ID: 923768997

View in Genome Browser
Species Human (GRCh38)
Location 1:236920874-236920896
Sequence ACCTCAGCTGGGAATCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923768992_923768997 9 Left 923768992 1:236920842-236920864 CCAGGGAGAAGGGCTTCAGTCAG No data
Right 923768997 1:236920874-236920896 ACCTCAGCTGGGAATCCTGGAGG No data
923768986_923768997 29 Left 923768986 1:236920822-236920844 CCAGAGTTGGAATTCAAGACCCA No data
Right 923768997 1:236920874-236920896 ACCTCAGCTGGGAATCCTGGAGG No data
923768991_923768997 10 Left 923768991 1:236920841-236920863 CCCAGGGAGAAGGGCTTCAGTCA No data
Right 923768997 1:236920874-236920896 ACCTCAGCTGGGAATCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923768997 Original CRISPR ACCTCAGCTGGGAATCCTGG AGG Intergenic
No off target data available for this crispr