ID: 923764681

View in Genome Browser
Species Human (GRCh38)
Location 1:236882195-236882217
Sequence GGTCCATGGCTGAGTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923764678_923764681 -5 Left 923764678 1:236882177-236882199 CCATAGGAGCTTATGTCAGGTCC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 923764681 1:236882195-236882217 GGTCCATGGCTGAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923764681 Original CRISPR GGTCCATGGCTGAGTGCTGT GGG Intronic
900931102 1:5738263-5738285 TCTCCATGGCTGAATGGTGTTGG + Intergenic
901066579 1:6497306-6497328 GCTCCATGGGTGAGTGCAGGCGG - Intronic
901933645 1:12613618-12613640 AGTTCCTGGCTGGGTGCTGTAGG + Intronic
901956736 1:12791398-12791420 GCTCCAGGAATGAGTGCTGTGGG - Exonic
901980120 1:13027545-13027567 GCTCCAGGAATGAGTGCTGTGGG - Intronic
902001964 1:13201386-13201408 GCTCCAGGAATGAGTGCTGTGGG + Intergenic
902021187 1:13347111-13347133 GCTCCAGGAATGAGTGCTGTGGG + Exonic
903015498 1:20358933-20358955 GGTCCACGGTTGGGAGCTGTAGG - Intergenic
903882307 1:26519554-26519576 GGTCCATGGCAGACTTCTCTCGG - Intergenic
905931130 1:41788405-41788427 GGTCATTGGCTGAGTGGTCTTGG - Intronic
907642275 1:56203000-56203022 GGGACTTGGCTGAGTGCTGGAGG - Intergenic
907704131 1:56818615-56818637 CTTGGATGGCTGAGTGCTGTTGG - Intronic
909800947 1:79806472-79806494 GGACCATGGCCCAGTGCTGGGGG + Intergenic
911472842 1:98339717-98339739 GGTACATGTCTGGGTGCTGAGGG - Intergenic
912748691 1:112267708-112267730 CATTCATGGCTGTGTGCTGTTGG - Intergenic
912948838 1:114106708-114106730 GGTCCATGGGGGTGTGGTGTGGG - Intronic
915481019 1:156185136-156185158 TGTCCAGGGCTGAGTCCTGCAGG + Intergenic
916437118 1:164787527-164787549 TGTCCTTGGCTGAGTGACGTGGG - Intronic
920290712 1:204921205-204921227 AGGGCATGGCTAAGTGCTGTGGG - Intronic
922770001 1:228176585-228176607 GCCCCATGGCTGTGAGCTGTCGG + Exonic
923764681 1:236882195-236882217 GGTCCATGGCTGAGTGCTGTGGG + Intronic
1063842437 10:10087975-10087997 GGTCCATGGCTCAGGGCTTGGGG + Intergenic
1067570787 10:47369409-47369431 TGGCCCTGGCTGAGTGCTGAGGG + Intronic
1073045966 10:100638301-100638323 GGTGCACGCATGAGTGCTGTTGG - Intergenic
1074444822 10:113513012-113513034 GCTGCCTGGCTGAGTGCTGAGGG - Intergenic
1076584206 10:131534036-131534058 GGCCCATGGCTGAGAACTGGGGG + Intergenic
1077343589 11:2036619-2036641 GGGCCAGGGCTGGGAGCTGTTGG + Intergenic
1078185365 11:9047443-9047465 GGTTCATGCCTGAGAGCTGGAGG + Exonic
1078729246 11:13961123-13961145 GATCCATGTCTGAGTGCTGAGGG - Intergenic
1083173205 11:60934883-60934905 GGTCTAGGTCTGAGTGCAGTGGG + Intronic
1083324346 11:61865899-61865921 GGGCCATGGCTGATGGCTGACGG - Exonic
1084263046 11:67991204-67991226 GGTCCGCGGCCGAGAGCTGTGGG + Exonic
1084446075 11:69204473-69204495 GGTCCAAGTCTGACTGCTGTGGG + Intergenic
1089710200 11:120309054-120309076 AGTCCATGGATGAGTTATGTGGG - Intronic
1090716861 11:129438796-129438818 TGTGCATTGCTGAGTGCAGTAGG + Intronic
1202826575 11_KI270721v1_random:91808-91830 GGGCCAGGGCTGGGAGCTGTTGG + Intergenic
1092243399 12:6849485-6849507 GGTCCATGGGTGAGTGTGGGAGG - Intronic
1094580407 12:31729046-31729068 GGTCCCTGGCTGGGTTCTGGAGG - Exonic
1096623203 12:52877416-52877438 CGTGCAGGGCTGTGTGCTGTGGG - Intergenic
1096984247 12:55745739-55745761 GGTCCAGGGTTGAGGGCTGGGGG - Intronic
1098096301 12:66960355-66960377 AGTCAATTGCTAAGTGCTGTTGG - Intergenic
1100500646 12:95170857-95170879 TATACATTGCTGAGTGCTGTGGG + Intronic
1103995620 12:124828248-124828270 GGTGCAGGGGAGAGTGCTGTGGG - Intronic
1107912631 13:45119835-45119857 GGTGCATGGCGGAGTGATGGTGG + Intergenic
1113887680 13:113669579-113669601 GCTCCGTGGCTGTGTGCAGTGGG + Intronic
1118777962 14:68985582-68985604 GGGTGATGGCTGAGTGCTGCTGG - Intergenic
1119378574 14:74214417-74214439 GGCCCATGGCTGAGCGCTGTGGG - Intergenic
1127282248 15:57502308-57502330 TTTCCATGCCTGAGAGCTGTGGG + Intronic
1127332844 15:57955624-57955646 GCTCAGAGGCTGAGTGCTGTGGG + Intronic
1128589309 15:68880687-68880709 GGGCCAGGGCTGTGTCCTGTGGG - Intronic
1131787772 15:95931604-95931626 GGTCCAGGGGAGAATGCTGTGGG + Intergenic
1134202351 16:12209589-12209611 GCTCCATGGCTGGGACCTGTAGG + Intronic
1136157334 16:28391985-28392007 GGTCCGGGGCGGAGTGCCGTTGG - Exonic
1136205752 16:28723296-28723318 GGTCCGGGGCGGAGTGCCGTTGG + Exonic
1136317297 16:29461763-29461785 GGTGCATGGCTGGGTCCTGGGGG + Exonic
1136431872 16:30201106-30201128 GGTGCATGGCTGGGTCCTGGGGG + Exonic
1136591272 16:31219205-31219227 GGGCCATGTCTGAGGGCTGGGGG + Intronic
1137617770 16:49857238-49857260 TGTCCATCGCTCGGTGCTGTTGG - Intronic
1138413973 16:56860682-56860704 CGCCCCTGGCTGAGTGCAGTGGG - Intergenic
1139964335 16:70737216-70737238 GGTCCTGGGCTGGGTGCTGCAGG + Intronic
1140266519 16:73426036-73426058 GGCCCAAGGGTGAGTGCTATGGG - Intergenic
1141513023 16:84524921-84524943 GGTCCCAGGCTGAGGGCTGCAGG - Intronic
1145942182 17:28748365-28748387 GGTGCAGGGCTGAGTGCGCTTGG - Exonic
1147384661 17:40074226-40074248 GGTCCCGGGCTGTGTGCTGGGGG - Exonic
1148818959 17:50349203-50349225 GGTAGATGGCAGAGAGCTGTAGG - Intronic
1150807061 17:68327742-68327764 GAGCCATGGCTGCTTGCTGTGGG - Intronic
1156173722 18:34517134-34517156 TGTGGATGGCTGAGTGTTGTGGG - Intronic
1157220791 18:45827356-45827378 GGTCCATGGCTGTGTGGGGTGGG - Intronic
1157585085 18:48795895-48795917 GGTACCTGGCTGAGAGCTGTGGG - Intronic
1158241826 18:55386323-55386345 TGTCCATGGCTGTGTGATATTGG - Intronic
1158303046 18:56074403-56074425 GATCCATGTCTGAGTCCTGTGGG + Intergenic
1160495957 18:79375586-79375608 AGTCATGGGCTGAGTGCTGTTGG + Intronic
1160501972 18:79406105-79406127 AGTTCAGGGCTGAGTCCTGTGGG + Intronic
1160589962 18:79938338-79938360 AGGCCATGGCTGACTGCGGTTGG - Intronic
1160691502 19:462339-462361 GGCCCTAGGCTGAGGGCTGTGGG + Intergenic
1161470951 19:4456581-4456603 GGTGCAAGGCTGAGGGCTGTTGG - Intronic
1161974058 19:7599268-7599290 GGTGGATGGATGAGTGCAGTGGG - Intronic
1161974104 19:7599435-7599457 GGTGGATGGATGAGTGCAGTGGG - Intronic
1163114409 19:15180546-15180568 GGTGTGTGGCTGAGTGGTGTGGG - Intronic
1163258124 19:16170157-16170179 GGCCCAGGGCTGAGTGTTCTTGG - Intronic
1168405718 19:56109234-56109256 GGTAGATGGCTGGGTGCTGGGGG + Intronic
1168641772 19:58035433-58035455 GGTCCTGGGCTGAGGTCTGTGGG - Intronic
925852009 2:8090988-8091010 GGTTCAAGGCTGAGTGGTGAGGG - Intergenic
927496440 2:23554701-23554723 GGCCCAGGGCTGAGGGCTGCTGG + Intronic
928478361 2:31654455-31654477 GGTGCGTGGGTGAGTGCTGGGGG + Intergenic
929682380 2:44004580-44004602 GGTCTATTGGAGAGTGCTGTAGG + Intergenic
931659340 2:64544000-64544022 GTTCCATTGCTGACTGCTATTGG + Intronic
931790912 2:65663469-65663491 GGCTCATGGCTTGGTGCTGTTGG + Intergenic
931817726 2:65921223-65921245 GGTCCAAGGGGGAGTGCTATGGG - Intergenic
935596757 2:104884706-104884728 ACTACATGGCTGACTGCTGTTGG - Intergenic
937153675 2:119703169-119703191 GGCCCAGGGCTGAGGGCTGAGGG - Intergenic
938102528 2:128506894-128506916 GGGCCATGCCTGAGTGCTCCAGG + Intergenic
938396967 2:130958203-130958225 GATCCCTGGCTGAGAGGTGTAGG + Intronic
938500059 2:131827662-131827684 GGCCCATGGCTGGGTGGCGTGGG + Intergenic
940896072 2:159082629-159082651 TGTCCTTAGCAGAGTGCTGTAGG + Intronic
942040701 2:172059321-172059343 GATGCAAGGCTGAGTGCGGTGGG - Intronic
945366357 2:208959063-208959085 TGTAAATGGCTAAGTGCTGTAGG - Intergenic
945935220 2:215897031-215897053 GTTACATGGCTGAATGCTGTTGG - Intergenic
946033188 2:216721356-216721378 GGCCCATGGGTGATGGCTGTTGG - Intergenic
1172821314 20:37737273-37737295 GGTCAATGGCAGAGTGAGGTGGG + Intronic
1173679573 20:44868395-44868417 AGTCTATTGCAGAGTGCTGTCGG + Intergenic
1173884011 20:46440854-46440876 GGTAGATGCCTCAGTGCTGTAGG + Intergenic
1174708973 20:52685186-52685208 CCTCCATGGCAGAGTGCAGTGGG + Intergenic
1175285876 20:57836430-57836452 GGTCCCAGGCTGGGTGCTGCAGG + Intergenic
1175721886 20:61292636-61292658 CTTCCAAGGCTCAGTGCTGTTGG - Intronic
1175817615 20:61891650-61891672 GGGCCAGGGCTCAGTGCAGTGGG - Intronic
1178594990 21:33945244-33945266 GGTGCATGTCTGGGTGCAGTGGG + Intergenic
1178606485 21:34040677-34040699 GGTGCTTGGCTGAATGCTGAAGG + Intergenic
1183489792 22:38110292-38110314 GCTGTATGGCTGAGTGCTCTCGG + Intronic
1184818541 22:46891044-46891066 GGCCCCTTCCTGAGTGCTGTCGG + Intronic
1184901420 22:47448743-47448765 GGTCCCTCCCTGAGTGCTCTGGG - Intergenic
952881793 3:37990366-37990388 GGACCAAGGCTGGGGGCTGTGGG - Intronic
953912475 3:46899910-46899932 GGTCCATGGCCCAGAGCCGTGGG + Intronic
954699161 3:52442545-52442567 GATCCTTTGGTGAGTGCTGTCGG - Exonic
954750644 3:52811542-52811564 GGCCCTGGGCTGAGTACTGTGGG - Intergenic
955667748 3:61368376-61368398 TGTGCATGGCTGAGTAGTGTGGG - Intergenic
958419624 3:93915571-93915593 TCTCCATGCCTGAGGGCTGTAGG - Intronic
959701675 3:109304632-109304654 GGTCCATGGCAGACTTCTCTCGG - Exonic
967867002 3:194198477-194198499 GCCCCATGGCTGAGTGCTGCTGG + Intergenic
968634502 4:1671009-1671031 GGGCCGTGGCTGTGAGCTGTTGG - Intronic
968685788 4:1957682-1957704 GGCCCAGGGCAGAGTTCTGTCGG - Intronic
969174126 4:5385981-5386003 GGGCCATGGGTGGGGGCTGTGGG - Intronic
969203306 4:5622757-5622779 GGGTCATGGCTGAGTTCTGCAGG + Exonic
969341276 4:6543276-6543298 GGTCCATGCCTGATTGATGAGGG - Intronic
970421492 4:15909441-15909463 GGTCCATGGCCAAGCTCTGTGGG - Intergenic
976147413 4:82055639-82055661 GGGTCATTGATGAGTGCTGTGGG + Intergenic
976303319 4:83535937-83535959 GGACCTTTGCTGAGTGCTGGGGG + Exonic
977564357 4:98566580-98566602 GGGCCAGGGCTGAGTGAAGTGGG + Intronic
977683297 4:99818496-99818518 AGTCTATGGTTGAGTACTGTGGG + Intronic
980501981 4:133668222-133668244 GGTTTATAGCTAAGTGCTGTCGG + Intergenic
980890727 4:138812232-138812254 TATCCAGGGCTGAGGGCTGTGGG + Intergenic
981022029 4:140039380-140039402 GTTCCATGGCTGTGGGCTGTGGG - Intronic
985475476 5:76605-76627 GCTCAATGGCTGAGTTCAGTGGG - Intergenic
985731191 5:1549980-1550002 GGTCCATGGCTGAGGCCGGCAGG - Intergenic
993879733 5:93348273-93348295 AGTCTGTGGCTGAGTCCTGTTGG - Intergenic
995751382 5:115456625-115456647 GGTCAAGGGCAGAGTGCCGTGGG + Intergenic
996920596 5:128763457-128763479 GATCCATGGCTGTGTGCAGGAGG + Intronic
997256551 5:132433077-132433099 AGTCCATTGGTGAGTACTGTTGG + Intronic
998383347 5:141741592-141741614 TCTCCAGGGCTGAGTGCTATAGG + Intergenic
999305038 5:150514024-150514046 GGAGCCTGGCTGAGGGCTGTGGG + Intronic
999796324 5:154992944-154992966 TGCCCATGGCTAAGTGTTGTGGG + Intergenic
1000341040 5:160277662-160277684 GGTCCCTGGCTGAGCCCTGTTGG + Intronic
1000623818 5:163516020-163516042 AGTCAAAGGCTGAGTGCGGTGGG - Intronic
1000924748 5:167180004-167180026 GGGCCAAGGCTGAGTCCTGTTGG + Intergenic
1006393002 6:33769882-33769904 TGTCCATGGCTGAGATTTGTGGG + Intergenic
1006803030 6:36771509-36771531 GGCCCATGGTTAAGTGCTATAGG + Intronic
1006990604 6:38211968-38211990 GACCCATGGCTGGGTGATGTGGG + Intronic
1008015481 6:46513791-46513813 GGTTGATGGCTGAGTGCTCAGGG + Intergenic
1008692323 6:53993338-53993360 TGCCCAAGGCTGAGGGCTGTAGG + Intronic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1019382468 7:731230-731252 GCTCCATAGCTGATAGCTGTCGG + Intronic
1019527578 7:1487596-1487618 CGTCCCTGGCTTACTGCTGTGGG - Intronic
1022478907 7:30730201-30730223 GGTGGATGGGTGAGTGCAGTTGG - Intronic
1022524628 7:31029053-31029075 GGTCCACGGCTGAGTGTTCTGGG - Intergenic
1023396367 7:39755439-39755461 GTGCTATGGCTGAGTGCAGTGGG + Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1027233809 7:76286430-76286452 GGACCCTGGCTGAGGGCTGGTGG + Exonic
1028798798 7:94937162-94937184 TGTACATGTCTGAGTGTTGTGGG + Intronic
1030773758 7:113508030-113508052 GGACCTTGGCTGGGTGCGGTGGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1033494631 7:141881669-141881691 GCTCCATGGCTGTGTGTAGTTGG + Intergenic
1036812910 8:11879994-11880016 GGTCCATGGCTGCCTGTTGGAGG + Intergenic
1037826185 8:22162017-22162039 GGTCCCTGGCTTAGTGGTCTTGG - Intronic
1039839126 8:41281023-41281045 GGGCCAAGGCTGAGCCCTGTGGG + Intronic
1040536712 8:48316949-48316971 GGCCAAGGGCTGAGTGCAGTGGG + Intergenic
1040675608 8:49745849-49745871 TGTTCATGGCTTCGTGCTGTGGG - Intergenic
1041154732 8:54973532-54973554 GCTCCCTGGCTGAGTGGTGTTGG - Intergenic
1043270791 8:78330262-78330284 GGTCTAGGGCTGAAGGCTGTTGG - Intergenic
1045397156 8:101772540-101772562 TGTCCAGGGCTGAGGGCAGTGGG - Intronic
1045417307 8:101980144-101980166 GGCCATTGTCTGAGTGCTGTAGG - Intronic
1048985734 8:139733796-139733818 GGTCAAGGGCAGAGGGCTGTGGG - Intronic
1049191172 8:141288587-141288609 GGTCCCTGGCTGTGTGAAGTAGG - Intronic
1054356346 9:64067024-64067046 GGAGCATGGCTGGCTGCTGTCGG - Intergenic
1058419365 9:104819821-104819843 GGTCCCAGGCTGGGTGCGGTTGG - Intronic
1061424074 9:130488441-130488463 GGGCCTGGGCTGTGTGCTGTGGG + Intronic
1061868398 9:133507148-133507170 GGGCCATGGCTGAGAACTGCTGG + Intergenic
1062249916 9:135588791-135588813 GGTCCAGGGCTGGGTGGGGTGGG + Intergenic
1188329407 X:28850429-28850451 GGCCCATTGCTGAGGGATGTGGG + Intronic
1188981656 X:36732328-36732350 GGTACATGGCTAAATGATGTAGG - Intergenic
1189490264 X:41465945-41465967 TGTCCTTGGCTGAGTTCTGAAGG - Intronic
1190165662 X:48071240-48071262 GGGGCCTGGCTGAGTGCTGCGGG - Intronic
1190259954 X:48791353-48791375 TGGCATTGGCTGAGTGCTGTTGG + Intronic
1190748464 X:53340992-53341014 GTTCCAGGGCTGTGTGCTGCTGG + Intergenic
1192727623 X:73769009-73769031 GGCCCATGCCTGGGTGCTGCGGG - Intergenic
1192930786 X:75803705-75803727 GGTCTATGGATGACTGCTCTGGG - Intergenic
1197970738 X:132112425-132112447 GGTTTATTGCTGAGTCCTGTGGG - Intronic