ID: 923774454

View in Genome Browser
Species Human (GRCh38)
Location 1:236966015-236966037
Sequence AGCCCTGTTTTGTAAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923774454_923774458 -1 Left 923774454 1:236966015-236966037 CCTCTTCCTTACAAAACAGGGCT No data
Right 923774458 1:236966037-236966059 TCATCTGGGAAACATTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923774454 Original CRISPR AGCCCTGTTTTGTAAGGAAG AGG (reversed) Intergenic
No off target data available for this crispr