ID: 923772367

View in Genome Browser
Species Human (GRCh38)
Location 1:236948704-236948726
Sequence AGTCCCTGTGGAGCAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923772367_923772373 13 Left 923772367 1:236948704-236948726 CCAGCACCTGCTCCACAGGGACT No data
Right 923772373 1:236948740-236948762 TGTTGTCCTTGTAGCAGTTTTGG No data
923772367_923772375 27 Left 923772367 1:236948704-236948726 CCAGCACCTGCTCCACAGGGACT No data
Right 923772375 1:236948754-236948776 CAGTTTTGGACAGAACTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923772367 Original CRISPR AGTCCCTGTGGAGCAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr