ID: 923771851

View in Genome Browser
Species Human (GRCh38)
Location 1:236944406-236944428
Sequence CTCTGATTATGTAAGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923771851_923771853 11 Left 923771851 1:236944406-236944428 CCTACCTACTTACATAATCAGAG No data
Right 923771853 1:236944440-236944462 TTGACACAAGTTATGTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923771851 Original CRISPR CTCTGATTATGTAAGTAGGT AGG (reversed) Intergenic
No off target data available for this crispr