
1138750488 16:59413909-59413931 TAGTTGAGAAAGTAGTGGCAGGG - Intergenic
1138909246 16:61376563-61376585 AAGTAGATAAAGCAGGGGAAAGG - Intergenic
1139059032 16:63225948-63225970 TAGTTGATAAAGCAGTGGCAAGG - Intergenic
1139061949 16:63263593-63263615 GAGGTGTTCAGGCAGGGGCAGGG + Intergenic
1140492925 16:75355381-75355403 TAGTTGATAAAGCAATAGCAGGG - Intronic
1140595714 16:76407782-76407804 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1140650276 16:77080639-77080661 TAGTTGATAAGGCATTGGCAGGG - Intergenic
1141304626 16:82850549-82850571 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1142953221 17:3501611-3501633 TAGTTGATAAAGCAGCAGCAGGG + Exonic
1144165498 17:12606145-12606167 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1144849860 17:18238604-18238626 GAGATGGTAAGGCAGGGGCAGGG + Exonic
1144955824 17:19018331-19018353 AAGGGGATGAAGCTGGGGCATGG - Intronic
1145377441 17:22363905-22363927 TAGTTGATAGAGGAGTGGCAGGG - Intergenic
1146158504 17:30545335-30545357 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1146359998 17:32166569-32166591 TAGTTGATAAAGCAGCAGTAGGG - Intronic
1146538909 17:33677882-33677904 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1146838308 17:36130724-36130746 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1147390259 17:40104982-40105004 TTGGTGAGAAAGGAGGGGGATGG - Intergenic
1147554845 17:41471271-41471293 TAGTTAATAAGGCAGTGGCAGGG - Intergenic
1147795351 17:43038409-43038431 TAGGTGCTAAAACAGGTCCAGGG - Intergenic
1148080942 17:44967516-44967538 TAGGTGAAAAAGTAGGTGCCGGG + Exonic
1148660051 17:49323179-49323201 TAGTTGATAAAGCAGTGGCTGGG - Intronic
1148692412 17:49537792-49537814 TAGTTGATAAAGGAGTGGTAGGG - Intergenic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148803603 17:50251151-50251173 TAGCTGATAAAGCAGCAGTAGGG - Intergenic
1148990347 17:51660732-51660754 GAGGTGTTTAAGCAGGGGTAAGG - Intronic
1149100088 17:52895240-52895262 TACTTGATAAAGCCGAGGCAGGG - Intronic
1149219499 17:54399840-54399862 TAGTGGATAAACCAGTGGCAGGG + Intergenic
1149299537 17:55292149-55292171 TAGTTGGTATAGCAGTGGCAGGG + Intronic
1149518281 17:57297725-57297747 TAGGTGAAAAAGCAGCTGCAGGG - Intronic
1149809248 17:59651950-59651972 TAGCTAATAAAGCAGTGGCAGGG - Intronic
1149875929 17:60233064-60233086 AAGGTCATAAAGCAAGTGCAAGG + Intronic
1150102554 17:62436878-62436900 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1150174381 17:63034947-63034969 TAGTTGATAAAACAGTGCCAGGG + Intronic
1150833716 17:68545741-68545763 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1151027547 17:70696468-70696490 TAGTTAATAAAGCTGTGGCAAGG + Intergenic
1151309088 17:73282515-73282537 GAGGTGGTAGGGCAGGGGCAGGG + Intergenic
1151410924 17:73928653-73928675 TTATTGATAAAGCAGAGGCAGGG + Intergenic
1151539904 17:74759536-74759558 TGGGTGACAGGGCAGGGGCATGG - Intronic
1151808209 17:76419958-76419980 GAGGTGATGAAGGAGGGGCAGGG - Intronic
1152879949 17:82808910-82808932 GAGGGGATAAGGCAGGTGCAGGG + Intronic
1152979114 18:256720-256742 TAGTTGATAAAGTAGCGGCAGGG + Intronic
1153060056 18:985847-985869 TGTGTGATAAAGTAGGGGGAGGG - Intergenic
1153133014 18:1879344-1879366 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1153181456 18:2439585-2439607 TACTTGATAAAGCAGCAGCAGGG - Intergenic
1153270449 18:3315877-3315899 TACTTGATAAAGCAGCGGCAGGG - Intergenic
1153976895 18:10276941-10276963 TAGCTGATATATCAGGGACAGGG - Intergenic
1154096468 18:11420789-11420811 TAGTTGATAAAGCAGCAGTAGGG - Intergenic
1154219970 18:12443552-12443574 TAGTTGATAAAGCAGCGGCAGGG - Intergenic
1154227768 18:12523415-12523437 TAGTTGATAAAGCAGCAGGAGGG + Intronic
1154249282 18:12729641-12729663 TAGTTGACAAAGCAGCGGCAGGG - Intergenic
1155265990 18:24094070-24094092 TAGTTGATAAGGCAGTGGTAAGG - Intronic
1155741378 18:29292255-29292277 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1155827351 18:30464510-30464532 TAGTTGATAAAGCAATGACAGGG - Intergenic
1156168374 18:34451580-34451602 TAGTTGATAAAGCAGTGACAAGG - Intergenic
1156181914 18:34614845-34614867 TAGTTGATAAGGCAGTGACAGGG + Intronic
1156281064 18:35639080-35639102 TAGTTGATAAAGCAGTGGCAAGG + Intronic
1156288117 18:35719801-35719823 TAGTTGATAAAGCAGAGGGAAGG + Intergenic
1156321113 18:36023526-36023548 TACTTGATAAAGCAGTAGCAGGG + Intronic
1157010132 18:43637825-43637847 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1157171103 18:45406163-45406185 TAGTTAATAAAGCAGTGGCAGGG - Intronic
1157706702 18:49813588-49813610 TAGGTGAAAGGGCAGGGGCGTGG - Exonic
1158068648 18:53444086-53444108 TAGTTGATAAAGCAGTGGTAGGG + Intronic
1158471128 18:57737910-57737932 TCAGTGAGAAAGCAGGAGCAGGG + Intronic
1158697473 18:59715769-59715791 TAGGTGAGAAAACTGAGGCATGG + Intergenic
1158757423 18:60343175-60343197 TAGTTGATGAAGCAGCGGCAGGG + Intergenic
1158783516 18:60680297-60680319 TAGGTGATAGTGCAATGGCATGG - Intergenic
1158790291 18:60772391-60772413 TAGTTGATAAATCAGAAGCAGGG - Intergenic
1158978281 18:62733064-62733086 TAGTTGATAAAGGAGCAGCAGGG + Intronic
1158990031 18:62858756-62858778 TAGATAATAAAGTAGGGGCAAGG - Intronic
1159226602 18:65545480-65545502 AAGGGGATAAGGCTGGGGCAGGG + Intergenic
1159401702 18:67945536-67945558 TTGTTGATAAAGCAGTGACAGGG - Intergenic
1159740859 18:72168403-72168425 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
1160117291 18:76092005-76092027 TAGCTGAGAAAGCACTGGCAGGG - Intergenic
1160546319 18:79658679-79658701 GAGTTGATAAAGCAGCGGCAGGG - Intergenic
1160552287 18:79702052-79702074 TAGTTGGTAAACCAGCGGCAGGG + Intronic
1161494170 19:4578696-4578718 AAGGTTATAGAGCAGGGGGAGGG - Intergenic
1162844030 19:13378344-13378366 TAGTTGACAAAGCAGTGGCAGGG + Intronic
1163176580 19:15568295-15568317 CAGGTGATAGAGCAGGGGATAGG - Intergenic
1164326237 19:24194802-24194824 CAGGTGAAAAAGAATGGGCATGG - Intergenic
1165686659 19:37827671-37827693 TAGTTGATACAGCAGTGGCAGGG + Intergenic
1165941976 19:39419160-39419182 AAGGTCACAAAGCAGGGACATGG - Intronic
1166580059 19:43888663-43888685 TAGTTGATAAAGCAGCACCAGGG - Intronic
1166622259 19:44311934-44311956 TAGGTGATAAAGCAGTGGCAGGG - Intergenic
1167021399 19:46879058-46879080 TAGCTGATAAAGTAGCAGCAGGG - Intergenic
1167627117 19:50598435-50598457 TAGTTGATAAAGCAATGGCATGG + Intergenic
1168269509 19:55241896-55241918 TGTGTGGTAAGGCAGGGGCACGG + Intronic
1168533794 19:57152069-57152091 TAGTTAAGAAAGCAGTGGCAGGG + Intergenic
924989795 2:303256-303278 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
925104293 2:1277148-1277170 TAGCTGATAAAGTAGCAGCAGGG + Intronic
925153136 2:1630425-1630447 TATGTGATAAAGCAGCAGCAGGG + Intergenic
925168450 2:1734930-1734952 TAGTGGATAAAGCAGTAGCAGGG - Intronic
925215416 2:2090761-2090783 CAGTTGATAAAGCAGCAGCAGGG - Intronic
925279886 2:2676365-2676387 TAGTTGAAGAAGCAGGGGTAAGG + Intergenic
925413704 2:3655172-3655194 AAGGAGAAAAGGCAGGGGCAGGG + Intergenic
925679409 2:6402637-6402659 TAGTTGATAAAGCAGCAGCAAGG - Intergenic
925955115 2:8955660-8955682 TAGTTGATAAAGCAGCAGCAGGG + Intronic
926032046 2:9600311-9600333 TAGTTGATAGAGCAGTGGCAGGG + Intronic
927105818 2:19824111-19824133 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
927188042 2:20496613-20496635 TAGAAGACAAAGCAGGGTCAGGG + Intergenic
927731505 2:25476840-25476862 TAGTTGACAAAGCAGTGGCAGGG + Intronic
927850210 2:26494125-26494147 TTGCTGATAGAGCAGGGGCCAGG - Intronic
928227286 2:29462255-29462277 TAGCTGATAAAGCAGTAGCAGGG + Intronic
928263884 2:29793075-29793097 TAGTTGATAAAGCAGTGGCAGGG - Intronic
928720191 2:34111819-34111841 TAGTAGATAAAACAGTGGCAGGG + Intergenic
928915997 2:36471247-36471269 TAGTTGATAAAGCAACAGCAGGG + Intronic
929520559 2:42646814-42646836 TAGTTGGCAAAGCAGTGGCAGGG + Intronic
929554681 2:42918505-42918527 TAGATGAGAAAACAGAGGCAAGG + Intergenic
929672992 2:43893264-43893286 TAGTTAATAAAGCAGTGGTATGG + Intronic
929709454 2:44251403-44251425 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
929749824 2:44698853-44698875 GAGTTGATAAAGCAGTGGCAGGG - Intronic
929757952 2:44783562-44783584 GAGTTGATAAAGCAGGGGCAGGG + Intergenic
929939060 2:46316875-46316897 AAGTTGATAAAGCAGTGGCAGGG - Intronic
930322026 2:49867538-49867560 TAGTTGATAAAGCAACAGCAGGG - Intergenic
930351272 2:50258278-50258300 TAGTTGAAAAAGCAGCAGCAGGG - Intronic
930491916 2:52084632-52084654 TAGTTGATAAAACAGCAGCATGG - Intergenic
930831705 2:55750636-55750658 TACTTGATAAAGCAGTGGCAGGG + Intergenic
930839012 2:55825494-55825516 GAAGTGTTCAAGCAGGGGCAGGG - Intergenic
930859525 2:56055753-56055775 TAGTTAATAAAGCAGCAGCAGGG - Intergenic
930948615 2:57108879-57108901 TGGTTGATAAAGCAGTGGCAGGG - Intergenic
931022487 2:58064185-58064207 TAGCTGATAAAGCAGTAGCATGG + Intronic
931407733 2:61996586-61996608 TAGTTGATAAAGCAGCAGCAGGG - Intronic
931683746 2:64774617-64774639 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
931895378 2:66723177-66723199 TAGTTGATAAAGCAGTTGCAGGG + Intergenic
932033196 2:68211690-68211712 TGGCTGATAAAGCAGCAGCAGGG - Intronic
932372116 2:71199024-71199046 TAGTTGATAAAGCAGTAGCAGGG + Intronic
932386280 2:71336079-71336101 TACTTGATAAGGCCGGGGCACGG + Intronic
932652143 2:73569762-73569784 TATTTGATGAAGCAGGGGAAAGG + Intronic
933170940 2:79124088-79124110 TAGTTGATAAAGAAGCAGCAGGG - Intergenic
933549037 2:83751068-83751090 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
933626612 2:84607967-84607989 TAGTTGATAAAGCAGAAGTAGGG - Intronic
933944052 2:87269210-87269232 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
934059162 2:88278320-88278342 TAGTTGATGGAGCAGCGGCAGGG + Intergenic
934127436 2:88911016-88911038 TAGTTGATAAAGCAGCAGTAGGG + Intergenic
934716139 2:96545546-96545568 TAGTTGATAAAGCAGCAGCAGGG + Intronic
935036823 2:99384945-99384967 TAATTGATAAAGCAGTGGCAGGG + Intronic
935485652 2:103650336-103650358 TCATTGATAAAGCAGTGGCAGGG + Intergenic
935796785 2:106649869-106649891 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
936336166 2:111592369-111592391 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
936350158 2:111706537-111706559 TAAGTGATCAAACAGGGACAGGG - Intergenic
936409727 2:112246769-112246791 TAGTTGATAAAGCAGTGGCAGGG + Intronic
936442115 2:112563500-112563522 TAGTTGATAAAACAGCGGCAGGG - Intronic
936886901 2:117321458-117321480 TTAGTGAGAAAACAGGGGCAGGG + Intergenic
936920360 2:117682538-117682560 TAAGTGATAAAGCAGCAACAGGG + Intergenic
937723322 2:125128668-125128690 TAGTTGAAAAAGCAGTGACAGGG + Intergenic
937818634 2:126282552-126282574 TAGTTTATAAGGCAGTGGCAGGG + Intergenic
937832724 2:126441414-126441436 TAGTTGATAAAGTAGTGGCAGGG - Intergenic
938158739 2:128964441-128964463 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
938562425 2:132485519-132485541 TAGTTGATAAAGCAGCAGCAGGG - Intronic
938606447 2:132898103-132898125 TAGTTGATAAAGCATTGGCAGGG - Intronic
938621658 2:133061216-133061238 TAGTTGATAAAGCAGTGGCAGGG + Intronic
938678486 2:133663519-133663541 TAGTTGATAAAGTAGCAGCAGGG - Intergenic
938947035 2:136222522-136222544 TAGCTGATAAGGCAGTGGAAGGG + Intergenic
939035429 2:137125300-137125322 TAGTTGAAAAAGCAGCAGCAGGG - Intronic
939285408 2:140122640-140122662 TAATTGATCAAGCAGTGGCAGGG - Intergenic
939722594 2:145673648-145673670 GGGTTGATAAAGCAGGGGCAGGG - Intergenic
939933536 2:148260202-148260224 TAGTAGATAAAGCAGCAGCAGGG - Intronic
940049270 2:149444546-149444568 CTGTTGATAAAGCAGTGGCAGGG - Intronic
940126980 2:150337277-150337299 TAATTGATAAAGCACTGGCAAGG + Intergenic
940184695 2:150970693-150970715 CAGTTGATAAAGCAGTGGCAGGG - Intergenic
940635920 2:156296478-156296500 TGGGTCATAGAGCAGGGCCAAGG + Intergenic
940823085 2:158379452-158379474 TAGTTGATAAAGCAATGTCAGGG + Intronic
941057355 2:160803958-160803980 TAGTTGATAAAGCAGTGAAAAGG + Intergenic
941077690 2:161024505-161024527 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
941461635 2:165778981-165779003 TAGGTGACAGAGCAGGTCCATGG + Intronic
941488443 2:166112058-166112080 TATTTGATAAAGCAGTGGCAGGG + Intronic
942534326 2:176947554-176947576 TAGTTGATAAAGCAGCAACAGGG + Intergenic
942747946 2:179256961-179256983 TAGTTGATAAAGCAGTGGCAGGG + Intronic
942833083 2:180260150-180260172 TAACTGATAAGGCAGTGGCAGGG - Intergenic
942999160 2:182302770-182302792 TAGTTGGTAAATCAGTGGCAGGG - Intronic
943084076 2:183291188-183291210 TAGTTGATAAAACAGCAGCAGGG + Intergenic
943421002 2:187669158-187669180 TAGTGGATAAAGCAGCAGCAGGG + Intergenic
944026029 2:195168408-195168430 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
944058900 2:195551184-195551206 TAATTGATAAAGCAGCAGCAGGG - Intergenic
944274082 2:197815992-197816014 TATTTGATAAAGCAGCAGCAGGG + Intronic
944623241 2:201541247-201541269 TAGTTGACAAAGCAGCAGCAGGG + Intronic
944957445 2:204828635-204828657 TTGGAGATAAACCAGGGGAATGG - Intronic
945383740 2:209172515-209172537 CAGTTGATAAAGTAGTGGCAGGG + Intergenic
945651997 2:212574111-212574133 TAGTTGATAAAGTAGTGGTAGGG - Intergenic
945830095 2:214773919-214773941 TAGTTGATAAAACAGCAGCAGGG - Intronic
945989605 2:216384156-216384178 TAGTTGATCAAGCAGCTGCAGGG + Intergenic
946091484 2:217228556-217228578 TAGTTGATAAAGCAGTGTCAGGG - Intergenic
946131422 2:217609914-217609936 GAGGTGATGGAGCAGGTGCAGGG + Intronic
946575348 2:221069882-221069904 TAATTGATAAAGCAGTGGCAGGG + Intergenic
946747206 2:222858417-222858439 TAGTGGATAAAGCAGTGGCAAGG + Intergenic
947020621 2:225671267-225671289 TAGTTGATAAAGCAGTGTCAGGG - Intergenic
947035366 2:225847664-225847686 TAGTTGATAAGGCAGTGGCAGGG - Intergenic
947654453 2:231814444-231814466 TAGTTGATAAAGCAGTGGCATGG - Intergenic
947754044 2:232548368-232548390 TAGTTGATAAAGCAGCAGCAGGG - Exonic
947786430 2:232825673-232825695 TAGTTGATAAAGCAGTGGCAGGG + Intronic
948506426 2:238430260-238430282 TAGTTGATTAAGCAGCAGCAGGG - Intronic
948721270 2:239902090-239902112 TCGTTAATAAAGCAGTGGCAGGG + Intronic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1169032694 20:2423046-2423068 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1169032717 20:2423338-2423360 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1169089900 20:2853005-2853027 TAGTTAATAAAGCAGCGGCGTGG - Intronic
1169159611 20:3365750-3365772 TAGTTAATAAAGCAGTGGCATGG - Intronic
1169260038 20:4130779-4130801 GAGGTGATCACACAGGGGCATGG + Intronic
1169518346 20:6343147-6343169 TGGTTGATAAAGCAGTGGCAAGG - Intergenic
1169756530 20:9048909-9048931 CAGTTGATAAAGCAGTGGCAGGG - Intergenic
1170252421 20:14299032-14299054 TAGTTGATAAAACAGTCGCAGGG + Intronic
1170252457 20:14299570-14299592 TAGTTGATAAAGCAGTGGTAGGG + Intronic
1170280477 20:14641071-14641093 TAGTTGACAAAGCAGTGGCAGGG - Intronic
1170284889 20:14695949-14695971 AAGTTTATAAAGCAGGGGAAAGG + Intronic
1170465916 20:16622426-16622448 TAGGTCTGAAAGCAAGGGCAGGG + Intergenic
1170753472 20:19173738-19173760 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1171119409 20:22555830-22555852 TAGTCTATAAAGCAGAGGCATGG + Intergenic
1171205599 20:23277717-23277739 TAGTTGATAAAGCAGTGACAGGG + Intergenic
1171223005 20:23418325-23418347 TAGCTAAGAAGGCAGGGGCAGGG + Intronic
1171236587 20:23531187-23531209 GAGTTGATAAAGCAGCTGCAAGG - Intergenic
1171251109 20:23648329-23648351 TAGATGATAAAGCAGTGACAAGG - Intergenic
1171313298 20:24164047-24164069 CAGCTGATAAAGCAGTGGCAGGG + Intergenic
1171526050 20:25812187-25812209 TAGTTGATAGAGGAGTGGCAGGG + Intronic
1171550777 20:26043698-26043720 TAGTTGATAGAGGAGTGGCAGGG - Intergenic
1171770212 20:29317380-29317402 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1171784597 20:29450718-29450740 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1171812923 20:29760173-29760195 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1171824379 20:29880775-29880797 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1171906305 20:30902133-30902155 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1173085200 20:39909441-39909463 TAGGTGAGGAAGCAGGACCAAGG + Intergenic
1173107001 20:40146336-40146358 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1173381128 20:42543259-42543281 TACTTGATAAAGTAGTGGCATGG - Intronic
1173882732 20:46429963-46429985 TAGTTGATAAAGCAACTGCAGGG + Intronic
1174568589 20:51484815-51484837 TGGGTCAGAAAGCAGGCGCAGGG - Intronic
1174650725 20:52122956-52122978 TAGTTGATAAAGTAGCAGCAGGG + Intronic
1174799536 20:53551637-53551659 AAGGTTATAAAGCTGGCGCATGG - Intergenic
1174834632 20:53844925-53844947 TCGTTGATAAAGCAGTGGCAGGG + Intergenic
1175088182 20:56478870-56478892 TAATTGATAAAGCAGTTGCAGGG - Intronic
1175250520 20:57607517-57607539 TAGTTGGTAAAGCAGCAGCAGGG + Intronic
1175649865 20:60710630-60710652 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1176195863 20:63836122-63836144 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195932 20:63836312-63836334 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176726048 21:10433731-10433753 TAGTTGTTAAAGCAGTGGCAGGG - Intergenic
1176950936 21:15045755-15045777 TAATTGATAAAACAGTGGCAGGG - Intronic
1177167384 21:17617954-17617976 TTAGTGATAAAGCAGCAGCAGGG - Intergenic
1177461216 21:21413989-21414011 TAGTTGATAAAGCGGTGACAGGG - Intronic
1177869334 21:26551812-26551834 TAGTTGATAAAGCAGCAGTAGGG + Intronic
1178070802 21:28964117-28964139 TAGATGATACAGCAGTGGCAGGG + Intronic
1179056051 21:37935633-37935655 TATATCATAAAGCAGGAGCAGGG + Intergenic
1179386996 21:40953003-40953025 TAGTTGATAGAGCTGTGGCAGGG + Intergenic
1179395297 21:41034265-41034287 TAGTTGACAAAGCAGTGGCAGGG - Intergenic
1179428518 21:41302645-41302667 TAGTTGATATGGCAGTGGCAGGG - Intergenic
1179965024 21:44798486-44798508 TAGTTGATAAAGCAGCCGCAGGG - Intronic
1180113500 21:45678790-45678812 TAGTTGCTAAAGCAGCAGCAGGG + Intronic
1180115634 21:45702871-45702893 TAGTTGCTAAAGCAGCAGCAGGG - Intronic
1180288325 22:10773382-10773404 TAGTTGTTAAAGCAGTGGCAGGG + Intergenic
1180315616 22:11275231-11275253 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1180339727 22:11608248-11608270 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1180574330 22:16758668-16758690 TAGTTGATAGAGGAGTGGCAGGG + Intergenic
1180651798 22:17383407-17383429 AAGCTGATAAAGCAGTGGCAGGG - Intronic
1181564518 22:23726810-23726832 TGGGTCATACAGCAGGGGCTGGG - Intergenic
1181873385 22:25921206-25921228 TAGGTGGCAAAGCAGTGGCCAGG - Intronic
1182514049 22:30842588-30842610 TAGTTGAAAAAGCAGTGGCAGGG - Intronic
1182820686 22:33213365-33213387 TAAATGATGAAGCAGTGGCAGGG + Intronic
1183234150 22:36604393-36604415 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1183283210 22:36944685-36944707 TAGTTGACAAAGCAGCAGCAGGG - Intergenic
1183706745 22:39479022-39479044 TAGGTGGTAGAGCATGGGCCAGG - Intronic
1184082882 22:42237188-42237210 TAGTTGATTAAGCAGTGGCGGGG - Intronic
1184446651 22:44551464-44551486 TATGTGAGATAGCAGGGGAATGG + Intergenic
1184498695 22:44859142-44859164 TGGCTGATAAAGCAGAGGGATGG + Intronic
1184500132 22:44866495-44866517 TGGCTGATAAAGCAGAGGGACGG - Intergenic
1184831072 22:46987933-46987955 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1185097083 22:48815588-48815610 TAGTCGATAAAGCAGCAGCAGGG + Intronic
1185394489 22:50579707-50579729 TCGGTGAGGAAGGAGGGGCAGGG - Exonic
949344451 3:3063798-3063820 AAGGTGTTAAAGCAGGTGGAAGG + Intergenic
949813330 3:8031892-8031914 TAGCTAATAAGGCAGTGGCAAGG - Intergenic
949969462 3:9391597-9391619 TGGTTGATAAAGCAGTGCCAGGG - Intergenic
950102384 3:10366018-10366040 TATGTGAAACAGCAGGGGCCTGG - Intronic
950109036 3:10406903-10406925 CAGATGACAAAGCAGGGGCTCGG - Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
950988982 3:17410913-17410935 TAAGTGAGAAAGCAGCTGCAGGG + Intronic
951096671 3:18640101-18640123 TAGTAGATAAAGCAGCAGCATGG - Intergenic
951164287 3:19466342-19466364 TAGTTTATAAAGCAGTGGCAGGG + Intronic
951455880 3:22891598-22891620 TAGGAGATAATGCAGCGGCTTGG - Intergenic
951529947 3:23688948-23688970 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
951608727 3:24467039-24467061 TAGTTGATATAGCAGTGGCAAGG - Intronic
951741262 3:25926901-25926923 TAGTTGATAAAGCAGCAGTAGGG - Intergenic
952119315 3:30222798-30222820 TAGTTGATAAAGCAGAGGCAGGG - Intergenic
952555884 3:34530207-34530229 TAGTTGACAAAGCAGTAGCAGGG + Intergenic
952639374 3:35574011-35574033 TAGTTGATAAAGCAGTGGCTGGG + Intergenic
952660169 3:35836296-35836318 TAGTTTATAAAGCAGTGGCAGGG - Intergenic
953121785 3:40051082-40051104 TAGTTGATAAAGCAGTAGCCAGG + Intronic
953367373 3:42357284-42357306 TAGTTGATAAATCAGCAGCAGGG + Intergenic
953495185 3:43379753-43379775 TGTGTGATACAGCAGAGGCAAGG + Intronic
953559482 3:43975171-43975193 TAGCTGATAAAGCAGCAGCAGGG + Intergenic
953783695 3:45894474-45894496 TAGCTGATAGAGCAGGGGGAAGG + Intronic
953838069 3:46365097-46365119 TAGTTAATAAAGCAGTGGCAGGG + Intergenic
954854447 3:53631241-53631263 TAGTTGATAAAGCAGTGGCAGGG - Intronic
954944776 3:54411242-54411264 TAGTTGATAAGGCAGCAGCAGGG + Intronic
955164302 3:56495715-56495737 TATTTGATAAAGCAGCAGCAGGG - Intergenic
955426699 3:58798573-58798595 GAGTTGATAAAGCAGCAGCATGG + Intronic
955938439 3:64125336-64125358 TAGTGGATAAAGCAGTGGCAGGG + Intronic
956013998 3:64861925-64861947 TAGGTGCTAAAGCATAGGCAGGG - Intergenic
956949084 3:74259071-74259093 CTAGTGATAAAGCAGGGGAACGG - Intergenic
956960792 3:74398112-74398134 TAGTAGATAAAGCAGTGACAGGG + Intronic
957335014 3:78817025-78817047 TTAGTTATAAAGCAGTGGCAAGG + Intronic
957401155 3:79715198-79715220 TAGTTGATAAAGCTGTGGCATGG + Intronic
957863599 3:85992983-85993005 TAGTTGATAAAGCAATGGAAGGG - Intronic
958051088 3:88347269-88347291 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
958092042 3:88889241-88889263 TCCTTGATAAAGCAGGGGCAGGG + Intergenic
958121484 3:89295528-89295550 TAGTTGATAAACCAGAAGCAGGG - Intronic
958494397 3:94825320-94825342 TAGATGATAAAGCAGTGGCAGGG - Intergenic
958655416 3:96996031-96996053 TAGTTGATAAAGCAGCAGCAGGG - Intronic
958773197 3:98450332-98450354 AAGTTGTTAAAGCAGCGGCAGGG - Intergenic
958800910 3:98754541-98754563 TAGTTGATAAAACAGTGGCAGGG + Intronic
958804756 3:98796442-98796464 TAGGTGACAATGCAGAGCCAGGG + Exonic
958840476 3:99198346-99198368 TAGTTGATAAAGCAGTAGCGGGG - Intergenic
959165088 3:102766744-102766766 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
959390465 3:105766338-105766360 TGGTTGATAAAGCAGTGGCAGGG + Intronic
959721544 3:109496159-109496181 TAGTTGATAAAGTAATGGCAGGG - Intergenic
959873637 3:111357028-111357050 TACTTGATAAAGCAGTGGCTAGG + Intronic
959923752 3:111898633-111898655 TAATTGATAAAGCAGTGGCAGGG - Intronic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
960139724 3:114140351-114140373 CAGGATATAAAGCAGGGACAAGG - Intronic
960383002 3:116987360-116987382 TAGTTGATAAAGCAGGGGCAAGG + Intronic
960476510 3:118136170-118136192 TAGTTGATAAAGCGGGAGCTGGG + Intergenic
960540684 3:118858677-118858699 AAGTTGATAAAGCAGAAGCAGGG + Intergenic
960647968 3:119910755-119910777 TAGTTGATAAAGCAGCAGCAGGG - Intronic
960657484 3:120021841-120021863 CAGCTGATAAAGCAGCAGCAGGG + Intronic
961523662 3:127483182-127483204 AAGGTGATAAAGCAGGGAATGGG - Intergenic
961732949 3:128980629-128980651 TAGTTGATAAAGAAGTGGCAGGG - Intronic
961962926 3:130870784-130870806 GAGGTGATAAAGCAGTGGCAGGG + Intronic
962029042 3:131579911-131579933 TAGTTGATAAAGCAGAGGCAGGG + Intronic
962033635 3:131627971-131627993 TAGTTGATAAAGCAGTGACAGGG + Intronic
962116091 3:132509510-132509532 GAGTTGATAAAGCAGCAGCAGGG + Intronic
962544083 3:136414293-136414315 TAGTTGATAAAGCAGTGACAAGG - Intronic
962560022 3:136596116-136596138 TATATGATAAAGCAGTGACAGGG + Intronic
963195345 3:142521896-142521918 TAGTTGATTAAGCAGTGGCAAGG + Intronic
963284088 3:143416260-143416282 TGATTGATAAAGCAGTGGCAGGG + Intronic
963608635 3:147437340-147437362 TATTTGATGAAGCAGTGGCAGGG - Intronic
964035410 3:152189908-152189930 TAGTTGATAAAGCAGCAGCAAGG + Intergenic
964235827 3:154526121-154526143 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
964440061 3:156699212-156699234 TAGTTGATAAAGCAACAGCAAGG + Intronic
964469240 3:157034650-157034672 TAGTTGATAAAGCAGTGACAGGG + Intronic
964574887 3:158154798-158154820 TAGTTGATAAAGCAGCAGCAGGG - Intronic
964599253 3:158477232-158477254 TAGTTGATAAAGCAGTGGCAGGG + Intronic
964617146 3:158678718-158678740 TGGTTGATAAAGCAGTGGCAAGG + Intronic
965011377 3:163096583-163096605 TAGAGGATAATGCAGGTGCATGG + Intergenic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
965366795 3:167810826-167810848 TAGTTGATAAAGCAGTGGTAGGG - Intronic
965438804 3:168687271-168687293 TAGTTGATAAACCAATGGCAAGG + Intergenic
965600104 3:170446124-170446146 TAGATGAGAAAACAGAGGCATGG + Intronic
966098062 3:176229953-176229975 TAGCTGATAAAGTAGCAGCAGGG - Intergenic
966297272 3:178438940-178438962 TATGTGAGAAAAAAGGGGCAAGG + Intronic
966503516 3:180673198-180673220 TATTTGATAAAGCAGCAGCAGGG + Intronic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
966814332 3:183877426-183877448 TAGCTGATAAAGCAGCAGCACGG + Intronic
966995597 3:185276996-185277018 TAGTTGACAAGGCAGCGGCAGGG - Intronic
967035030 3:185642423-185642445 TAGCTGATGAAGCAGCAGCAGGG + Intergenic
967399734 3:189047662-189047684 TAGAAGATAAAGCAGCAGCAGGG - Intronic
967491951 3:190102701-190102723 TAGTTGATAAAGCAGTGGCAGGG + Intronic
967544919 3:190714296-190714318 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
967570831 3:191026466-191026488 AAGGTAATAAAGCAGGAGTAGGG + Intergenic
967802848 3:193683398-193683420 TAGTAGATAAAGCAGCTGCAGGG + Intronic
968244417 3:197128194-197128216 TAGTTGATAAAGCAGCAGTAGGG - Intronic
968575126 4:1362446-1362468 CCTGTGATAAAGCAGGGGCATGG - Intronic
968747236 4:2366446-2366468 TTGGTGAGACAGCAGGTGCAGGG - Intronic
968766624 4:2474576-2474598 TAGTTAATAAAACAGTGGCAGGG + Intronic
968945616 4:3662025-3662047 GAGGTGATGAAGCAGGGCCTTGG - Intergenic
969218008 4:5738346-5738368 TATTTGATAAAGCAGCTGCAGGG + Intronic
969280120 4:6164982-6165004 TAGCTGATAAGGCAGTGGCAAGG + Intronic
970440756 4:16079265-16079287 TCAGTGACAAAGCAGGGGAAGGG + Intronic
970628956 4:17920659-17920681 TAGTTGATAAAGGAGTGGCAGGG - Intronic
971868734 4:32207986-32208008 TAGTTGATAAAGTAGTGGCAGGG + Intergenic
972099480 4:35395519-35395541 TAGTTAATAAAGCAGCAGCAGGG + Intergenic
972177466 4:36426299-36426321 TAGCTGATAAAGCAGCAACAGGG - Intergenic
972560436 4:40223204-40223226 TACTTGATAAAGCAGTGGCAGGG + Intronic
972768820 4:42176522-42176544 TAGTTTATAAAGCAGTGGCAGGG - Intergenic
972776419 4:42245579-42245601 TAGTTGATAAAGTAGTGACAGGG + Intergenic
972776541 4:42246587-42246609 TAGTTGATAAAGCAGTGGCAAGG + Intergenic
972837493 4:42890799-42890821 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
973901323 4:55475429-55475451 TAGTTGATAGAGCAGCAGCAGGG + Intronic
974471729 4:62327631-62327653 TAGTTGATAAAGGAGCAGCAGGG + Intergenic
974608629 4:64185488-64185510 TATGTGTTAAAGGAGGGGCATGG - Intergenic
974660091 4:64876316-64876338 TAGTTGACAAAGCAGTGGCAAGG - Intergenic
975077360 4:70228159-70228181 TAATTGATAAAGCAGTGGCAGGG - Intronic
975407747 4:74011262-74011284 GAGTTGATAAAGCAGTGGCAGGG + Intergenic
975475379 4:74817117-74817139 TAGTTGATAAAGCTGCAGCAGGG - Intergenic
975568095 4:75781392-75781414 TAGTTGATAAAGCAGTGTCAGGG + Intronic
976154873 4:82132451-82132473 TAGTTGATAAAGCAGGGGCAGGG + Intergenic
976468629 4:85400928-85400950 TAGTTGATAAGACAGAGGCAAGG + Intergenic
976595163 4:86888917-86888939 TAGATGATAAAGGATGGGGAAGG - Intronic
976885246 4:89975127-89975149 GAGTTGATAAAGCAGTGGCAGGG - Intergenic
976932698 4:90588301-90588323 CAATTGATAAAGCAGGAGCAGGG - Intronic
976934724 4:90615775-90615797 TAGTGGATAAAGCTGGGGCAGGG + Intronic
977126895 4:93180625-93180647 TAATTGATAAAGCAGCAGCAAGG - Intronic
977158487 4:93604525-93604547 TAGTTGGTAAAGCAGCAGCAGGG + Intronic
977169622 4:93744687-93744709 TAGTTGATAAGACAGAGGCAGGG + Intronic
977612723 4:99052871-99052893 TAGTTGATAAAACAGGAGCAGGG - Intronic
977688124 4:99872649-99872671 TAGTTGATAAAGCAGTTGCAGGG - Intergenic
977981148 4:103323686-103323708 TAGTTGATAAAGCAATGGCAGGG - Intergenic
978010178 4:103671961-103671983 TAGCTGATAAAGCAGCAGCAGGG - Intronic
978074163 4:104508351-104508373 TAGGAGATAAATCAGGGGACTGG - Intergenic
978530376 4:109706519-109706541 TAGTTGACAAAGCAGTGGCAGGG + Intergenic
978980583 4:114940536-114940558 TAGGTGAGTGAGCAGGTGCAGGG + Intronic
979374481 4:119929593-119929615 TAGCGGATAAAGCAGTGGCAGGG + Intergenic
979576942 4:122303908-122303930 TAGTTGATGAAGCAGTGGCAAGG + Intronic
979695164 4:123604838-123604860 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
979744419 4:124193346-124193368 TAGTTGATGAAGCAGTGGCAGGG - Intergenic
979836924 4:125381827-125381849 TAGCTGATAAAAGAGTGGCAGGG - Intronic
979908265 4:126325557-126325579 ATGTTGATAAAGCAGTGGCAGGG - Intergenic
979973931 4:127172449-127172471 TAGTTAATAAAGCAGCAGCAGGG + Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980187761 4:129483371-129483393 TAGTTGATAAAGCAGCAGCAAGG - Intergenic
980504628 4:133700458-133700480 TTGTTGATAAAGCAGTGGCAGGG - Intergenic
980760031 4:137220709-137220731 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
980858749 4:138473087-138473109 TAATTGATAAAGCAGTGGCAAGG + Intergenic
980870163 4:138602230-138602252 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
981439226 4:144763879-144763901 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
981806536 4:148722215-148722237 TAGTTGATGCAGCAGTGGCAGGG - Intergenic
981924378 4:150122168-150122190 TAGTTGATAAAGCAGCAGCAGGG - Intronic
982152884 4:152481944-152481966 TAGTTGACAAAGCAGCAGCAGGG + Intronic
982300557 4:153874622-153874644 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
982552484 4:156820214-156820236 TAGTTGATAGAGCAGCAGCAGGG + Intronic
982876147 4:160652779-160652801 TAGTTGATAAAGCAGCTGCAGGG + Intergenic
983031459 4:162807426-162807448 TAGTTGATAAAGCAGTGGCATGG - Intergenic
983058389 4:163126639-163126661 TAGTTGATAAGGCAGTGGCAGGG + Intronic
983124375 4:163932395-163932417 TAGTTGATAAAGCAGCAGCAGGG - Intronic
983134344 4:164062045-164062067 TAGTTGATAAAGCAGCAGGAGGG - Intronic
983549649 4:169003530-169003552 TAGTTGATAAAGCAATAGCAGGG + Intronic
983549718 4:169004479-169004501 TAGTTGATAAAGCAATAGCAGGG - Intronic
983615606 4:169701121-169701143 TAGTTGATAAAGCAGTAGCAGGG - Intronic
983794717 4:171847601-171847623 TAGTTGATAAAGCAGTGTCGGGG - Intronic
983831037 4:172329015-172329037 GAAGTGGTCAAGCAGGGGCAGGG + Intronic
983963396 4:173781229-173781251 TAGTTGATAAAGCAGTGACATGG + Intergenic
984121275 4:175747908-175747930 TAGTTGATAAAGTAGCAGCAGGG - Intronic
984461194 4:180039263-180039285 TAGTTGATAAAGCAGTGTCAAGG + Intergenic
984637025 4:182121944-182121966 TAGTTGATAAAGCAGTGGAAAGG - Intergenic
984685735 4:182666275-182666297 TAGTAGATAAAGCAGTGGCAAGG + Intronic
984760283 4:183357355-183357377 TAGGAGATAAGGCAGGTGAAGGG + Intergenic
984898758 4:184565547-184565569 TAGTTGATAGAGCAGTGGCAGGG - Intergenic
984972118 4:185200978-185201000 TAGCTAATAAAGCAGCGGCAGGG + Intronic
985185459 4:187310110-187310132 TAGTTGATCAAGCAGTGGCAGGG - Intergenic
985310997 4:188598862-188598884 TAGTTGATAAAGCAGTGACAGGG - Intergenic
985369500 4:189270563-189270585 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
986355025 5:6915553-6915575 TAGGTAATGATGCATGGGCATGG + Intergenic
986617389 5:9632562-9632584 TAGTTAATAAAGTAGTGGCACGG - Intronic
986631409 5:9777273-9777295 TATTTGATAAAGCAGTAGCAGGG - Intergenic
986738782 5:10687741-10687763 TAATTGATAAAGCAGTGGCAGGG + Intronic
986745888 5:10744596-10744618 TACGTGACATATCAGGGGCAAGG + Intronic
986941693 5:12958626-12958648 TAGTTGATAAAACAGTGGCAGGG + Intergenic
987058769 5:14221843-14221865 TAGTTGATAAAGCAGCAGCAGGG + Intronic
987242229 5:16011959-16011981 TATTTAATAAAGCAGTGGCAGGG - Intergenic
987544584 5:19296705-19296727 TTAGTTGTAAAGCAGGGGCAAGG + Intergenic
987602324 5:20087365-20087387 TAGTTGCTAAAGCAGTGGCAAGG + Intronic
987768712 5:22271153-22271175 AAGTTGATAAAGCAGCAGCAAGG - Intronic
987795929 5:22626415-22626437 TAGGGAATAAAGCTGGGGCCTGG + Intronic
987912778 5:24170202-24170224 GCGGGGATCAAGCAGGGGCAGGG + Intronic
988590890 5:32548397-32548419 TAGTTGATAAAGCAGCAGCCAGG + Intronic
988888982 5:35593703-35593725 TACTTGATGAAGCAGTGGCAAGG - Intergenic
989128698 5:38082571-38082593 CAGTTGATAAAACAGAGGCAGGG + Intergenic
989225267 5:39020231-39020253 TAGTTGATGCAGCAGTGGCAGGG + Intronic
989379465 5:40798650-40798672 AAGGTTAGAAAGCAGTGGCAGGG - Intergenic
989729417 5:44630611-44630633 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
990002925 5:50915698-50915720 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
990068045 5:51742802-51742824 TAGTTTATAAAGCAGCAGCAGGG - Intergenic
990481744 5:56218229-56218251 TAGTTGATAAAGTAGTGGTAGGG + Intronic
990677232 5:58201384-58201406 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
990835662 5:60016570-60016592 TACTTGATAAAGCAGTGGCAGGG - Intronic
991394302 5:66187582-66187604 TAATTGATAAAGCAGTGGCAGGG + Intergenic
991468429 5:66940427-66940449 TAGTTGATAAAGCAATAGCAGGG - Intronic
991621898 5:68553512-68553534 TAGTTGATAAAACAGTGGCAGGG - Intergenic
992074676 5:73180582-73180604 TAGTTGATAAGGCAGCAGCAGGG + Intergenic
992271376 5:75067225-75067247 TAGATGATAAAGCAGCAGCAGGG + Intergenic
992566425 5:77999454-77999476 GAGGTTAGAAAGCAGGGGGACGG + Intergenic
992922350 5:81539446-81539468 GAGTTGATAAAGCAGCGGCAAGG + Intronic
992935472 5:81699385-81699407 TAGTTGATAAAACAGTGGCAGGG - Intronic
993124216 5:83812413-83812435 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
993349504 5:86830945-86830967 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
993403431 5:87481733-87481755 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
993599705 5:89906293-89906315 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
993771678 5:91935977-91935999 TTGGTGATAAAACAGTGGCAGGG - Intergenic
993893350 5:93501758-93501780 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
993897700 5:93557855-93557877 TAGTTGATAAAGCAACAGCAGGG - Intergenic
993906246 5:93626964-93626986 TAGTTGATAAAACAGTGGCAAGG - Intronic
993956246 5:94236541-94236563 TAGTTGAGAAGGCAGTGGCAGGG + Intronic
994020214 5:95014732-95014754 TAGTTGATAAAGCAACAGCAGGG + Intronic
994155547 5:96499727-96499749 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
994235780 5:97360368-97360390 TAGTTGATAAAACAGTGGCAGGG - Intergenic
995482412 5:112606321-112606343 GAGGTGAAAAAGCAGGAACAAGG + Intergenic
995505622 5:112857764-112857786 TAGTTGATACAGCAGTGGCAGGG - Intronic
995658747 5:114457012-114457034 TAGTTGATAAAGCTGTGTCACGG + Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996072996 5:119155983-119156005 TAGTTGATAGAGCATTGGCAGGG + Intronic
996352089 5:122555412-122555434 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
996841854 5:127855236-127855258 TAGATGATATAGCAGTGGCAGGG - Intergenic
997566460 5:134890828-134890850 TAGTTGATAATGCAGCAGCAGGG - Intronic
997694954 5:135853422-135853444 TAGCTGATAAAGCAGCGTCAGGG - Intronic
997703334 5:135922575-135922597 TAGTTGATAAAGCAGCAGCAGGG - Intronic
997741074 5:136255169-136255191 TAGTTGACAAAGCAGCAGCAAGG + Intronic
998989355 5:147798606-147798628 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
999688188 5:154121554-154121576 TAGTTGGTAAAGCAGCGGCAGGG + Intronic
1000312392 5:160057721-160057743 TAGCTGATAAAGCAGCAGCAGGG - Intronic
1000492731 5:161934917-161934939 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1000886924 5:166757936-166757958 TAGTTGATAAAGCAGTGACAGGG + Intergenic
1000955253 5:167535413-167535435 TAGGTGAGAAAACAGTGGCAAGG + Intronic
1001190429 5:169625707-169625729 TAGTTGATAAGGCAGAGGCAGGG + Intergenic
1001656014 5:173350749-173350771 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002813254 6:655024-655046 TGGTTGATAAACCAGTGGCAGGG + Intronic
1002915705 6:1526226-1526248 TAGGGGATAAAGCAGATGCACGG + Intergenic
1002964885 6:1954521-1954543 TAGTTGTTAAAGCAGCAGCAGGG - Intronic
1003085886 6:3061050-3061072 AAGTTGATAAAGCAGTGGCAGGG + Intergenic
1003154883 6:3584019-3584041 TAAGTGATAAAGTAAGGGGAAGG - Intergenic
1003274926 6:4641827-4641849 TAGTTGAGAAAGCAGTGGCAGGG - Intergenic
1003323377 6:5072813-5072835 TAGGTGATCAGGGAGGGGCAGGG + Intergenic
1003528227 6:6916320-6916342 GAGGTGATAAGGCAGAGGAAAGG + Intergenic
1003662486 6:8075843-8075865 TAGTTGACAAAGCAGCTGCAGGG - Intronic
1004152260 6:13133007-13133029 TAGTTGAGAAAGCAGCAGCAGGG - Intronic
1005154335 6:22786686-22786708 TGAGTGATAAAGCAGAGCCACGG - Intergenic
1005252655 6:23965037-23965059 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1005401989 6:25444253-25444275 TACCTGATAAAGCAGTGGGAGGG - Intronic
1005603270 6:27448872-27448894 TAGATAATAAAGCAGGGTGAAGG - Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1006020205 6:31113279-31113301 AAGGTGAAAAAGCAGGGAAAGGG - Intergenic
1006181890 6:32158655-32158677 CAGGTAATAAGGCAGGGGAAAGG + Intronic
1006245344 6:32729590-32729612 TAGTTGAGAAAGCAGTAGCAGGG + Intergenic
1006707748 6:36036405-36036427 TAGTTGATAAAGCAGCAGCAAGG + Intronic
1006959418 6:37913291-37913313 CAGCTGATAAAGCAGCAGCAGGG - Intronic
1007017643 6:38485044-38485066 TAGTTGATAAAGCAGTAGTAGGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007863930 6:44946791-44946813 TAGCTGATAAAGCAATGTCAGGG + Intronic
1007947538 6:45839711-45839733 GAGGTGATGGAGCAGGGGCAGGG - Intergenic
1008120652 6:47612924-47612946 TAGTTGATAAAGCAGAGGCAGGG - Intronic
1008917005 6:56799120-56799142 TAGTTGATAAAGCAGCAGCGGGG + Intronic
1009036459 6:58122780-58122802 TAGTTGACAAAGCAGTGGCAGGG + Intergenic
1009212268 6:60876398-60876420 TAGTTGACAAAGCAGTGGCAGGG + Intergenic
1009241401 6:61190233-61190255 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
1009479261 6:64136042-64136064 TAGTTGATAAAGCAGTGGCAAGG - Intronic
1009590002 6:65655873-65655895 TAGTTGAGAAAGCAGTGGCAGGG + Intronic
1009590126 6:65657717-65657739 TAGTTGAGAAAGCAGTGGCAGGG + Intronic
1009748011 6:67845438-67845460 TAGTTGATAAAACAGTAGCAGGG - Intergenic
1009963205 6:70549888-70549910 GAGTTGAAAAAGCAGTGGCAGGG - Intronic
1010019116 6:71139283-71139305 GTGGTGATCAGGCAGGGGCACGG - Intergenic
1010067548 6:71702388-71702410 TAGTTGATAAAGCAGTGGCAAGG + Intergenic
1010135366 6:72545610-72545632 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1010711340 6:79178476-79178498 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1010724426 6:79317095-79317117 TAGTTGATAAAGCAATGGCAGGG - Intergenic
1010796112 6:80118666-80118688 TAGCTGATAAAGAAGTGGCAGGG - Intronic
1010800001 6:80164179-80164201 TAGATGATCAAGCAGGGCCCTGG - Intronic
1011737208 6:90323112-90323134 TACTTGATAAAGCAGCAGCAGGG - Intergenic
1011829250 6:91351047-91351069 TAACTGATAAAGCAGTGGCAGGG + Intergenic
1011856397 6:91698099-91698121 TATTTGATAAAGCAGTGGCAGGG - Intergenic
1011908262 6:92401571-92401593 TAGTTGATAAAGCAGTAGCAAGG - Intergenic
1011976793 6:93311324-93311346 TAGCTGATAAAGCAGTGGCAAGG - Intronic
1012108962 6:95201705-95201727 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1012119308 6:95344155-95344177 CAGTTGATAAACCAGTGGCAGGG - Intergenic
1012207733 6:96481552-96481574 TCATTGATAAAGCAGTGGCAGGG - Intergenic
1012304632 6:97638025-97638047 TAGTTGATAAAACAGTGACAGGG + Intergenic
1012312423 6:97742673-97742695 TGGTTGATAAAGCAATGGCAGGG - Intergenic
1012390547 6:98733288-98733310 TAGATGATAAAGCAGTGGCAGGG - Intergenic
1012392730 6:98761554-98761576 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1012501629 6:99895030-99895052 GTGTTGGTAAAGCAGGGGCAAGG - Intergenic
1012521177 6:100123067-100123089 TAGGTGAGAAAACTGAGGCATGG - Intergenic
1012565016 6:100637968-100637990 TAGTTCAGAAAGCAGTGGCAGGG + Intronic
1012745050 6:103076373-103076395 TAGGTGATAAAGATGGGTAAAGG - Intergenic
1012782833 6:103584763-103584785 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1012928459 6:105291812-105291834 TAATTGATAAAACAGTGGCAGGG - Intronic
1012930819 6:105314430-105314452 TTGTTGATAAATCAGTGGCAGGG - Intronic
1013172809 6:107652575-107652597 TAGTTGATAAAACAGCAGCAGGG + Intronic
1013266343 6:108502848-108502870 TAGTTGTTAAAGCAGTGGCAGGG - Intronic
1013457277 6:110342008-110342030 AAGGTGAGAAAGAAGGGCCAAGG + Intronic
1013493700 6:110676396-110676418 TAGTTGGTAAAGTAGTGGCAGGG + Intronic
1013712989 6:112923372-112923394 TGGCTGATAAAGCAGTGGCAGGG + Intergenic
1013739933 6:113270764-113270786 TAGTCGATAAAGCAATGGCAGGG + Intergenic
1013823872 6:114187661-114187683 TAGTTGACAAAGCAGCAGCAGGG + Intronic
1013922671 6:115427377-115427399 TAATTGATAGAGCAGTGGCAGGG - Intergenic
1014689436 6:124544600-124544622 TAGGTTCTAAACTAGGGGCAAGG + Intronic
1014741512 6:125153154-125153176 TAGTTGATAAAGCAATGGCAGGG + Intronic
1014742222 6:125159234-125159256 TAGTCGATAAAGCAGTGGCAGGG - Intronic
1015337133 6:132052579-132052601 TAGTTGATAAAGCAGTGGTAGGG + Intergenic
1015640838 6:135330132-135330154 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1015704714 6:136075562-136075584 TAAATGATAAAGCAGTGCCAGGG - Intronic
1015746274 6:136513290-136513312 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1015939877 6:138438029-138438051 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1016199193 6:141386994-141387016 TAGTTAATAAAGCAGCAGCAGGG - Intergenic
1016892345 6:149019238-149019260 TAAGGGCTAAAGCAGGGTCATGG + Intronic
1017314537 6:153015253-153015275 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1018587364 6:165376454-165376476 TGTTTGACAAAGCAGGGGCAGGG + Intronic
1018594822 6:165467768-165467790 TAGTTGATAAGGCAGAGACAGGG + Intronic
1018881286 6:167883974-167883996 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1019159650 6:170061175-170061197 TAGTCGATAAAGCAGCAGCAGGG + Intergenic
1019230822 6:170560898-170560920 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1019691420 7:2416058-2416080 TACATGATAATGCAGTGGCAAGG - Intronic
1019895939 7:3983189-3983211 TAGCTGGTAAAGCTGTGGCAGGG + Intronic
1020091221 7:5342728-5342750 TAGCCGATAAAGCAGCAGCAGGG + Intronic
1020548823 7:9571927-9571949 TACTTGATAAAGCAGCAGCAGGG - Intergenic
1020758527 7:12238129-12238151 TGGTCGATAAAGCAGAGGCAGGG - Exonic
1021071398 7:16246137-16246159 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1021204368 7:17761855-17761877 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1021221614 7:17980769-17980791 TAGTTGATAAAGCAGTAGCAGGG - Intergenic
1021267904 7:18547697-18547719 TAGCTGATAAAGCAGAAGCAGGG - Intronic
1021933981 7:25611793-25611815 TAGTTGATAAAGCAGTGACAGGG - Intergenic
1022006452 7:26270288-26270310 AACATGATAAAGCAGTGGCAAGG - Intergenic
1022063375 7:26823977-26823999 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1022424890 7:30259234-30259256 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1022548794 7:31216283-31216305 GAGTTGATAAAGCAGCAGCAGGG - Intergenic
1022566778 7:31411757-31411779 TAGTTGATAAAGCAGCGGCAGGG + Intergenic
1022594464 7:31699086-31699108 TTGGTGCTAAAGCAGGGAAAAGG + Intronic
1022690205 7:32642651-32642673 TAGTTGCTAAAGCAGTGGCAGGG + Intergenic
1022917744 7:34976514-34976536 TAGTTGCTAAAGCAGTGGCAGGG + Intronic
1023099613 7:36702936-36702958 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1023724574 7:43129108-43129130 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1024061995 7:45704872-45704894 GAGGTAATGGAGCAGGGGCAGGG - Intronic
1024631874 7:51255873-51255895 TAAGGGACAAAGCAGGGGCTGGG - Intronic
1025017654 7:55452089-55452111 TAGTTGGTAAAGTAGTGGCAGGG - Intronic
1025196139 7:56935448-56935470 AAACTGATAAAGCAGTGGCAGGG + Intergenic
1025286446 7:57666074-57666096 TAGTTGATAGAGGAGTGGCAGGG + Intergenic
1025675808 7:63641486-63641508 AAACTGATAAAGCAGTGGCAGGG - Intergenic
1025945868 7:66104057-66104079 TAGTTGATAAAGTAGGAGCAGGG - Intronic
1026092414 7:67312000-67312022 TAGCTGATAAAGCAGCACCAGGG - Intergenic
1026255947 7:68711501-68711523 TAGCTGGTAAAGCAGGAACAGGG - Intergenic
1027006180 7:74695266-74695288 TAGTTCATAAAGCAATGGCAGGG + Intronic
1027379135 7:77586740-77586762 TAGTTGATAAAGCAGTGGAAGGG - Intronic
1027490814 7:78823650-78823672 TAGGTGATAAAGAAGTAGCATGG + Intronic
1027511959 7:79094150-79094172 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1027526582 7:79277002-79277024 TAGTTGATAAAGCAGTGCCAGGG + Intronic
1027573611 7:79903496-79903518 TAGCTGATAGAGCAGCAGCAGGG + Intergenic
1027596311 7:80178312-80178334 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1027632235 7:80620888-80620910 TGGTTGATGAAGCAGTGGCAGGG + Intronic
1027742535 7:82028945-82028967 TATTTGATAAAGCAGTGCCAGGG + Intronic
1027908753 7:84220084-84220106 TAGTTGATAATGCATGGGCAGGG - Intronic
1028065041 7:86373626-86373648 TAGTTGATAAAGCAGTAGCAAGG + Intergenic
1028178191 7:87681985-87682007 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1028345008 7:89768959-89768981 TAGTTGATGAAGTAGTGGCAGGG + Intergenic
1028661032 7:93275233-93275255 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1028675588 7:93456984-93457006 TAGGTGATACAGGAGCTGCAGGG + Intronic
1028696073 7:93714531-93714553 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1028870697 7:95768639-95768661 TATTTGATAAAGCAGTGGCAGGG + Intergenic
1028876255 7:95826675-95826697 AAGGAAATAAAGCAGGGGAAAGG + Intronic
1029377851 7:100191870-100191892 TAGCTGATAAAGCAGCACCAGGG - Intronic
1029981287 7:104881674-104881696 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1030151079 7:106405694-106405716 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1030567581 7:111178576-111178598 TTGCTGATAAAGCAGTGACAGGG - Intronic
1030587580 7:111439857-111439879 TAGGTGGTAAAGCAGTGACAGGG - Intronic
1031183569 7:118447152-118447174 TGGTTGATAAAGCAGTGGCGGGG - Intergenic
1031511413 7:122655215-122655237 TAGCTGATAAAGCAGTGGCAGGG + Intronic
1031645081 7:124215347-124215369 TAAGTGATTATGCTGGGGCAGGG + Intergenic
1031698400 7:124890423-124890445 TAGTTGATAATGCAGCAGCAGGG + Intronic
1031726020 7:125240341-125240363 TAGTTGATAAAGCAGCAGCAAGG + Intergenic
1031735784 7:125359386-125359408 TAGTAGATAAAGCAGCTGCATGG - Intergenic
1031860088 7:126969369-126969391 TAGTTGATGAAGCAGTGGCAGGG - Intronic
1032031761 7:128490072-128490094 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1032235359 7:130117454-130117476 TAGTTGATTAAGCAGTGGCAGGG - Intronic
1032374803 7:131402136-131402158 TAGCTGATAAAGCAGCAGCAGGG - Intronic
1032712863 7:134476767-134476789 TAGTTGATAAAGCACTGGCAGGG - Intergenic
1032983282 7:137309572-137309594 TAGGTGATAAAGCAGTGGGAAGG - Intronic
1033241854 7:139686787-139686809 TCGTTGATAAAGCAGTGGCAGGG + Intronic
1033468861 7:141624795-141624817 TAGTTGACAAAGCATTGGCAGGG + Intronic
1034093406 7:148384587-148384609 TGGGTGAAAAAGCAGAGGCTTGG - Intronic
1034210926 7:149361979-149362001 TTGTTGATAAAGCAGCAGCAGGG + Intergenic
1034404666 7:150895166-150895188 TGGTTGATAAAGCAGCAGCAGGG + Intergenic
1034568956 7:151939747-151939769 TAGCTGACAAAGCAGTGGCAAGG + Intergenic
1034582633 7:152058772-152058794 TAGTTGATAAAGTAGCAGCAGGG - Intronic
1034727628 7:153353346-153353368 TGGTTGATAAAGCAGCAGCAGGG + Intergenic
1034743627 7:153502033-153502055 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1035036188 7:155896358-155896380 TAGTTGATAAAGCAGTGGAAGGG + Intergenic
1035071459 7:156148170-156148192 ATGGTGATACGGCAGGGGCAGGG - Intergenic
1035071476 7:156148223-156148245 ACGGTGATACGGCAGGGGCAGGG - Intergenic
1035128806 7:156631623-156631645 TAGGAGACAAAGCTGGGCCAAGG - Intergenic
1035144537 7:156801073-156801095 TAGTTGATAAAACAGAGGCAGGG + Intronic
1035387274 7:158482227-158482249 TATTTGATAAGGCAGTGGCAGGG + Intronic
1035426122 7:158775445-158775467 TAGTTGATAAAGGAGTAGCAGGG - Intronic
1035455119 7:159003403-159003425 TAGTTGATAAAGCAGTAGCAGGG - Intergenic
1035958896 8:4115003-4115025 TAGTTGATAATGCAGAAGCATGG + Intronic
1036254967 8:7198650-7198672 TAGCTGAGAAAGCTGGGGAATGG - Intergenic
1036621131 8:10425082-10425104 TAGGTGCGAAAGAAGGGGAAAGG - Intronic
1036664611 8:10730528-10730550 AAGCTGATAAATCAGGGGCCGGG - Intronic
1036933906 8:12982239-12982261 GAGGTGATAGGGAAGGGGCAGGG + Intronic
1037145837 8:15571760-15571782 TAGTTGATAGAGCAGTGGCAGGG - Intronic
1037218437 8:16486379-16486401 TAGTTGATAAAGCAATGGCAAGG - Intronic
1037263541 8:17034888-17034910 TATTTGATAGAGCAGTGGCAAGG + Intronic
1037417267 8:18665576-18665598 TAGTTCATAAAGCAGTAGCAGGG + Intronic
1038130477 8:24725093-24725115 TAGTTGATAAAGCAGCTGCAGGG + Intergenic
1038297457 8:26308411-26308433 TAGTTGATAAAGCAGCAGTAGGG - Intronic
1038621918 8:29152304-29152326 TAGTTGATAAAGCAGTGTCAGGG + Intronic
1039212139 8:35229547-35229569 TAGTTGATAAAGCACCAGCAGGG - Intergenic
1039670490 8:39591377-39591399 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1039702078 8:39972271-39972293 TAGTTGATAAAGCATCAGCAGGG + Intronic
1040033551 8:42847126-42847148 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1040075909 8:43230178-43230200 TAGTTGATGAAGCAATGGCAGGG - Intergenic
1040601382 8:48887630-48887652 TAGTTGATAAAGCAGAAGCAGGG - Intergenic
1040774018 8:51016968-51016990 TAGTCGATAAAGCAGTGGCAGGG - Intergenic
1040841270 8:51787731-51787753 TAGTTGATAAGGCAGTAGCAAGG + Intronic
1041099971 8:54386326-54386348 TAGTTGAGAAAGCAGTGGCAGGG - Intergenic
1041432413 8:57797978-57798000 TAATTGATAAAGCAGTGGCAGGG + Intergenic
1041450630 8:58003047-58003069 TAGTTGATAAAACAGTGGCAGGG - Intronic
1041779894 8:61566498-61566520 TTGTTGATAAGGCAGTGGCAGGG + Intronic
1041926200 8:63239299-63239321 TAGCTGATAAAGCAGATGCCAGG - Intergenic
1042045207 8:64643702-64643724 TAGTTGATAAAGCAGCAACAGGG - Intronic
1042409720 8:68449989-68450011 TAGTTGATAAAGCAGTGACAGGG - Intronic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1042575112 8:70209395-70209417 TAGTTGATAAGGCAGGAACAGGG + Intronic
1043172991 8:76988772-76988794 TAATTGATAAAGCAATGGCAGGG - Intronic
1043421001 8:80098718-80098740 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1043580011 8:81701048-81701070 TAGTTGATAAAGCTGTGGCAGGG + Intergenic
1043990755 8:86751023-86751045 TATTTGATAAAGCAGCAGCAAGG - Intergenic
1044089669 8:87983472-87983494 TAGTTTATAAAGCAGCAGCAGGG - Intergenic
1044114430 8:88317134-88317156 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1044259419 8:90100146-90100168 TAGTTGATAAAGCAGTGACAGGG - Intergenic
1044461363 8:92448287-92448309 TAGTTGATAAAGCAGGGGCAAGG + Intergenic
1045094467 8:98783728-98783750 TAATTGAGAAAGCAGTGGCAGGG - Intronic
1045131505 8:99159353-99159375 TGGTTGATAAAGCAATGGCATGG + Intronic
1045573128 8:103390557-103390579 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1045670426 8:104545351-104545373 TAGTTGATAAAGCAGCAGCAGGG + Intronic
1045948271 8:107822210-107822232 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1046571625 8:115973403-115973425 TGATTGATAAAGCAGTGGCAGGG - Intergenic
1046597080 8:116273291-116273313 TCTGTGATGAAGCATGGGCAGGG - Intergenic
1046653044 8:116860300-116860322 TGGTTGATAAAGCAGTGGTAGGG + Intronic
1046744039 8:117858192-117858214 TAGTTGACAAAGCAGTGGCAGGG + Intronic
1046753862 8:117953665-117953687 GAGGTGATAAAACAGTTGCAGGG - Intronic
1047207568 8:122815638-122815660 TAGTTGATAAAGCTGCCGCAGGG + Intronic
1047400769 8:124545231-124545253 TAGTTGATTAAGCAGTAGCAGGG + Intronic
1047400896 8:124546262-124546284 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1047614390 8:126551412-126551434 TTGATGAGAAAGCAGGGGAAGGG - Intergenic
1047703799 8:127477167-127477189 TAGTTGATAAAGCAGCAGTAGGG + Intergenic
1047794845 8:128244135-128244157 TAGTTAATAAAGCAGCAGCAGGG - Intergenic
1048830983 8:138477311-138477333 TAGGTGACAAAGAAGAGGTAAGG - Intronic
1049227580 8:141464691-141464713 TTACTGATAAAGCAGTGGCAGGG + Intergenic
1049628861 8:143640514-143640536 TAGTTGATAAAACACAGGCAGGG - Intronic
1049739325 8:144228908-144228930 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1050383661 9:5060422-5060444 TAGTACATAAAGCAGTGGCAGGG - Intronic
1051123965 9:13782939-13782961 TAGTTGATAGAGCAGGGGCAGGG + Intergenic
1051147072 9:14038452-14038474 TCGTTGATAAAGTAGTGGCAGGG - Intergenic
1051473614 9:17477825-17477847 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1051542808 9:18239338-18239360 TAGTTCATAAAGCAGCAGCAGGG - Intergenic
1051601577 9:18879900-18879922 TAATTAATAAAGCAGTGGCAGGG - Intronic
1051721689 9:20043828-20043850 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1051753731 9:20372253-20372275 TAGTCGATAAAGCAGTGGCAGGG + Intronic
1051767279 9:20539256-20539278 TAGTTGATAAAGCAGTGGCAAGG - Intronic
1051783349 9:20714559-20714581 CAGGTGGTAAAGCAGGACCATGG - Intronic
1052758780 9:32568482-32568504 TAGTTGATAAAGCAGCGGCATGG + Exonic
1052760483 9:32585731-32585753 TAGTTGATAAAGCAGCAGCATGG - Intergenic
1052986417 9:34491263-34491285 TAAGCTAGAAAGCAGGGGCAGGG - Intronic
1052989156 9:34508577-34508599 GAGCTGGGAAAGCAGGGGCAGGG - Intronic
1053132661 9:35626479-35626501 TAGTTGATAGAGCAGTGTCAGGG + Intronic
1053217525 9:36284635-36284657 CAGTTCATAAAGCAGTGGCATGG - Intronic
1053575202 9:39352950-39352972 TAGTGGATAAAGCAGTGGTAGGG + Intergenic
1053748828 9:41233422-41233444 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1053793960 9:41708100-41708122 TAGTTGATAAAAGAGTGGCAGGG + Intergenic
1053839706 9:42180884-42180906 TAGTGGATAAAGCAGTGGCAGGG + Intergenic
1054096764 9:60911633-60911655 TAGTGGATAAAGCAGTGGTAGGG + Intergenic
1054118168 9:61187259-61187281 TAGTGGATAAAGCAGTGGCAGGG + Intergenic
1054182372 9:61920118-61920140 TAGTTGATAAAAGAGTGGCAGGG + Intergenic
1054337549 9:63819965-63819987 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1054470991 9:65537859-65537881 TAGTTGATAAAAGAGTGGCAGGG - Intergenic
1054589587 9:66995305-66995327 TAGTGGATAAAGCAGTGGCAGGG - Intergenic
1054656138 9:67668361-67668383 TAGTTGATAAAAGAGTGGCAGGG - Intergenic
1054839532 9:69721503-69721525 TAGTTGATAAAGCAGCAGCAAGG + Intronic
1054895777 9:70309477-70309499 TAGGTGATAAAGTAGAGGCAGGG - Intronic
1054994619 9:71371683-71371705 TAGTTGGTAAAGCAGAGGCAGGG + Intronic
1055377363 9:75663970-75663992 TAGTTGATAAAACAGTGACAGGG + Intergenic
1055402246 9:75936430-75936452 TAGTTAATAAAGCAGTGGCAGGG - Intronic
1055645019 9:78355185-78355207 TAGGAAATAAAGCAGTGACAGGG - Intergenic
1055658817 9:78480400-78480422 AAGTTGATAAAGCAGCAGCAGGG - Intergenic
1056140220 9:83670763-83670785 TTGTTGATAAAGCAGTGGCAGGG - Intronic
1056175127 9:84027187-84027209 TAGATGATAAAGCAGTGGCAGGG + Intergenic
1056181543 9:84088288-84088310 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1056261179 9:84850454-84850476 AAGGTGATAAAGCTGGAGCCAGG + Intronic
1056879151 9:90373063-90373085 TAATTGATAAAGCAGTGGCAGGG + Intergenic
1056959248 9:91107399-91107421 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1056979471 9:91295398-91295420 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1057250338 9:93495907-93495929 TAGTTGATAAAGCAGTGGCAGGG - Intronic
1057279507 9:93699732-93699754 TGGGTGACAAAGCAGGGCCAGGG + Intergenic
1057311957 9:93948501-93948523 TAGGTGAAAAGCCAGGGGGAGGG + Intergenic
1057323948 9:94042824-94042846 TGGTTGATAAAGCAGTGGCAGGG - Intronic
1057735405 9:97654268-97654290 TAGCTAATAAAGCAGTGGCAGGG - Intronic
1058628030 9:106955690-106955712 TAGCTGATAAAGTAGTGGCAGGG - Intronic
1058638689 9:107061746-107061768 TAGTTGATAAAACAGTGGCAGGG - Intergenic
1058769328 9:108215095-108215117 TACGTGATAAAGGAAAGGCAGGG - Intergenic
1059129409 9:111729924-111729946 TAGTTGATAAAGTAGTGGCAGGG - Intronic
1059572371 9:115452912-115452934 TAGTTGTTAAAGCAGCAGCAGGG - Intergenic
1059711952 9:116876445-116876467 TGCTTGATAAAGCAGTGGCAGGG + Intronic
1059844377 9:118256814-118256836 TAGTTAATAAAGCAATGGCATGG + Intergenic
1060066561 9:120506898-120506920 TAGTTGATAAAGCAGTAGCAGGG + Intronic
1060235123 9:121857296-121857318 TAAGTGATACAGAGGGGGCAGGG - Intronic
1203445206 Un_GL000219v1:47578-47600 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1203363904 Un_KI270442v1:241168-241190 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1186255889 X:7719116-7719138 TAATTGATAAAGAAGTGGCAGGG - Intergenic
1186706889 X:12149688-12149710 TAGTTGATAAAGAAGCAGCAGGG + Intronic
1186942212 X:14522135-14522157 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1186969710 X:14828394-14828416 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1186994902 X:15110017-15110039 TAGTTGATAAAGCAGCGGCAGGG + Intergenic
1187026781 X:15444027-15444049 CAGTTGATAAAGCAGTGGCAGGG + Intronic
1187074946 X:15925419-15925441 TAGATGATAAGGCAGTGGCAGGG + Intergenic
1187110749 X:16297196-16297218 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1187516749 X:19978646-19978668 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
1187846862 X:23547905-23547927 TAGTTGATAAAGCAGTGACAAGG + Intergenic
1188093361 X:25990680-25990702 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1188238520 X:27757237-27757259 TAGCAGATAAAGCAGTGCCAGGG + Intergenic
1188291321 X:28392381-28392403 AAGTTGATAAAGCAGTGGCAAGG - Intergenic
1188456033 X:30367087-30367109 TAGCTGATAAAGCAGCAGCAGGG - Intergenic
1188591533 X:31842401-31842423 TAGTTGGTAAAGCAGCAGCAGGG + Intronic
1189708475 X:43783883-43783905 TAGTTGATAAAGCAGTGACAGGG - Intronic
1189930759 X:46006717-46006739 CAGTTGATAAAGTAGGAGCAGGG - Intergenic
1189942734 X:46142720-46142742 TGGTTGATAAAGCGTGGGCAGGG + Intergenic
1189951786 X:46239792-46239814 TAGTTGACAAAGCAGCAGCAGGG + Intergenic
1190460600 X:50669636-50669658 TAGTTGATAAAATAGTGGCAGGG - Intronic
1190482050 X:50887327-50887349 TAGTTGATAGAGCAGTGGCAGGG - Intergenic
1190814626 X:53918943-53918965 TGGTTGATAAAGCAGCAGCAAGG + Intergenic
1191019236 X:55842152-55842174 GAGGTGATCAGGCAGGGGCAGGG + Intergenic
1191728662 X:64310141-64310163 TAGTTGAAAAAGCAGTGTCACGG - Intronic
1192078826 X:68028021-68028043 TAGTTGATAAAGTGGTGGCAAGG + Intergenic
1192388739 X:70702075-70702097 TAGTTGATAAAGCAGTGGCAGGG + Intronic
1192676766 X:73204568-73204590 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1193218188 X:78889836-78889858 CAGTTGATAAAGCAGCAGCAGGG + Intergenic
1193470424 X:81895418-81895440 TAGTTGATAAAGCAGTGGCAGGG - Intergenic
1193615121 X:83677679-83677701 TAGTTGTTCAAGCAGTGGCAGGG - Intergenic
1193966292 X:87990855-87990877 TAGATGATAAAGCAGCAGCAGGG - Intergenic
1194120961 X:89963129-89963151 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1194167769 X:90541443-90541465 TAGTTGATAAAGCAATGGCAGGG - Intergenic
1194181287 X:90714536-90714558 TAGTTGATAAAACAGTGCCAAGG + Intergenic
1194195156 X:90883243-90883265 GAAGTGCTCAAGCAGGGGCAGGG + Intergenic
1194286360 X:92015481-92015503 TACTTGATAAGGCAGTGGCAGGG - Intronic
1194641370 X:96407293-96407315 AAGCTGACAAAGCAGGGTCAGGG + Intergenic
1194846333 X:98814010-98814032 TAGTTGAAAAAGCAGTGGCAGGG - Intergenic
1194865218 X:99056589-99056611 TAGTTGATAAAGCAGTGGCAAGG - Intergenic
1195011316 X:100734574-100734596 TAGTTGATAAAGCAGCAGCAGGG + Intergenic
1195231070 X:102848476-102848498 AACTTGATAAAGCAGTGGCAGGG - Intergenic
1195339016 X:103886665-103886687 TAGTTGATAAAACAGTGTCAGGG + Intergenic
1195628277 X:107026828-107026850 TATTTGATAAAGCAGTGGCAGGG - Intergenic
1195792521 X:108603807-108603829 TAGTTGATAAAGCAGCAGCAGGG - Intronic
1195819116 X:108923642-108923664 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1195987709 X:110648651-110648673 TAATTGATAAAGCAGCAGCAGGG - Intergenic
1196029439 X:111080119-111080141 TAGTTGATAAAGCATCAGCAGGG + Intronic
1196067096 X:111476006-111476028 TAGTTGGTAAAACAGTGGCAGGG - Intergenic
1196112526 X:111962667-111962689 TAGTTGATAAAACAGTGGCAGGG + Intronic
1196260089 X:113568891-113568913 TAGTTAATAAAGCAGTGGCAGGG - Intergenic
1196384612 X:115135614-115135636 TATTTGATAAAGCAGTGGCAGGG + Intronic
1196466376 X:115975196-115975218 AAAGTGAAAAAGCAGGGGGATGG + Intergenic
1196721690 X:118860368-118860390 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1196971497 X:121114277-121114299 TAATTGATAAAGCAGCAGCAAGG - Intergenic
1197129200 X:122984770-122984792 TGTTTGATAAAGCAGTGGCAGGG - Intergenic
1197358351 X:125466038-125466060 TAGTTGATAAAGCAGCAGCAGGG - Intergenic
1197386139 X:125804802-125804824 TAGTTGATAAAGCAGCAGCATGG + Intergenic
1197987536 X:132282711-132282733 TAGTTGATAAAGCAGTAGCAGGG + Intergenic
1198161325 X:134011473-134011495 TAAATGATAAACCAGGGGCTGGG + Intergenic
1198199809 X:134404533-134404555 TGGTTGATAAAGCAGTGGCAGGG + Intronic
1198304942 X:135371506-135371528 TAGTTGATAGAGCAGTGGCAAGG + Intergenic
1198414701 X:136408103-136408125 GAGCTTATAAAGGAGGGGCAGGG + Intronic
1198621237 X:138512637-138512659 TAGTTGATACAGCAGTGGCAGGG - Intergenic
1198826436 X:140703002-140703024 TAGTTGATAAAGCAGCAGCATGG - Intergenic
1198970564 X:142274037-142274059 TAGTTGATGAGGCAGTGGCACGG - Intergenic
1199103129 X:143829499-143829521 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1199409485 X:147504135-147504157 GAGTTGATAAAGCAGTGGCAGGG + Intergenic
1199916626 X:152349090-152349112 TAGTTGATAAAGCAGTGCCAGGG - Intronic
1200013918 X:153144219-153144241 TAGTTGATACAGCAGTGGCAGGG + Intergenic
1200025682 X:153255734-153255756 TAGTTGATACAGCAGTGGCAGGG - Intergenic
1200153929 X:153965273-153965295 TAGGTGTGGCAGCAGGGGCAGGG - Intronic
1200389038 X:155924876-155924898 CAGCTGATAAAGCAGTAGCAGGG - Intronic
1200473824 Y:3620633-3620655 TAGTTGATAAAGCAGTGGCAGGG + Intergenic
1200514022 Y:4119233-4119255 TAGTTGGTAAAGCAATGGCAGGG - Intergenic
1200527916 Y:4296455-4296477 TAGTTGATAAAACAGTGTCAAGG + Intergenic
1200603906 Y:5240033-5240055 TACTTGATAAGGCAGTGGCAGGG - Intronic
1202372984 Y:24210722-24210744 AAGGTGGCAAAGTAGGGGCAGGG + Intergenic
1202497798 Y:25459398-25459420 AAGGTGGCAAAGTAGGGGCAGGG - Intergenic