ID: 923772925

View in Genome Browser
Species Human (GRCh38)
Location 1:236953155-236953177
Sequence CTGTGAACAAGGACAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923772925_923772929 3 Left 923772925 1:236953155-236953177 CCATCCTCTGTCCTTGTTCACAG No data
Right 923772929 1:236953181-236953203 ACGAGGCTCACCACACATCCAGG No data
923772925_923772931 17 Left 923772925 1:236953155-236953177 CCATCCTCTGTCCTTGTTCACAG No data
Right 923772931 1:236953195-236953217 ACATCCAGGCCATCGTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923772925 Original CRISPR CTGTGAACAAGGACAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr