ID: 923770909

View in Genome Browser
Species Human (GRCh38)
Location 1:236936834-236936856
Sequence GCAAGTCCTGCTTTTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923770909_923770920 6 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770920 1:236936863-236936885 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
923770909_923770921 7 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770921 1:236936864-236936886 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002
923770909_923770918 -1 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770918 1:236936856-236936878 CCGCTAAGGGTGAAGGAGAAGGG 0: 201
1: 360
2: 460
3: 354
4: 240
923770909_923770915 -8 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770915 1:236936849-236936871 GGACTTGCCGCTAAGGGTGAAGG 0: 457
1: 585
2: 275
3: 104
4: 106
923770909_923770919 0 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770919 1:236936857-236936879 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
923770909_923770922 8 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770922 1:236936865-236936887 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
923770909_923770916 -2 Left 923770909 1:236936834-236936856 CCCCCTAGAAAAGCAGGACTTGC No data
Right 923770916 1:236936855-236936877 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923770909 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr